Genetically engineered bacterium of high-yield gibberellin GA3, construction method and application

Abstract

The invention provides a genetically engineered bacterium for producing gibberellin GA3 at high yield, a construction method and application. According to the invention, a key phospholipid synthesis regulation factor ino2 in gibberella zeylanica is enhanced and expressed, and a transcription inhibition factor opi1 and a pah1 gene for coding phosphatidic acid phosphatase are knocked out by adopting a CRISPR-Cas9 gene editing technology, so that the area amplification of the endoplasmic reticulum is stimulated, the synthesis and folding capabilities of endoplasmic reticulum protein are enhanced, and the metabolic limitation of limited enzyme abundance is relieved; and the yield of GA3 is further improved. Compared with a wild type, the reformed recombinant gibberella fujikuensis has the advantages that the endoplasmic reticulum area is enlarged, so that enrichment of recombinant terpenoid biosynthase in the endoplasmic reticulum is stimulated, accumulation of GA3 is finally improved, the gibberellin GA3 production level of a strain with the optimal performance is improved by 31.5% compared with that of an original strain, the gibberellin GA3 production capacity is remarkably improved, and the production cost is reduced. And a feasible route is provided for construction of high-yield GA3 engineering strains.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a method for constructing a genetically engineered bacterium with high gibberellin GA3 production, the constructed genetically engineered bacterium, and application of the genetically engineered bacterium in producing gibberellin GA3. Background Art

[0002] Gibberellin Acid (GA3) is an important plant hormone derived from a tetracyclic skeleton of diterpenoid acid synthesized by plants and some fungi. It has a molecular formula of C19H22O6, a molecular weight of 346.37, a melting point of 233-235°C, and is easily soluble in alcohols, acetone, ethyl acetate, sodium bicarbonate solution, and a phosphate buffer solution with a pH of 6.2, but is difficult to dissolve in water and ether. The synthesis site of GA3 in Gibberellin is in the cytoplasm. Its biosynthesis starts from acetyl-CoA synthesized by the TCA cycle, and synthesizes isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl diphosphate (DMAPP) through mevalonic acid (MVA). Subsequently, the precursor dimethyl pyrophosphate (GGPP) is synthesized by synthase through geranyl pyrophosphate (GPP) and farnesyl pyrophosphate (FPP). Under the action of the gibberellin synthesis gene cluster, two molecules of GGPP are cyclized to synthesize copapyrophosphate (CPP), and then kaurene is produced. P450 monooxygenase gradually oxidizes kaurenoic acid at C-19, and then produces GA12-semialdehyde through oxidation at C-7α and C-6β. P450 monooxygenase produces GA14 under oxidation at C-3β and C-7. GA14 is converted to GA4 by oxidation, GA7 is produced by desaturation, and GA3 is converted by hydroxylation. As early as the 1930s, scientists discovered gibberellins in the secondary metabolites of Gibberella fujikura. Gibberellins are one of the most important plant growth regulators and are increasingly widely used in agricultural production. They have broad market prospects, but their high industrial production costs seriously restrict their widespread application. As a secondary metabolite, GA3 is generally obtained by liquid fermentation, solid fermentation and plant extraction. At present, the production of GA3 mainly relies on liquid deep fermentation or solid fermentation. In recent years, the use of biotechnology to increase the production of gibberellins has become a research hotspot.

[0003] The microbial fermentation method for synthesizing terpenoids has the remarkable characteristic of short cycle, and is both green and natural, economical and environmentally friendly, and is a production route with significant competitive advantages. However, terpenoids in wild-type microbial cells are usually intermediate products of metabolism, so the content in cells is generally low, and biotechnology transformation is needed to significantly improve the efficiency of cell synthesis. Summary of the invention

[0004] In order to solve the problem of low synthesis efficiency of gibberellin GA3 produced by microbial fermentation in the prior art, the present invention provides a method for constructing a genetically engineered bacterium with high gibberellin GA3 production by metabolic engineering technology, which utilizes endoplasmic reticulum amplification to increase the production of gibberellin GA3 of Gibberella fujikura. The genetically engineered bacterial strain with the best performance after transformation has a 31.5% increase in the level of gibberellin GA3 produced by fermentation compared to the starting strain, significantly improving the production capacity of gibberellin GA3, and providing a feasible route for the construction of high-yield GA3 engineering strains.

[0005] The technical solution adopted by the present invention is: a method for constructing a genetically engineered bacterium with high gibberellin GA3 production, characterized in that the method comprises: using CRISPR-Cas9 gene editing technology to: knock out the transcription inhibitor opi1, and / or knock out the phosphatidic acid phosphatase encoding gene pah1, ​​and / or enhance the expression of the phospholipid synthesis regulatory factor ino2 in the genome of the chassis bacteria, so as to construct a genetically engineered bacterium with high gibberellin GA3 production.

[0006] The biosynthetic pathway of GA3 is a complex process involving multiple enzymes. FPP formed through the MVA pathway is considered to be a common precursor of terpenoids such as GA3. The conversion from FPP to GA3 is catalyzed by four cytochrome P450 enzymes (P450s) in sequence to form GA3. Therefore, the study of key enzymes and enzyme genes in the pathway is essential to achieve targeted regulation of GA3. As membrane-bound proteins, it is also very important to consider the actual compartments of P450 enzymes in heterologous chassis, which will significantly affect the expression of related proteins and the subsequent catalytic ability. Most P450s are naturally located in the endoplasmic reticulum (ER). As the active site of protein folding, the ER provides a microenvironment that is optimized for efficient and accurate protein production. The ER volume space is a key determinant of protein folding ability. Therefore, ER-amplified strains provide a synthetic chassis on which new biosynthetic pathways can be implemented to construct production platform strains for the synthesis of terpenes, alkaloids, polyketides, and other products of industrial value.

[0007] Based on the above ideas, the present invention enhances the expression of ino2, a key phospholipid synthesis regulator in Gibberella fujikura, and uses CRISPR-Cas9 gene editing technology to knock out the transcriptional repressor opi1 and the pah1 gene encoding phosphatidic acid phosphatase ( Figure 1), stimulate the expansion of the endoplasmic reticulum membrane area, enhance the synthesis and folding ability of endoplasmic reticulum proteins, and alleviate the metabolic limitation of limited enzyme abundance, thereby increasing the production of GA3. Through the above transformation strategy, a recombinant Fujikura Gibberella genetically engineered bacteria with high production of gibberellin GA3 was successfully obtained. Among them, the transcriptional repressor opi1 regulates the expression of genes involved in phospholipid synthesis such as ino2. These genes respond to the abundance of phospholipid precursor phosphatidic acid in the endoplasmic reticulum. Therefore, knocking out opi1 is beneficial to the increase of phospholipid synthesis. And pah1, ​​which encodes phosphatidic acid phosphatase, will cause a sharp expansion of the endoplasmic reticulum ER, thereby stimulating the production of terpenoid chemical synthases and ultimately promoting the accumulation of terpenoid compounds. Therefore, knocking out pah1 is beneficial to the increase of GA3 production.

[0008] Preferably, the method for enhancing the expression of phospholipid synthesis regulatory factor ino2 includes: connecting the tef1 promoter and the tef1 terminator to the coding gene of the phospholipid synthesis regulatory factor ino2 to construct an ino2 gene expression frame; and replacing the original gene bik4 in the chassis bacteria genome with the ino2 gene expression frame.

[0009] Preferably, the tef1 promoter is derived from Aspergillus nidulans, and its nucleotide sequence is shown in SEQ ID NO.2.

[0010] Preferably, the tef1 terminator is derived from Aspergillus nidulans, and its nucleotide sequence is shown in SEQ ID NO.3.

[0011] Preferably, the coding gene sequence of the phospholipid synthesis regulatory factor ino2 is as shown in SEQ ID NO.1.

[0012] Preferably, the bottom plate fungus is Fusariumfujikuroi CCTCC NO:M 2019378, which has been disclosed in Chinese invention patent CN110527630A.

[0013] Preferably, the method comprises the following steps:

[0014] (1) Using CRISPR-Cas9 gene editing technology, the opi1 gene in the genome of Fusarium fujikuroi CCTCCNO:M2019378 was knocked out to construct the opi1-deficient strain GA-1;

[0015] (2) using CRISPR-Cas9 gene editing technology, the pah1 gene in the GA-1 genome in step (1) was knocked out to construct the pah1 auxotrophic strain GA-2;

[0016] (3) The tef1 promoter and the tef1 terminator are connected to the coding gene of the phospholipid synthesis regulatory factor ino2 to construct an ino2 gene expression cassette, and the ino2 gene expression cassette replaces the original gene bik4 in the GA-2 genome in step (2) to obtain the genetically engineered bacteria Fusariumfujikuroi CCTCC NO:M 2019378 overexpressing ino2, Δbik4::ino2Δopi1Δpah1, ​​recorded as GA-3, which is the genetically engineered bacteria for high-yield gibberellin GA3.

[0017] The present invention also provides a genetically engineered bacterium with high production of gibberellin GA3 obtained by the method. The recombinant Fuzura gibberellin transformed by the method has an enlarged endoplasmic reticulum membrane area compared to the wild type, thereby stimulating the enrichment of recombinant terpenoid biosynthetic enzymes in the endoplasmic reticulum and ultimately improving the accumulation of GA3.

[0018] Preferably, the genetically engineered bacteria is Fusariumfujikuroi CCTCC NO:M 2019378, Δbik4::ino2Δopi1Δpah1. As the strain with the best performance after transformation, Fusariumfujikuroi CCTCC NO:M2019378, Δbik4::ino2Δopi1Δpah1 has a 31.5% increase in the level of gibberellin GA3 produced by fermentation compared with the chassis bacteria, significantly improving the production capacity of gibberellin GA3, and providing a feasible route for the construction of high-yield GA3 engineering strains.

[0019] The invention also provides the use of the genetically engineered bacteria in preparing gibberellin GA3 by microbial fermentation.

[0020] Preferably, the application comprises: inoculating the genetically engineered bacteria into a fermentation medium, carrying out fermentation culture at 25-30°C and 200-300rpm for 150-200h to obtain a fermentation liquid containing gibberellin GA3, and separating and purifying the fermentation liquid to obtain the gibberellin GA3.

[0021] Preferably, the fermentation medium comprises: 70-90 g / L corn starch, 70-90 g / L rice flour, 10-30 g / L soybean flour, 10-30 g / L peanut flour, 0.5-1.5 g / L potassium sulfate, 0.5-1.5 g / L potassium dihydrogen phosphate, the solvent is water, and the pH is natural.

[0022] Usually, before the genetically engineered strain is fermented, the slant is activated first, and then inoculated into the seed culture medium and cultured at 25-30°C and 200-300rpm. Then the seed solution is transferred to the fermentation medium and cultured at 25-30°C and 200-300rpm. The culture solution is separated and purified to obtain gibberellin GA3. The slant activation method is: inoculate the genetically engineered bacteria in the seed culture medium, culture at 25-30°C and 200-300rpm for 2 days, spread on the PDA slant, and culture at 28°C for 4 days to obtain the seed slant. The final concentration of the seed culture medium is as follows: corn starch 10-30g / L, sucrose 10-30g / L, peanut powder 10-30g / L, soybean powder 10-30g / L, potassium dihydrogen phosphate 0.5-1.5g / L, magnesium sulfate 0.5-1.5g / L, the solvent is water, the pH is natural, and sterilized at 121°C for 30min.

[0023] The beneficial effects of the present invention are as follows: compared with the wild-type strain, the recombinant Fujikura Gibberella cells transformed by the present invention undergo endoplasmic reticulum membrane area expansion driven by the proliferation of endoplasmic reticulum sheets and lipid biosynthesis, and the cell protein synthesis capacity is enhanced after endoplasmic reticulum expansion, thereby enriching more terpenoid compound synthases, further improving the metabolic capacity, so that the engineered strain after the transformation can produce gibberellin GA3 more efficiently. The optimal strain after endoplasmic reticulum expansion transformation has a level of gibberellin GA3 fermentation production increased from 1.81 g / L to 2.38 g / L compared to the starting strain, significantly improving the gibberellin GA3 production capacity. The productivity of the engineered strain can be applied to large-scale gibberellin GA3 production. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the overall strategy diagram for the directed transformation of the endoplasmic reticulum of Gibberella fujikura according to the GA3 synthesis pathway of the present invention.

[0025] Figure 2 This is a graph of GA3 production of wild bacteria WT, genetically engineered bacteria GA-1, genetically engineered bacteria GA-2, and genetically engineered bacteria GA-3 in Example 4 of the present invention. DETAILED DESCRIPTION

[0026] The following is an explanation of the embodiments of the present invention by specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied by other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the features in the following embodiments and embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can be obtained from commercial sources.

[0027] Example 1: Knockout of opi1 gene to obtain GA-1 strain

[0028] The opi1 gene encoding a transcriptional repressor in the genome of Fusariumfujikuroi CCTCC NO: M2019378 was knocked out by the CRISPR-Cas9 system. The sgRNA-Δopi1-1 fragment was amplified using primers 1 and 2 by PCR with the sgRNA expression frame as a template. The PCR reaction conditions were as follows: 98°C, 3min; 98°C, 15s; 58°C, 15s; 72°C, 15s; repeat 30 cycles; 72°C for 3min. The sgRNA-Δopi1-2 fragment was amplified using primers 3 and 4 in the same way. The PCR products were detected by 1.0% agarose gel electrophoresis and the purified fragments were recovered by gel cutting. The two recovered DNA fragments were subjected to fusion PCR using primers 1 and 4. The PCR reaction conditions were as follows: 98°C, 3min; 98°C, 15s; 58°C, 15s; 72°C, 30s; repeat 30 cycles; 72°C for 3min. The PCR product was detected by 1.0% agarose gel electrophoresis and the purified fragment was recovered by gel excision (the nucleotide sequence is shown in SEQ ID NO.4). The upstream homologous fragment of the opi1 gene was amplified by PCR using primers 5 and 6, with the genome of Fusariumfujikuroi CCTCC NO: M 2019378 as a template. The PCR reaction conditions were as follows: 98°C, 5min; 98°C, 30s; 58°C, 30s; 72°C, 30s, repeated 30 cycles; 72°C continued for 5min. The downstream homologous fragment of the opi1 gene was amplified using primers 7 and 8 in the same way. The PCR product was detected by 1.0% agarose gel electrophoresis and the purified fragment was recovered by gel excision. The two recovered DNA fragments were subjected to fusion PCR using primers 5 and 8, and the PCR reaction conditions were as follows: 98°C, 5min; 98°C, 30s; 58°C, 30s; 72°C, 30s, repeated 30 cycles; 72°C continued for 5min. The PCR product was detected by 1.0% agarose gel electrophoresis and the purified fragment was recovered by gel cutting (the nucleotide sequence is shown in SEQ ID NO.5). The pFC332-Ffcas9 vector was used as a template and connected by a one-step cloning kit ClonExpress IIOne Step Cloning Kit (purchased from Nanjing Novazyme) to construct a pFC332-Ffcas9-Δopi1 mutant plasmid vector capable of expressing sgRNA targeting the target gene opi1. The ligation product was transformed into the E.coliDH5α recipient bacteria, coated on an LB solid plate containing a final concentration of 100mg / L ampicillin resistance, and cultured at 37°C for 12h.Single colonies were randomly picked and placed in LB liquid culture medium containing a final concentration of 100 mg / L ampicillin resistance, cultured at 37°C for 12 h, the bacteria were collected and the plasmid was extracted to obtain the pFC332-Ffcas9-Δopi1 vector, and the pFC332-Ffcas9-Δopi1 vector was transformed into the protoplasts of Gibberella fujikura.

[0029] The protoplasts of Fusarium fujikura were prepared for transformation. Wild-type Fusarium fujikura was inoculated into YPD liquid medium and cultured at 28°C for 48h. The mycelia were collected and added to the wall-breaking buffer containing a final concentration of 15mg / L compound enzyme Yatalase (purchased from Dalian Bao Biotechnology) and 15mg / L crash enzyme Driselase (purchased from Sigma), and incubated at 30°C for 3h. After filtering the buffer using Miracloth, the lower layer of liquid was collected, centrifuged at 2500rpm for 6min, the supernatant was discarded, and the precipitated cells were fully suspended with 1mL 1M sorbitol, and the protoplasts were successfully prepared. The transformed bacterial solution was applied to a CD plate containing 1mg / L hygromycin, cultured at 28°C for 6-8 days, and a single colony was picked to extract the genome. The genome was used as a template, and PCR was performed with primers 9 and 10. A DNA band of 1488bp was observed in the 1.0% agarose gel to confirm the deletion of the opi1 gene. The confirmed strain was cultured in a YPD liquid medium containing hygromycin at 28°C for 2 days to remove the pFC332-Ffcas9-Δopi1 vector, and the genetically engineered bacteria Fusariumfujikuroi CCTCC NO:M 2019378, Δopi1, were obtained and designated as GA-1.

[0030] Table 1: Primer sequences

[0031]

[0032] Example 2: Knockout of the pah1 gene to obtain the GA-2 strain

[0033] The pah1 gene encoding phosphatidic acid phosphatase in the genome of Fusariumfujikuroi CCTCC NO: M2019378 was knocked out by the CRISPR-Cas9 system. The sgRNA-Δpah1-1 fragment was amplified using primers 11 and 12 by PCR with the sgRNA expression frame as a template. The PCR reaction conditions were as follows: 98°C, 3min; 98°C, 15s; 58°C, 15s; 72°C, 15s; repeated 30 cycles; 72°C continued for 3min. The sgRNA-Δpah1-2 fragment was amplified using primers 13 and 14 in the same way. The PCR product was detected by 1.0% agarose gel electrophoresis and the purified fragment was recovered by gel excision. The two recovered DNA fragments were subjected to fusion PCR using primers 11 and 14. The PCR reaction conditions were as follows: 98°C, 3min; 98°C, 15s; 58°C, 15s; 72°C, 30s; repeated 30 cycles; 72°C continued for 3min. The PCR product was detected by 1.0% agarose gel electrophoresis and the gel was cut to recover the purified fragment (the nucleotide sequence is shown in SEQ ID NO.6). The upstream homologous fragment of the pah1 gene was amplified by PCR using primers 15 and 16, using the genome of Fusariumfujikuroi CCTCC NO: M 2019378 as a template. The PCR reaction conditions were as follows: 98°C, 5min; 98°C, 30s; 58°C, 30s; 72°C, 30s; repeated 30 cycles; 72°C continued for 5min. The downstream homologous fragment of the pah1 gene was amplified using primers 17 and 18 in the same way, and the PCR product was detected by 1.0% agarose gel electrophoresis and the purified fragment was recovered by gel cutting. The two recovered DNA fragments were subjected to fusion PCR using primers 15 and 18, and the PCR reaction conditions were as follows: 98°C, 5min; 98°C, 30s; 58°C, 30s; 72°C, 30s; repeat 30 cycles; 72°C for 5min. The PCR product was detected by 1.0% agarose gel electrophoresis and the purified fragment was recovered by gel cutting (the nucleotide sequence is shown in SEQ ID NO.7). The pFC332-Ffcas9 vector was used as a template and connected by a one-step cloning kit ClonExpress IIOne Step Cloning Kit (purchased from Nanjing Vazyme) to construct a pFC332-Ffcas9-Δpah1 mutant plasmid vector capable of expressing sgRNA targeting the target gene pah1. The ligation product was transformed into the E. coli DH5α recipient bacteria, spread on a LB solid plate containing ampicillin resistance at a final concentration of 100 mg / L, and cultured at 37°C for 12 h.Single colonies were randomly picked and placed in LB liquid culture medium containing a final concentration of 100 mg / L ampicillin resistance, cultured at 37°C for 12 h, the bacteria were collected and the plasmid was extracted to obtain the pFC332-Ffcas9-Δpah1 vector, and the pFC332-Ffcas9-Δpah1 vector and the recovered DNA fragment were transformed into the protoplasts of Gibberella fujikura.

[0034] Preparation of protoplasts of engineered strain GA-1 for transformation: Inoculate engineered strain GA-1 in YPD liquid medium and culture at 28°C for 48h. Collect hyphae and add to wall-breaking buffer containing 15mg / L compound enzyme Yatalase (purchased from Dalian Bao Biotechnology) and 15mg / L crash enzyme Driselase (purchased from Sigma) at a final concentration, and incubate at 30°C for 3h. After filtering the buffer using Miracloth, collect the lower layer of liquid, centrifuge at 2500rpm for 6min, discard the supernatant, and fully suspend the precipitated cells with 1mL 1M sorbitol, and protoplasts are successfully prepared. Apply the transformed bacterial solution to a CD plate containing 1mg / L hygromycin, culture at 28°C for 6-8 days, pick a single colony to extract the genome, use the genome as a template, perform PCR with primers 19 and 20, and observe the presence of a 1486bp DNA band in 1.0% agarose gel to confirm the deletion of the pah1 gene. The confirmed strain was cultured in a YPD liquid medium containing hygromycin at 28°C for 2 days to remove the pFC332-Ffcas9-Δpah1 vector, and the genetically engineered bacterium Fusariumfujikuroi CCTCC NO:M 2019378, Δopi1Δpah1, ​​was obtained and designated as GA-2.

[0035] Table 2: Primer sequences

[0036] Primer 11 GTTTCCGCTGAGGGTTTAATCATACGACCAAAGGTAGTG Primer 12 CTGTTATGTGTTGGGCGAGACATACAACAGCGGGGATTCG Primer 13 TCTCGCCCAACACATAACAGGTTTTAGAGCTAGAAATAGCAA Primer 14 CCAGGATTGGAGAAGTGGTTAAAAAAAAAGCACCGACTCGGT Primer 15 AACCACTTCTCCAATCCTGGT Primer 16 CTTTCCTTCACTTCACTTTAATTAACTTGCCTCTTACGGCAGAGG Primer 17 AGTGAAGTGAAGGAAAGCTAAG Primer 18 TGTCTCGGCTGAGGTCTTAGGAGATCCGACTTAACTACTT Primer 19 GGTACTACGGCAGTGTCATG Primer 20 CCTGAGAGTGTTGGCGACTA

[0037] Example 3: Enhanced expression of ino2 gene to obtain GA-3 strain

[0038] The tef1 promoter fragment was amplified by PCR using primers 21 and 22 with the Aspergillus nidulans genome as a template. The PCR reaction conditions were as follows: 98°C, 5min; 98°C, 30s; 58°C, 30s; 72°C, 30s; 30 cycles were repeated; 72°C was continued for 5min. The tef1 terminator fragment was amplified using primers 23 and 24 in the same manner. The PCR product was detected by 1.0% agarose gel electrophoresis and the purified fragment was recovered by gel excision (the nucleotide sequences of the tef1 promoter fragment and the tef1 terminator fragment are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively). The ino2 gene fragment was amplified by PCR using primers 25 and 26, with the genome of Fusariumfujikuroi CCTCC NO:M2019378 as a template. The PCR reaction conditions were as follows: 98°C, 8min; 98°C, 30s; 58°C, 30s; 72°C, 1min; repeated 30 cycles; 72°C continued for 8min. The PCR product was detected by 1.0% agarose gel electrophoresis and the gel was cut to recover the purified fragment (the nucleotide sequence is shown in SEQ ID NO.1). The two recovered DNA fragments (ino2 gene, tef1 terminator) were subjected to fusion PCR using primers 24 and 25. The PCR reaction conditions were as follows: 98°C, 8min; 98°C, 30s; 58°C, 30s; 72°C, 5min; repeated 30 cycles; 72°C continued for 8min. The PCR product was detected by 1.0% agarose gel electrophoresis and the gel was cut to recover the purified fragment (the nucleotide sequence is shown in SEQ ID NO.8). Using the PFC332-Δbik4 vector as a template, the tef1 promoter fragment and the fusion PCR fragment were connected by a one-step cloning kit ClonExpressⅡOne Step CloningKit (purchased from Nanjing Vazyme) to construct the PFC332-Δbik4-Ptef1-ino2-Ttef1 vector, and the ligation product was transformed into the E. coli DH5α recipient bacteria, spread on an LB solid plate containing a final concentration of 100 mg / L ampicillin resistance, and cultured at 37°C for 12 hours. Single colonies were randomly picked to LB liquid culture medium containing a final concentration of 100 mg / L ampicillin resistance, cultured at 37°C for 12 hours, and the bacteria were collected and the plasmid was extracted to obtain the PFC332-Δbik4-Ptef1-ino2-Ttef1 vector.

[0039] The protoplasts of the engineered strain GA-2 were prepared for transformation. The engineered strain GA-2 was inoculated into YPD liquid medium and cultured at 28°C for 48h. The mycelia were collected and added to the wall-breaking buffer containing a final concentration of 15mg / L compound enzyme Yatalase (purchased from Dalian Bao Biotechnology) and 15mg / L crash enzyme Driselase (purchased from Sigma), and incubated at 30°C for 3h. After filtering the buffer using Miracloth, the lower layer of liquid was collected, centrifuged at 2500rpm for 6min, the supernatant was discarded, and the precipitated cells were fully suspended with 1mL 1M sorbitol. The protoplasts were successfully prepared. The transformed bacterial solution was applied to a CD plate containing 1mg / L hygromycin, cultured at 28°C for 6-8 days, and a single colony was picked to extract the genome. The genome was used as a template and PCR was performed with primers 27 and 28. The confirmed strain was cultured in a YPD liquid medium containing hygromycin at 28°C for 2 days to remove the PFC332-Δbik4-Ptef1-ino2-Ttef1 vector, and the genetically engineered bacterium Fusarium fujikuroi CCTCC NO: M2019378, Δbik4::ino2Δopi1Δpah1, ​​was obtained and designated as GA-3.

[0040] Table 3: Primer sequences

[0041] Primer 21 TGCTTATCTCGCTCACTACCCGAGACAGCAGAATCACCGC Primer 22 GGTGAAGGTTGTGTTATGTTTTG Primer 23 GCGGACATTCGATTTATGCCG Primer 24 ATAGCCGTCCAGTCTAAATGTATTGGGATGAATTTTGTATGC Primer 25 AACATAACACAACCTTCACCATGCTCGCCGTACAGCACG Primer 26 GGCATAAATCGAATGTCCGCTCAGATGCGCCCTTCTAACG Primer 27 GCGAGCAGTGGCATGGAATA Primer 28 GATGGAAGGTCGATGAGAGC

[0042] Example 4: Shake flask fermentation verification of different genotypes of gibberellin GA3-producing engineered bacteria

[0043] The genetically engineered bacteria constructed in Examples 1 to 3 were respectively applied to the microbial fermentation to prepare gibberellin GA3.

[0044] (1) Strain culture and fermentation

[0045] The modified strains and the starting strain constructed in Examples 1, 2, 3, and 4 were inoculated into 25 mL of seed culture medium, respectively, and cultured at 28°C and 250 rpm as pre-culture. After 48 hours, 2.8 mL of pre-culture was inoculated into a 500 mL shake flask containing 40 mL of fermentation medium, and then cultured at 28°C and 250 rpm for 7 days. During the fermentation process, the GA3 content in the fermentation broth changed as follows: Figure 2 As shown. The seed culture medium was prepared as follows: 20 g / L corn starch, 20 g / L sucrose, 20 g / L peanut powder, 20 g / L soybean powder, 1.0 g / L potassium dihydrogen phosphate, 1.0 g / L magnesium sulfate, natural pH, sterilized at 121°C for 30 min. The fermentation medium composition: 80 g / L corn starch, 80 g / L rice flour, 20 g / L soybean powder, 20 g / L peanut powder, 1.0 g / L potassium sulfate, 1.0 g / L potassium dihydrogen phosphate, the solvent is tap water, the pH is natural, and sterilized at 121°C for 30 min.

[0046] (2) GA3 yield detection

[0047] Take 2mL of the fermentation broth of the strain obtained in step (1) of this implementation, centrifuge at 13000rpm for 8min to obtain the supernatant for use. Dissolve the GA3 standard (Yuanye Biotechnology Co., Ltd.) in methanol, prepare 250mg / L, 500mg / L, 1000mg / L, 1500mg / L, 2000mg / L, and 2500mg / L standard solutions respectively, and perform quantitative analysis by HPLC. Read the corresponding peak area at 210nm, and use linear fitting to obtain the concentration-peak area standard curve equation. The liquid chromatography conditions: injection volume 20μL, chromatographic column is Yuexu Technology Co., Ltd.'s C18 column, specifications 5μm×250mm×4.6mm. Mobile phase A liquid is 40% methanol, B liquid is 10% methanol, C liquid is pure methanol, flow rate: 1mL / min. The ultraviolet detection wavelength is 210nm, and the column temperature is 40℃.

[0048] To determine the yield of GA3, 0.02 mL of the supernatant in step (2) was taken and filtered with a 0.22 μm filter membrane for HPLC analysis. The peak areas corresponding to the GA3 produced by wild fungus Fusariumfujikuroi CCTCC NO:M 2019378, genetically engineered bacteria GA-1, genetically engineered bacteria GA-2, and genetically engineered bacteria GA-3 after HPLC were measured and input into the standard curve equation to obtain the yield of the four strains. The results are shown in Figure 2 As shown, the modified engineered strains can increase the production of GA3, and the engineered strain GA-3 has the highest yield of 2.38g / L, which is 1.31 times the yield of the wild strain Fusariumfujikuroi CCTCC NO:M 2019378 (1.81g / L). In addition, the yield of the genetically engineered strain GA-1 is 2.06g / L, which is 1.14 times that of the wild strain; the yield of the genetically engineered strain GA-2 is 2.02g / L, which is 1.12 times that of the wild strain.

[0049] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may be modified and varied in various ways. Any modification, equivalent substitution, improvement, etc. made within the spirit and principle of the present invention, such as replacement of a strong promoter, codon optimization of ino2 / opi1 / pah1, ​​and homologous replacement of ino2 / opi1 / pah1 homologous proteins (similarity of more than 80%), shall be included in the protection scope of the present invention.

Claims

1. A method for constructing a genetically engineered bacterium that produces high yields of gibberellin GA3, characterized in that: The method comprises: using CRISPR-Cas9 gene editing technology to: knock out the transcription inhibitor opi1, and / or knock out the phosphatidic acid phosphatase encoding gene pah1, ​​and / or enhance the expression of the phospholipid synthesis regulatory factor ino2 in the genome of the chassis bacteria, so as to construct a genetically engineered bacterium with high production of gibberellin GA3.

2. The method according to claim 1, characterized in that The method for enhancing the expression of phospholipid synthesis regulatory factor ino2 includes: connecting the tef1 promoter and the tef1 terminator to the coding gene of the phospholipid synthesis regulatory factor ino2 to construct the ino2 gene expression frame; and replacing the original gene bik4 in the chassis bacteria genome with the ino2 gene expression frame.

3. The method according to claim 2, characterized in that The tef1 promoter is derived from Aspergillus nidulans, and its nucleotide sequence is shown in SEQ ID NO.2; The tef1 terminator is derived from Aspergillus nidulans, and its nucleotide sequence is shown in SEQ ID NO.

3.

4. The method according to claim 1, characterized in that The coding gene sequence of the phospholipid synthesis regulatory factor ino2 is shown in SEQ ID NO.

1.

5. The method according to any one of claims 1 to 4, characterized in that: The bottom plate fungus is Fusariumfujikuroi CCTCC NO:M 2019378.

6. A genetically engineered bacterium with high production of gibberellin GA3 obtained by the method according to any one of claims 1 to 5.

7. The genetically engineered bacterium according to claim 6, characterized in that The genetically engineered bacteria is Fusariumfujikuroi CCTCC NO:M 2019378, Δbik4::ino2Δopi1Δpah1.

8. Use of the genetically engineered bacteria as claimed in claim 6 in the preparation of gibberellin GA3 by microbial fermentation.

9. The use according to claim 8, characterized in that The application includes: inoculating the genetically engineered bacteria into a fermentation medium, carrying out fermentation culture at 25-30°C and 200-300rpm for 150-200h to obtain a fermentation liquid containing gibberellin GA3, and separating and purifying the fermentation liquid to obtain the gibberellin GA3.

10. The use according to claim 9, characterized in that The fermentation medium comprises: 70-90 g / L corn starch, 70-90 g / L rice flour, 10-30 g / L soybean flour, 10-30 g / L peanut flour, 0.5-1.5 g / L potassium sulfate, 0.5-1.5 g / L potassium dihydrogen phosphate, the solvent is water, and the pH is natural.

Images