Marker and probe composition for detecting benign and malignant pulmonary nodules and application of marker and probe composition

Abstract

The invention provides a marker for detecting benign and malignant pulmonary nodules, and the marker is a CSMD2 gene and / or a TRPM4 gene. The marker can be used for screening benign and malignant pulmonary nodules. The composition is used for screening asymptomatic people in a non-invasive mode, harm caused by invasive detection is reduced, and the composition has higher sensitivity and accuracy and can achieve real-time monitoring.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a marker and a probe composition for detecting benign or malignant pulmonary nodules and their application. Background Art

[0002] Lung cancer is one of the most confirmed cancers in the world. High-risk groups include those over 65 years old who have one or more of the following risk factors. Risk factors include: heavy smoking, a history of smoking, family history, chest radiotherapy, and carcinogens. Due to the lack of obvious symptoms in the early stages of lung cancer, patients are generally diagnosed in the middle and late stages of lung cancer (stage III, IV). However, a large number of studies have shown that patients with lung cancer diagnosed in the early stages have a higher survival rate. The five-year survival rate of patients diagnosed in stage I lung cancer is 13 times higher than that of patients diagnosed in stage IV lung cancer. Therefore, early detection and diagnosis of lung tumors are crucial to improving the survival rate of lung cancer patients.

[0003] Low-dose computed tomography thoracic scan (LDCT) for detecting lung nodules is the most common diagnostic method for detecting lung tumors today. Surgical resection of lung nodules determined by imaging can effectively reduce the mortality rate of lung cancer by 20%-39%. However, approximately 15%-35% of lung nodules, which are initially determined to be high-risk lung nodules by LDCT imaging, are finally confirmed to be pathologically harmless after surgical resection. Therefore, imaging detection has certain limitations. The diagnosis of malignant lung tumors based solely on imaging test results increases some unnecessary surgeries, causing unnecessary surgical risks and complications for patients, and increasing the burden of medical expenses. Therefore, it is particularly important to judge the benign or malignant nature of lung nodules in people who are determined to be at high risk of lung cancer based solely on imaging. Summary of the invention

[0004] The disadvantages of low-dose chest CT are as follows: it is difficult to detect lesions and tiny lesions in hidden parts of the lungs; if the shadow of the tumor overlaps with the heart shadow, it is difficult to tell that it is a tumor, and the misdiagnosis rate is very high; if chest X-rays are used to screen lung cancer, when lesions can be found on the film, most of them are already in the middle and late stages of lung cancer; the diagnosis of malignant lung tumors based solely on imaging test results increases some unnecessary surgeries, causing patients unnecessary surgical risks and complications, and increasing the burden of medical expenses.

[0005] The technical solution of this application is as follows:

[0006] 1. A marker for detecting benign or malignant pulmonary nodules, wherein the marker is the CSMD2 gene and / or the TRPM4 gene.

[0007] 2. The marker according to item 1, wherein

[0008] The target sequence of the CSMD2 gene is as shown in any one of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:19, or the target sequence of the CSMD2 gene includes the sequence shown in any one of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:19; or

[0009] The target sequence of the TRPM4 gene is as shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:20, or the target sequence of the TRPM4 gene includes the sequence shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:20.

[0010] 3. A probe composition, wherein the probe composition comprises a probe targeting the methylation of the marker described in any one of item 1 or 2.

[0011] 4. The probe composition according to item 3, wherein

[0012] The probe composition comprises a first hypermethylated probe composition and a second hypomethylated probe composition, wherein the first probe composition is used for hybridizing with a CG hypermethylated region converted by bisulfite, and the second probe composition is used for hybridizing with a CG hypomethylated region converted by bisulfite.

[0013] 5. The probe composition according to item 4, wherein

[0014] The first probe composition includes n probes, and the n probes hybridize to each nucleotide of the sense strand and / or antisense strand of the CG hypermethylated region converted by bisulfite;

[0015] Preferably,

[0016] The second probe composition includes m probes, and the m probes hybridize to each nucleotide of the sense strand and / or antisense strand of the CG hypomethylated region converted by bisulfite;

[0017] More preferably,

[0018] Both n and m are any integers from 1 to 10.

[0019] 6. The probe composition according to item 5,

[0020] There are x1 nucleotide overlaps between the n-1th probe and the nth probe, and preferably, x1 is any integer between 0 and 100;

[0021] Preferably,

[0022] There are x2 nucleotide overlaps between the m-1th probe and the mth probe, and preferably, x2 is any integer between 0-100.

[0023] 7. The probe composition according to item 6, wherein

[0024] The first probe composition includes the nucleotide sequence shown in SEQ ID NO: 3-6;

[0025] The second probe composition includes the nucleotide sequences shown in SEQ ID NOs: 7-10.

[0026] 8. Use of a nucleic acid for detecting a marker in preparing a kit for detecting benign and malignant pulmonary nodules, wherein the marker is the CSMD2 gene and / or the TRPM4 gene.

[0027] 9. The use according to item 8, wherein

[0028] The target sequence of the CSMD2 gene is as shown in any one of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:19, or the target sequence of the CSMD2 gene includes the sequence shown in any one of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:19; or

[0029] The target sequence of the TRPM4 gene is as shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:20, or the target sequence of the TRPM4 gene includes the sequence shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:20.

[0030] 10. The use according to item 8 or 9, wherein the nucleic acid is used to target methylated markers of benign and malignant pulmonary nodules.

[0031] 11. The use according to any one of items 8 to 10, wherein the nucleic acid is the probe composition according to any one of items 3 to 7.

[0032] 12. The use according to any one of items 8 to 10, wherein the nucleic acid comprises:

[0033] A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the CSMD2 gene or the TRPM4 gene, and the fragment contains at least one CpG dinucleotide sequence;

[0034] Preferably, the nucleic acid further comprises:

[0035] A probe that hybridizes with at least a 15-nucleotide fragment in the target sequence of the CSMD2 gene or TRPM4 gene under moderately stringent or stringent conditions, wherein the fragment contains at least one CpG dinucleotide sequence.

[0036] 13. The use according to any one of items 8 to 12,

[0037] Wherein, the nucleic acid further comprises:

[0038] Blockers that preferentially bind to target sequences in their unmethylated state.

[0039] 14. A composition for detecting benign or malignant pulmonary nodules, wherein the composition comprises a nucleic acid for detecting methylation of the CSMD2 gene or the TRPM4 gene.

[0040] 15. The composition according to item 14, wherein

[0041] The target sequence of the CSMD2 gene is as shown in any one of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:19, or the target sequence of the CSMD2 gene includes the sequence shown in any one of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:19; or

[0042] The target sequence of the TRPM4 gene is as shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:20, or the target sequence of the TRPM4 gene includes the sequence shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:20.

[0043] 16. The composition according to item 14 or 15, wherein the nucleic acid comprises the probe composition according to any one of items 3 to 7.

[0044] 17. The composition according to item 14 or 15, wherein the nucleic acid comprises:

[0045] A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the CSMD2 gene or the TRPM4 gene, and the fragment contains at least one CpG dinucleotide sequence;

[0046] Preferably, the nucleic acid further comprises:

[0047] A probe that hybridizes with at least a 15-nucleotide fragment in the target sequence of the CSMD2 gene or TRPM4 gene under moderately stringent or stringent conditions, wherein the fragment contains at least one CpG dinucleotide sequence.

[0048] 18. A composition according to any one of items 14-17, further comprising an agent for converting the unmethylated cytosine base at position 5 of the target sequence of the CSMD2 gene or TRPM4 gene into uracil.

[0049] 19. The composition according to any one of items 14-18, wherein the nucleic acid further comprises:

[0050] Blockers that preferentially bind to target sequences in their unmethylated state.

[0051] 20. A kit comprising a reagent for detecting the marker described in Item 1 or 2, the probe composition described in Item 3 to 7, or the composition described in any one of Items 14 to 19.

[0052] 21. A chip comprising a reagent for detecting the marker described in Item 1 or 2, the probe composition described in Item 3-7, or the composition described in any one of Items 14-19.

[0053] Compared with the prior art, the beneficial effects of this application are:

[0054] The inventors of the present application used epigenomic and bioinformatics techniques to analyze the whole genome methylation data of benign and malignant lung nodules, and found two methylation genes related to benign and malignant lung nodules, and determined the target sequence of the methylation genes of benign and malignant lung nodules where methylation abnormalities occurred. Moreover, through the target sequence of this methylation gene, the methylation status of the gene can be sensitively and specifically detected, which can be used for the detection of free DNA in peripheral blood.

[0055] The composition described in the present application is used for screening asymptomatic people in a non-invasive manner, reducing the harm caused by invasive testing. The composition has higher sensitivity and accuracy and can achieve real-time monitoring. DETAILED DESCRIPTION

[0056] The present application is further described below in conjunction with examples. It should be understood that the examples are only used to further describe and illustrate the present application and are not used to limit the present application.

[0057] Unless otherwise defined, the technical and scientific terms in this specification have the same meaning as those generally understood by those skilled in the art. Although similar or identical methods and materials as described herein may be used in experiments or practical applications, materials and methods are described herein below. In the event of a conflict, the present specification including the definitions therein shall prevail. In addition, materials, methods and examples are provided for illustration only and are not restrictive. The present application is further described below in conjunction with specific embodiments, but is not intended to limit the scope of the present application.

[0058] In this application, nodules are a multi-system, multi-organ granulomatous disease of unknown etiology, often invading organs such as the lungs, bilateral hilar lymph nodes, eyes, and skin. Pulmonary micronodules or small nodules are pulmonary nodules with a nodule size of less than 10 mm. Pulmonary nodules can be malignant or benign, and malignant pulmonary nodules are also called lung cancer.

[0059] In the present application, the marker can be a nucleic acid molecule or its expression product. The nucleic acid molecule can be a nucleic acid molecule isolated from an animal, or can be an artificially synthesized nucleic acid molecule having an animal genome fragment sequence.

[0060] In the present application, methods for detecting gene expression levels are well known in the art, such as PCR, DNA sequencing, RNA sequencing, DNA hybridization, RNA hybridization, Southern, Western, immunoprecipitation, ELISA, restriction endonuclease analysis, high-resolution melting curve method, and mass spectrometry.

[0061] In the present application, the reagents used in the above-mentioned methods for detecting gene expression levels are well known in the art. Exemplarily, the reagents for detecting gene expression levels may include one or more of the following: buffer, polymerase, dNTP, primer, probe, restriction endonuclease, fluorescent dye, fluorescence quencher, fluorescent reporter, exonuclease, alkaline phosphatase, internal standard, control. In the detection method involving DNA amplification, the detection reagent includes a primer. The reagent for detecting gene expression levels can also be a polypeptide probe such as an antibody. The polypeptide probe specifically binds to the expression product of the nucleic acid molecule described herein, for example, the polypeptide probe is an antibody that specifically binds to the expression product of the nucleic acid molecule described in the first aspect of the present invention. The reagent for detecting gene expression levels can also be a nucleic acid probe. The nucleic acid probe described herein can hybridize with the genomic sequence, coding sequence, RNA sequence or cDNA sequence of the gene described herein under stringent conditions. The stringent conditions for nucleic acid hybridization are known to those skilled in the art.

[0062] In the present application, the sample is from a mammal, preferably a human. The sample may be from any organ (e.g., lung), tissue (e.g., epithelial tissue, connective tissue, muscle tissue, and neural tissue), cell (e.g., lung nodule cell), or body fluid (e.g., blood, plasma, serum, tissue fluid, urine). In an exemplary embodiment, the sample is peripheral blood.

[0063] In the present application, primer refers to a nucleic acid molecule with a specific nucleotide sequence that guides synthesis at the start of nucleotide polymerization. Primers are usually two artificially synthesized oligonucleotide sequences, one primer is complementary to a DNA template strand at one end of the target region, and the other primer is complementary to another DNA template strand at the other end of the target region, and its function is to serve as the starting point of nucleotide polymerization. Primers designed artificially in vitro are widely used in polymerase chain reaction (PCR), qPCR, sequencing, and probe synthesis. Usually, primers are designed to amplify products with a length of 50 to 150 bp, 60-140, 70-130, 80-120 bp. The primers contained in the reagents herein can be primers for genome sequencing, such as whole genome sequencing primers or sequencing primers for a certain region of the genome, or PCR primers for amplifying genes or their specific DNA regions or fragments. The design method of whole genome sequencing primers or PCR primers for a certain region or a certain site in a region is known in the art.

[0064] The present application provides a marker for detecting benign or malignant pulmonary nodules, wherein the marker is the CSMD2 gene and / or the TRPM4 gene.

[0065] In some embodiments, the target sequence of the CSMD2 gene is as shown in any one of SEQ ID NO: 1, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 19, or the target sequence of the CSMD2 gene includes the sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 19; SEQ ID NO: 1 is the nucleotide sequence of the CSMD2 gene:

[0066] CGGCCATACCACCCTGAACGTGCCTGATCTTGTCTGATCTCGGAAG CTAAGCAGGTTCAGGCCTTGTTAGTACTTGGAC (SEQ ID NO: 1).

[0067] SEQ ID NO: 19 is the reverse complementary strand of SEQ ID NO: 1: GTCCAAGTACTAACAAGGCCTGAACCTGCTTAGCTTCCGAGATCAGACAAGATCAGGCACGTTCAGGGTGGTATGGCCG (SEQ ID NO: 19)

[0068] In some embodiments,

[0069] The target sequence of the TRPM4 gene is as shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:20, or the target sequence of the TRPM4 gene includes the sequence shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:20.

[0070] SEQ ID NO: 2 is the nucleotide sequence of the TRPM4 gene:

[0071] GGGCGTGGGAGGTGAGTGGTCGAACCCATGACCCACAACCCACGACCCACAACCTGCAACCCCAGCGCTCAGGATCCCAGTAGTTTGGTCTGGTCG (SEQ ID NO: 2).

[0072] SEQ ID NO:20 is the reverse complementary strand of SEQ ID NO:2: CGACCAGACCAAACTACTGGGATCCTGAGCGCTGGGGTTGCAGGTTGTGGGTCGTGGGTTGTGGGTCATGGGTTCGACCACTCACCTCCCACGCCC (SEQ ID NO:20)

[0073] In the present application, the above sequences of SEQ ID NO: 1-SEQ ID NO: 2 and SEQ ID NO: 19-SEQ ID NO: 20 refer to sequences that have not been converted by bisulfite.

[0074] In the present application, one or more nucleotides are deleted, one or more nucleotides are added, or one or more nucleotides are replaced on the basis of the nucleotide sequences shown in SEQ ID NO:1-SEQ ID NO:2, SEQ ID NO:11-SEQ ID NO:20, but they have 90%, 91%, 92%, 93%, 94%, 95% or 96% or 97% or 98% or 99% identity with the nucleotide sequences shown in SEQ ID NO:1-SEQ ID NO:2, SEQ ID NO:11-SEQ ID NO:20, and can also be used as methylation markers of the present application, and should also be understood to be covered within the scope of protection of the present application.

[0075] The present application provides a probe composition, wherein the probe composition comprises a probe targeting the methylation of the above-mentioned marker.

[0076] In this application, the methylation refers to the methylation process of the 5th carbon atom on cytosine in CpG dinucleotides. As a relatively stable modification state, it can be inherited to the new offspring DNA during the DNA replication process under the action of DNA methyltransferase. It is an important epigenetic mechanism. When DNA is methylated, the methylation of the gene promoter region can lead to the transcriptional silencing of tumor suppressor genes, so it is closely related to the occurrence of tumors. Abnormal methylation includes high methylation of tumor suppressor genes and DNA repair genes, low methylation of repetitive sequence DNA, and loss of imprinting of certain genes, which are related to the occurrence of various tumors.

[0077] The methylation described herein may be a methylation level, a methylation degree or a methylation state. When analyzing the methylation of such a target sequence, those skilled in the art may use a quantitative measurement method to determine the methylation.

[0078] In the present application, the probe is a single-stranded or double-stranded DNA with a length ranging from tens to hundreds or even thousands of base pairs. It can utilize the molecular denaturation, renaturation and high accuracy of base complementary pairing to hydrogen bond (hybridize) with the complementary non-labeled single-stranded DNA or RNA in the sample to be tested to form a double-stranded complex (hybrid). After washing away the unpaired bound probe, the hybridization reaction result can be detected by a detection system such as radioautography or enzyme-linked reaction. In the present application, the area complementary to or hybridized with the probe is a specific target area, and multiple probes are combined into a probe composition.

[0079] In one embodiment, the probe composition of the probe targeting methylation of the CSMD2 gene comprises a first probe composition for high methylation and a second probe composition for low methylation, wherein the first probe composition is used to hybridize with a region of high methylation of CG converted by bisulfite, and the second probe composition is used to hybridize with a region of low methylation of CG converted by bisulfite.

[0080] The region with high CG methylation refers to the region where the target sequence is more methylated. Since the methylation status of each person is different, the region with extreme high CG methylation refers to the region where all CGs of the target sequence are methylated; the region with low CG methylation refers to the region where the target sequence is less methylated. In the present application, the region with extreme low CG methylation refers to the region where all CGs in the target sequence are not methylated.

[0081] The CG hypermethylated region after bisulfite conversion refers to the conversion of base C to base T after the target sequence is converted by bisulfite, but if it is a base CG, since the 5-methylcytosine residue (5mC) is resistant to it, the C in CG will not be converted, so the base C remains unchanged;

[0082] The CG hypomethylated region after bisulfite conversion means that after bisulfite conversion, since all or most of the bases CG on the target sequence are not methylated, all or most of the bases C are converted to base T.

[0083] Since the methylation status of each person is different, the sequence obtained after bisulfite conversion is also different. Here is an extreme case of this marker, that is, all CGs in this segment are in a high methylation state, and the high methylation state sequence of its complementary chain is shown:

[0084] An extreme case of the hypermethylated state of SEQ ID NO: 1 is shown in SEQ ID NO: 11:

[0085] CGGTTATATTATTTTGAACGTGTTTGATTTTGTTTGATTTCGGAAGTTAAGTAGGTTTAGGTTTTGTTAGTATTTGGAT(SEQ ID NO:11)

[0086] SEQ ID NO: 12 is the sequence of the reverse complementary strand of SEQ ID NO: 1 in a hypermethylated state:

[0087] GTTTAAGTATTAATAAGGTTTGAATTTGTTTAGTTTTCGAGATTAGATAAGATTAGGTACGTTTAGGGTGGTATGGTCG (SEQ ID NO: 12).

[0088] Similarly, since the methylation status of each person is different, an extreme case is shown here, that is, all CGs are in a low methylation state, and the low methylation state sequence of its complementary chain is also shown.

[0089] An extreme case of the low methylation state of SEQ ID NO: 1 is shown in SEQ ID NO: 15:

[0090] TGGTTATATTATTTTGAATGTGTTTGATTTTGTTTGATTTTGGAAGTTAAGTAGGTTTAGGTTTTGTTAGTATTTGGAT (SEQ ID NO: 15).

[0091] SEQ ID NO: 16 is the sequence of the reverse complementary strand of SEQ ID NO: 1 in a hypomethylated state:

[0092] GTTTAAGTATTAATAAGGTTTGAATTTGTTTAGTTTTTGAGATTAGATAAGATTAGGTATGTTTAGGGTGGTATGGTTG (SEQ ID NO: 16).

[0093] An extreme case of the hypermethylated state of SEQ ID NO:2 is shown in SEQ ID NO:13:

[0094] GGGCGTGGGAGGTGAGTGGTCGAATTTATGATTTATAATTTACGATTTATAATTTGTAATTTTAGCGTTTAGGATTTTAGTAGTTTGGTTTGGTCG (SEQ ID NO: 13).

[0095] SEQ ID NO: 14 is the sequence of the reverse complementary strand of SEQ ID NO: 2 in a hypermethylated state:

[0096] CGATTAGATTAAATTATTGGGATTTTGAGCGTTGGGGTTGTAGGTTGTGGGTCGTGGGTTGTGGGTTATGGGTTCGATTATTTTTTTTACGTTT (SEQ ID NO: 14).

[0097] Similarly, since the methylation status of each person is different, an extreme case is shown here, that is, all CGs are in a low methylation state, and the low methylation state sequence of its complementary chain is also shown.

[0098] An extreme case of the low methylation state of SEQ ID NO: 2 is shown in SEQ ID NO: 17:

[0099] GGGTGTGGGAGGTGAGTGGTTGAATTTATGATTTATAATTTATGATTTATAATTTGTAATTTTAGTGTTTAGGATTTTAGTAGTTTGGTTTGGTTG (SEQ ID NO: 17).

[0100] SEQ ID NO: 18 is the sequence of the reverse complementary strand of SEQ ID NO: 2 in a hypomethylated state:

[0101] TGATTAGATTAAATTATTGGGATTTTGAGTGTTGGGGTTGTAGGTTGTGGGTTGTGGGTTGTGGGTTATGGGTTTGATTATTTTTTTTATGTTT (SEQ ID NO: 18).

[0102] In some embodiments, the first probe composition includes n probes that hybridize to each nucleotide of the sense strand and / or antisense strand of the bisulfite-converted CG hypermethylated region.

[0103] In some embodiments, the second probe composition includes m probes that hybridize to each nucleotide of the sense strand and / or antisense strand of the bisulfite-converted CG hypomethylated region.

[0104] The present application does not impose any limitation on the number of probes in the first probe composition, the second probe composition, the third probe composition, and the fourth probe composition, and those skilled in the art may select the number as needed. For example, n and m may be any integers from 1 to 10, and n and m may be the same or different.

[0105] For example, n and m can be any integer of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0106] In some embodiments, there are x1 nucleotide overlaps between the n-1th probe and the nth probe, and preferably, x1 is any integer between 0-100.

[0107] In some embodiments, there are x2 nucleotide overlaps between the m-1th probe and the mth probe, and preferably, x2 is any integer between 0-100.

[0108] Among them, x1 and x2 can be the same or different. When x1 is 0, it indicates that the tail of the n-1th probe is connected to the head of the nth probe. Similarly, when x2 is 0, it indicates that the tail of the m-1th probe is connected to the head of the mth probe.

[0109] The present application hybridizes the probe composition with the target sequence converted by bisulfite, wherein the highly methylated first probe composition hybridizes with the CG highly methylated region, and the low-methylated second probe composition hybridizes with the CG low-methylated region, thereby being able to efficiently and accurately detect the methylation level of the target sequence, and further being able to be used for the detection of benign and malignant screening of lung nodules.

[0110] In some embodiments, the hypermethylated first probe composition comprises the nucleotide sequence shown in SEQ ID NO:3-6;

[0111] The nucleotide sequence shown in SEQ ID NO:3 is:

[0112] CTTCTTTTTCTCCTTTCTCCCGTCCAAATACTAACAAAACCTAAACCTACTTAACTTCCGAAATCAAACAAAATCAAACACGTTCAAAATAATATAACCGTAAATCTCTTTTTCTCCTTT (SEQ ID NO: 3)

[0113] The nucleotide sequence shown in SEQ ID NO:4 is:

[0114] AAAAAAAAAAAAAAATCTACGACCATACCACCCTAAACGTACCTAATCTTATCTAATCTCGAAAACTAAACAAATTCAAACCTTATTAATACTTAAACGAAAAAAAAAAAAAAAAAA (SEQ ID NO: 4).

[0115] The nucleotide sequence shown in SEQ ID NO:5 is:

[0116] TTCCCCAAATCTCGACCAAACCAAACTACTAAAATCCTAAACGCTAAAATTACAAATTATAAATCGTAAATTATAAATCATAAATTCGACCACTCACCTCCCACGCCCGTCTTCTACTAT(SEQ ID NO:5)

[0117] The nucleotide sequence shown in SEQ ID NO:6 is:

[0118] ACAACAAAAAACGAACGTAAAAAAATAAATAATCGAACCCATAACCCACAACCCACGACCCACAACCTACAACCCCAACGCTCAAAATCCCAATAATTTAATCTAATCGAAATTTAAAAAA (SEQ ID NO: 6).

[0119] In some embodiments, the hypomethylated second probe composition comprises a nucleotide sequence as shown in SEQ ID NO: 7-10;

[0120] The nucleotide sequence shown in SEQ ID NO:7 is:

[0121] CTTCTTTTTCTCCTTTCTCCCATCCAAATACTAACAAAACCTAAACCTACTTAACTTCCAAAATCAAACAAAATCAAACACATTCAAAATAATATAACCATAAATCTCTTTTTCTCCTTT(SEQ ID NO:7)

[0122] The nucleotide sequence shown in SEQ ID NO:8 is:

[0123] AAAAAAAAAAAAAAAATCTACAACCATACCACCCTAAACATACCTAATCTTATCTAATCTCAAAAACTAAACAAATTCAAACCTTATTAATACTTAAACAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 8).

[0124] The nucleotide sequence shown in SEQ ID NO:9 is:

[0125] TTCCCCAAATCTCAACCAAACCAAACTACTAAAATCCTAAACACTAAAATTACAAATTATAAATCATAAATTATAAATCATAAATTCAACCACTCACCTCCCACACCCATCTTCTACTAT(SEQ ID NO:9)

[0126] The nucleotide sequence shown in SEQ ID NO:10 is:

[0127] ACAACAAAAAACAAACATAAAAAATAAATAATCAAACCCATAACCCACAACCCACAACCCACAACCTACAACCCCAACACTCAAAATCCCAATAATTTAATCTAATCAAAATTTAAAAAA (SEQ ID NO: 10).

[0128] Specifically, the first probe composition includes the nucleotide sequence shown in SEQ ID NO: 3-4 for hybridizing with the methylation sequence of the CSMD2 gene;

[0129] The first probe composition includes the nucleotide sequence shown in SEQ ID NO: 5-6 for hybridizing with the methylation sequence of the TRPM4 gene;

[0130] The second probe composition includes the nucleotide sequence shown in SEQ ID NO:7-8 for hybridizing with the methylation sequence of the CSMD2 gene;

[0131] The second probe composition includes the nucleotide sequences shown in SEQ ID NOs: 9-10 for hybridizing with the methylation sequence of the TRPM4 gene.

[0132] The present application provides a use of a nucleic acid for detecting a marker in preparing a kit for detecting benign or malignant pulmonary nodules, wherein the marker is a CSMD2 gene and / or a TRPM4 gene.

[0133] In some embodiments, the target sequence of the CSMD2 gene is as shown in any one of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:19, or the target sequence of the CSMD2 gene includes the sequence shown in any one of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:19; or the target sequence of the TRPM4 gene is as shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:20, or the target sequence of the TRPM4 gene includes the sequence shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:20.

[0134] In some embodiments, the nucleic acid is used to target methylated markers of benign and malignant pulmonary nodules.

[0135] In some embodiments, the nucleic acid is the probe composition described above.

[0136] In some embodiments, the nucleic acid includes: a primer, which is a fragment of at least 9 nucleotides in the target sequence of the CSMD2 gene or TRPM4 gene, and the fragment contains at least one CpG dinucleotide sequence; preferably, the nucleic acid also includes: a probe, which hybridizes with a fragment of at least 15 nucleotides in the target sequence of the CSMD2 gene or TRPM4 gene under moderately stringent or stringent conditions, and the fragment contains at least one CpG dinucleotide sequence.

[0137] That is, in the present application, when the nucleic acid includes primers and probes, if the test sample NDA is converted using bisulfite, the nucleic acid includes a fragment of at least 9 nucleotides in the sequence after the target sequence of the CSMD2 gene or TRPM4 gene is converted with bisulfite, and the fragment contains at least one CpG dinucleotide sequence.

[0138] In some embodiments, the nucleic acid further comprises:

[0139] Blockers that preferentially bind to target sequences in their unmethylated state.

[0140] The blocker is used to improve the amplification specificity of the PCR amplification primer. The 5' end of the blocker nucleotide sequence has an overlap region of greater than or equal to 5 nucleotides with the 3' end nucleotide sequence of the forward or reverse primer. The blocker and the forward or reverse primer are complementary to the same strand of the target gene target sequence DNA. The melting temperature of the blocker is higher than that of the forward or reverse primer by more than (including) 5°C. The nucleotide sequence of the blocker contains at least one CpG dinucleotide sequence and is complementary to the sequence of the target gene target sequence DNA that has not been methylated after bisulfite conversion. Therefore, when the genomic DNA of the biological sample to be detected is a mixture of methylated and unmethylated states, especially when the DNA in the methylated state is far less than the DNA in the unmethylated state, the DNA in the unmethylated state will preferentially bind to the blocker after bisulfite conversion, thereby binding the DNA template to the PCR obligation, and thus no PCR amplification occurs, while the DNA in the methylated state does not bind to the blocker, and thus combines with the primer set to undergo PCR amplification, and then directly or indirectly detect the fragments obtained by amplification.

[0141] The present application provides a composition for detecting benign or malignant pulmonary nodules, wherein the composition comprises a nucleic acid for detecting methylation of a CSMD2 gene or a TRPM4 gene.

[0142] In some embodiments, the target sequence of the CSMD2 gene is as shown in any one of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:19, or the target sequence of the CSMD2 gene includes the sequence shown in any one of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:19; or the target sequence of the TRPM4 gene is as shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:20, or the target sequence of the TRPM4 gene includes the sequence shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:20.

[0143] In some embodiments, the nucleic acid comprises the above-described probe composition.

[0144] In some embodiments, the nuclear primer, the primer is a fragment of at least 9 nucleotides in the target sequence of the CSMD2 gene or TRPM4 gene, and the fragment contains at least one CpG dinucleotide sequence; preferably, the nucleic acid also includes: a probe, the probe is a fragment of at least 15 nucleotides in the target sequence of the CSMD2 gene or TRPM4 gene that hybridizes under moderately stringent or stringent conditions, and the fragment contains at least one CpG dinucleotide sequence.

[0145] In some embodiments, the composition further comprises a reagent for converting the unmethylated cytosine base at position 5 of the target sequence of the CSMD2 gene or TRPM4 gene into uracil.

[0146] In the present application, the 5-position unmethylated cytosine base refers to the cytosine that has not received a methyl group on the fifth carbon, that is, the cytosine has not undergone methylation modification.

[0147] In the present application, the reagent may be, for example, bisulfite or the like.

[0148] In some embodiments, the nucleic acid further comprises a blocker that preferentially binds to a target sequence in an unmethylated state.

[0149] The present application provides a kit comprising a reagent for detecting the marker described above, the probe composition described above, or the composition described above. In some embodiments, the kit further comprises a container for accommodating a biological sample of a subject. In some embodiments, the kit further comprises instructions for using and interpreting the test results.

[0150] In the present application, the biological sample may be, for example, whole peripheral blood, plasma or serum.

[0151] The present application does not impose any limitation on the method for detecting the methylation level of the target sequence using the above-mentioned kit, and those skilled in the art can select it as needed. For example, the present application provides a method for detecting the methylation level of the marker target sequence using the above-mentioned kit, which comprises the following steps:

[0152] Collect samples from subjects;

[0153] Extracting and purifying DNA from the sample;

[0154] Constructing a DNA library for sequencing from the purified DNA sample;

[0155] The constructed DNA library is transformed with bisulfite;

[0156] Pre-PCR amplification of the bisulfite-converted DNA library;

[0157] Using the probe composition to perform hybridization capture on the sample amplified by the pre-PCR;

[0158] Amplify the products captured by hybridization using PCR;

[0159] Perform high-throughput next-generation sequencing on the products amplified by PCR and captured by hybridization;

[0160] Analyze the sequencing data to determine the methylation level of the sample;

[0161] The threshold of each marker is calculated based on the methylation status of the existing samples, and the disease condition of the patient is judged based on the methylation level of a marker in the sample. If the methylation level of a marker in the sample exceeds the threshold, it is a lung cancer sample; if it is lower than the threshold, it is a benign lung nodule sample.

[0162] For example, the present application provides a method for detecting the methylation level of a target sequence of a marker using the above-mentioned kit, which comprises the following steps:

[0163] (1) Draw peripheral blood from the subject and separate plasma or serum;

[0164] (2) extracting free DNA from plasma or serum;

[0165] (3) treating the free DNA obtained in step (2) with a reagent to convert the unmethylated cytosine base at position 5 into uracil or other bases, that is, the unmethylated cytosine base at position 5 of the target sequence of the marker is converted into uracil or other bases, and the converted base is different from the unmethylated cytosine base at position 5 in terms of hybridization performance and is detectable;

[0166] (4) contacting the free DNA treated in step (3) with a DNA polymerase and a primer of the target sequence of the marker, so that the target sequence of the treated marker is amplified to produce an amplification product or is not amplified; if the target sequence of the treated marker undergoes a DNA polymerization reaction, an amplification product will be produced; if the target sequence of the treated marker does not undergo a DNA polymerization reaction, it will not be amplified;

[0167] (5) detecting the amplified product with a probe;

[0168] (6) Based on the presence or absence of the amplification product, determining the methylation status of at least one CpG dinucleotide of the target sequence of the marker, thereby determining the methylation level of the target sequence of the marker.

[0169] The present application provides a chip, which comprises the world for detecting the above-mentioned marker or the above-mentioned probe combination or the above-mentioned combination.

[0170] The chip is also called a gene chip. Its sequencing principle is a hybridization sequencing method, that is, a method of determining the nucleic acid sequence by hybridization with a group of nucleic acid probes of known sequences. Probes of target nucleotides with known sequences are fixed on the surface of a substrate. When the nucleic acid sequence with a fluorescent marker in the solution produces a complementary match with the nucleic acid probe at the corresponding position on the gene chip, a group of probe sequences with completely complementary sequences are obtained by determining the probe position with the strongest fluorescence intensity.

[0171] The chip is prepared mainly by using a glass sheet or a silicon sheet as a carrier, and using in-situ synthesis and micro-matrix methods to arrange oligonucleotide fragments or cDNA as probes in sequence on the carrier.

[0172] The chip described in the present application is based on signal detection of DNA sequence hybridization after bisulfite treatment. The bisulfite treatment converts non-methylated cytosine into uracil, while the methylated cytosine remains unchanged. Uracil is then converted into thymine, and finally chip hybridization is performed. Finally, the type of added base is judged according to the fluorescent color, thereby determining whether the site is methylated.

[0173] The present application provides a method for detecting benign or malignant pulmonary nodules, which comprises:

[0174] Detecting the methylation level of the markers, and

[0175] The risk of the subject suffering from pulmonary nodules is judged based on the methylation level, and the marker is the CSMD2 gene and / or the TRPM4 gene.

[0176] Example 1 Screening markers

[0177] 1) Sample collection:

[0178] Regarding the collection of lung nodule samples: plasma samples (dysplasia samples) from 56 lung cancer patients were collected from cooperating hospitals, and plasma samples from 84 patients with benign lung nodules were collected for whole genome methylation sequencing;

[0179] 2) Candidate marker analysis:

[0180] The DSS software was used to analyze the differences between patients with benign pulmonary nodules and lung cancer for the methylation sites obtained from the sequencing data. The filtering criteria were: P < 0.05, and the difference between the means of the two groups was greater than 0.1. 124 differentially methylated regions were obtained.

[0181] 3) Marker verification:

[0182] Probe capture was designed for the above 124 differentially methylated regions and verified using Boercheng plasma sample data (lung cancer sample number = 51, benign pulmonary nodule sample number = 73). Ultimately, two markers that can distinguish between benign and malignant pulmonary nodules were obtained, and their sequences are shown in SEQ ID NO: 1-SEQ ID NO: 2, respectively.

[0183] According to the obtained target sequence region, a probe composition (panel) is customized, which includes a probe composition for a methylated probe of SEQ ID NO:1, including a highly methylated first probe composition and a hypomethylated second probe composition; or a probe composition for a methylated probe of SEQ ID NO:2, including a highly methylated third probe composition and a hypomethylated fourth probe composition. Wherein, the first probe composition includes two probes, such as including nucleotide sequences as shown in SEQ ID NO:3-4; the second probe composition includes two probes, such as including nucleotide sequences as shown in SEQ ID NO:7-8; the third probe composition includes two probes, such as including nucleotide sequences as shown in SEQ ID NO:5-6; the fourth probe composition includes two probes, such as nucleotide sequences as shown in SEQ ID NO:9-10.

[0184] Then it was validated in plasma samples using Qiagen Circulating Nucleic Acid Kit was used to prepare cfDNA, catalog number 55114. METHYL-SEQ DNA LIBRARY KIT was used to prepare the library. The catalog number is 30096. The experimental detection method is as follows:

[0185] 1.1.cfDNA extraction and purification:

[0186] 1.1.1. Preparation of plasma samples:

[0187] Centrifuge the blood sample at 4°C, 2000 g for 10 min and transfer the plasma to a new centrifuge tube. Centrifuge the plasma sample at 4°C, 16000 g for 10 min and proceed to the next step depending on the type of collection tube used. The type of collection tube used in this experiment is Other.

[0188] 1.1.2. Lysis and binding:

[0189] 1.1.2.1. Pipette 100 μl, 200 μl, 300 μl, 400 μl, or 500 μl of QIAGEN Proteinase K into a 50 ml centrifuge tube.

[0190] 1.1.2.2. Add 1 ml, 2 ml, 3 ml, 4 ml, or 5 ml of plasma or serum to the above 50 ml centrifuge tube.

[0191] 1.1.2.3. Add 0.8ml, 1.6ml, 2.4ml, 3.2ml, 4.0ml Buffer ACL (containing 1.0μg carrier RNA), cover and vortex for 30s; Note: Mix thoroughly to ensure complete lysis; proceed to the next step immediately.

[0192] 1.1.2.4. Incubate at 60°C for 30 min.

[0193] 1.1.2.5. Take out the centrifuge tube, place it on the test bench, and unscrew the tube cap.

[0194] 1.1.2.6. Add 1.8ml, 3.6ml, 5.4ml, 7.2ml and 9.0ml of Buffer ACB into a 50ml centrifuge tube; cover the tube and mix for 15-30s.

[0195] 1.1.2.7. Incubate the lysis mixture on ice for 5 min.

[0196] 1.1.2.8. Insert the QIAamp Mini column into the vacuum pump connector adapter and insert the 20 ml tube extender into the column; Note: Make sure the tube extender is firmly inserted into the QIAamp Mini column to avoid sample leakage.

[0197] 1.1.2.9. Carefully add the lysate-buffer ACB mixture from step 7 to the tube extender of the QIAamp Mini column and turn on the vacuum pump. When all the lysate has been completely pumped out of the Mini column, turn off the vacuum pump and release the pressure to 0 mbar. Carefully remove and discard the tube extender.

[0198] 1.1.3. Washing:

[0199] 1.1.3.1. Add 600 μl Buffer ACW1 to the Mini column, open the cover, and start the vacuum pump; after all the liquid passes through the column membrane, turn off the vacuum pump and release the pressure to 0 mbar.

[0200] 1.1.3.2. Add 750 μl Buffer ACW2 to the Mini column, open the cover, and start the vacuum pump; after all the liquid passes through the column membrane, turn off the vacuum pump and release the pressure to 0 mbar.

[0201] 1.1.3.3. Add 750 μl of ethanol (96-100%) to the Mini column, open the lid, and start the vacuum pump; after all the liquid passes through the column membrane, turn off the vacuum pump and release the pressure to 0 mbar.

[0202] 1.1.3.4. Cover the QIAamp Mini column cap, remove it from the adapter, and discard the VacConnector. Place the QIAamp Mini column in a clean 2 ml collection tube and centrifuge at high speed (20,000 g; 14,000 rpm) for 3 min.

[0203] 1.1.3.5. Place the QIAamp Mini column in a new 2 ml collection tube. Open the tube cap and incubate at room temperature for 5 min to allow the membrane to dry completely.

[0204] 1.1.4. Elution of cfDNA:

[0205] 1.1.4.1. Place the QIAamp Mini column in a 1.5 ml elution tube and discard the 2 ml collection tube in step 1.1.3.5. Add 20-150 μl of Buffer AVE to the center of the Mini membrane; cover the tube and incubate at room temperature for 3 minutes.

[0206] 1.1.4.2. Centrifuge at full speed (20000g; 14000rpm) for 1 min to elute the nucleic acid.

[0207] For cfDNA samples, Agilent2100 performed fragment detection and Qubit was directly used for subsequent experiments.

[0208] 1.2.Bisulfite conversion and purification:

[0209] 1.2.1..Prepare CT Conversion Reagent:

[0210] 1.2.1.1. Add 700 μl NF water, 300 μl M-Dilution Buffer and 50 μl M-Dissolving Buffer to a tube of CT conversion reagent, mix well at room temperature, and vortex or shake frequently for 10 minutes.

[0211] 1.2.1.2. After mixing, divide the mixture into 10 reaction volumes.

[0212] 1.2.2. Perform bisulfite conversion on the DNA library and prepare the reaction system according to the table below.

[0213] Table 1

[0214] Components High concentration sample (1ng-2μg) volume Samples from the previous step 40ul CT Conversion Reagent 110ul Total volume 150ul

[0215] 1.2.3. Adjust the pipette to 100μl, gently pipette and mix 6 times, then divide into two tubes and place on the PCR instrument.

[0216] 1.2.4. Set the following program to perform the reaction on the PCR instrument: the heated lid temperature is 105°C.

[0217] Table 2

[0218] temperature time 98℃ 10min 64℃ 2.5h 4℃ ∞

[0219] 1.2.5. Take a new 1.5ml centrifuge tube and add 600μl of M-Binding Buffer.

[0220] 1.2.6. After PCR, transfer the two tubes of the same sample to the corresponding 1.5ml centrifuge tubes mentioned above by brief centrifugation and mix well.

[0221] 1.2.7. Add the mixed sample to Zymo-Spin TM Invert the IC Column to mix, and centrifuge at 10,000 x g for 30 s.

[0222] 1.2.8. Add 100 μl of M-Wash Buffer to the column and centrifuge at 10,000 x g for 30 s.

[0223] 1.2.9. Add 200 μl of M-Desulphonation Buffer to the column, incubate at room temperature for 15-20 min, and centrifuge at 10,000 x g for 30 s.

[0224] 1.2.10. Add 200 μl of M-Wash Buffer to the column and centrifuge at 10,000 x g for 30 s.

[0225] 1.2.11. Repeat the previous step once.

[0226] 1.2.12. Place the column in a new collection tube and centrifuge again at 10,000 x g for 30 seconds.

[0227] 1.2.13. Place the recovery column in a new 1.5 ml EP tube, add 15 μl LOW EDTA buffer to the center of the column membrane, and centrifuge at 10,000 x g for 30 seconds.

[0228] 1.3. Transformation:

[0229] 1.3.1. Preheat the PCR instrument to 95°C.

[0230] 1.3.2. Set the following program to perform the reaction on the PCR instrument: the heated lid temperature is 105°C.

[0231] Table 3

[0232] temperature time 95℃ ∞ 95℃ 2min 95℃ ∞

[0233] 1.3.3. After incubation, immediately place the test tube on ice for 2 minutes.

[0234] 1.4. Connector ligation and purification:

[0235] 1.4.1. Configure the reaction system according to the following table:

[0236] Table 4

[0237] Components volume Low EDTA TE 11.5μl Buffer G1 4μl Reagent G2 4μl Reagent G3 2.5μl Enzyme G4 1μl Enzyme G5 1μl Enzyme G6 1μl DNA 15ul Total Volume 40ul

[0238] 1.4.2. Set the following program to perform the reaction on the PCR instrument: the heated lid temperature is 105°C.

[0239] Table 5

[0240] temperature time 37℃ ∞ 37℃ 15min 95℃ 2min 4℃ ∞

[0241] 1.5. Sample extension and purification:

[0242] 1.5.1. Configure the reaction system according to the following table:

[0243] Table 6

[0244] Components volume Reagent Y1 2ul Enzyme Y2 42ul totalVolume 44ul

[0245] 1.5.2. Set the following program to perform the reaction on the PCR instrument: the heated lid temperature is 105°C.

[0246] Table 7

[0247] temperature time 98℃ ∞ 98℃ 1min 62℃ 2min 65℃ 5min 4℃ ∞

[0248] 1.5.3. DNA protection buffer is added to the liquid and turns blue. Gently pipette to mix, then divide into two tubes and place on the PCR instrument.

[0249] 1.5.4. Set the following program and run: Heated lid 105°C.

[0250] Table 8

[0251] temperature time 95℃ 5min 60℃ 10min 95℃ 5min 60℃ 10min 4℃ ∞

[0252] 1.5.5. Prepare the purification system according to the following table:

[0253] Table 9

[0254] Input Reaction volume Magnetic beads amount volume 200bp (SeqCap Epi) 84ul 101μl(ratio:1.2) 15μl

[0255] 1.5.6. Add the above proportion of magnetic beads to each sample for recovery, shake and mix, and centrifuge instantly.

[0256] 1.5.7. Incubate at room temperature for 5 minutes.

[0257] 1.5.8. Mix by shaking and centrifuge briefly. Place on a magnetic rack for adsorption until the solution becomes clear (~2 minutes). After the solution becomes clear, aspirate the supernatant.

[0258] 1.5.9. Add 200 μl of 80% ethanol to wash the beads for 30 seconds, discard the supernatant, and carefully remove all the remaining ethanol from the inner wall of the dropper.

[0259] 1.5.10. Repeat the above steps.

[0260] 1.5.11. Add low EDTA TE buffer in an optimal volume for elution and then shake to mix.

[0261] 1.5.12. Incubate at room temperature for 2 min.

[0262] 1.5.13. Place on a magnetic rack and adsorb until the solution becomes clear (~2 min). After the solution becomes clear, aspirate the supernatant.

[0263] 1.5.14. Transfer the entire eluate into a new 0.2 mL PCR tube, making sure that the eluate does not contain the magnetic beads.

[0264] 1.6. Connector ligation and purification:

[0265] 1.6.1. Prepare the library reaction system according to the following table:

[0266] Table 10

[0267] Components volume Buffer B1 3ul Reagent B2 10μl Enzyme B3 2ul TotalVolume 15ul

[0268] 1.6.2. Set the following program and run: Heated cover 0℃:

[0269] Table 11

[0270] temperature time 25℃ ∞ 25℃ 15min 4℃ ∞

[0271] 1.6.3. Prepare the purification system according to the following table:

[0272] Table 12

[0273] Input Reaction volume Magnetic beads amount volume 200bp (SeqCap Epi) 30ul 36μl(ratio:1.2) 20μl

[0274] 1.6.4. Add the above proportion of magnetic beads to each sample for recovery, shake and mix, and centrifuge instantly.

[0275] 1.6.5. Incubate at room temperature for 5 minutes.

[0276] 1.6.6. Mix by shaking and centrifuge briefly. Place on a magnetic rack for adsorption until the solution becomes clear (~2 minutes). After the solution becomes clear, aspirate the supernatant.

[0277] 1.6.7. Add 200 μl of 80% ethanol to wash the beads for 30 seconds, discard the supernatant and carefully remove all the remaining ethanol from the inner wall of the dropper.

[0278] 1.6.8. Repeat the above steps.

[0279] 1.6.9. Add low EDTA TE buffer in an optimal volume for elution and then vortex to mix.

[0280] 1.6.10. Incubate at room temperature for 2 min.

[0281] 1.6.11. Place on a magnetic rack and adsorb until the solution becomes clear (~2 min). After the solution becomes clear, aspirate the supernatant.

[0282] 1.6.12. Transfer the entire eluate into a new 0.2 mL PCR tube, making sure that the eluate does not contain the magnetic beads.

[0283] 1.7. Library amplification and purification:

[0284] 1.7.1. Prepare the library reaction system according to the following table:

[0285] Table 13

[0286] Components volume The above reaction DNA 20ul KAPA HiFi HotStart Uracil+ReadyMix(2x) 25ul index(U001-U024) 5μl Total volume 50ul

[0287] 1.7.2. Set the following program and run: Heated lid 105℃:

[0288] Table 14

[0289]

[0290] 1.7.3. The recommended number of cycles is as follows:

[0291] Table 15

[0292] Input Recommended number of cycles 20ng cfDNA 10-11 100ng gDNA 9-10 20ng gDNA 11-12

[0293] 1.7.4. Prepare the purification system according to the following table:

[0294] Table 16

[0295] Input Reaction volume Magnetic beads amount volume 200bp (SeqCap Epi) 50ul 60μl(ratio:1.2) 22μl

[0296] 1.7.5. Transfer the PCR product into a 1.5 ml centrifuge tube.

[0297] 1.7.6. Add the above proportion of magnetic beads to each sample for recovery, shake and mix, and centrifuge instantly.

[0298] 1.7.7. Incubate at room temperature for 5 minutes.

[0299] 1.7.8. Mix by shaking and centrifuge briefly. Place on a magnetic rack for adsorption until the solution becomes clear (~2 minutes). After the solution becomes clear, aspirate the supernatant.

[0300] 1.7.9. Add 500 μl of 80% ethanol to wash the beads for 30 seconds, discard the supernatant and carefully remove all the remaining ethanol from the inner wall of the dropper.

[0301] 1.7.10. Repeat the above steps.

[0302] 1.7.11. Place on the magnetic stand for 5-10 minutes until the beads are dry (avoid over-drying, which may result in reduced DNA recovery).

[0303] 1.7.12. Add low EDTA TE buffer to the optimal volume for elution and then vortex to mix.

[0304] 1.7.13. Incubate at room temperature for 2 min.

[0305] 1.7.14. Place on a magnetic rack and adsorb until the solution becomes clear (~2 min). After the solution becomes clear, aspirate the supernatant.

[0306] 1.7.15. Transfer the entire eluate into a new 0.2 mL PCR tube, making sure that the eluate does not contain the magnetic beads.

[0307] 1.7.16. Aspirate 1ul for qubit calibration and perform 2100 quality inspection.

[0308] 1.8. Hybridization of samples and probes:

[0309] 1.8.1. Mixed samples:

[0310] 1.8.1.1. The amount of DNA library can refer to the table below. The total amount can be more than 1500ng, but not more than 4ug;

[0311] Table 17

[0312] Number of mixed samples The amount of each library Total library volume per reaction 1 500ng 500ng 2 500ng 1000ng 3 500ng 1500ng 4 375ng 1500ng 8 187.5ng 1500ng

[0313] 1.8.1.2. Calculate the amount of different samples and mix them evenly in a centrifuge tube.

[0314] 1.8.1.3. Add the following pre-hybridization reagents to the mixed sample and mix well, trying not to create bubbles.

[0315] Table 18

[0316] Components volume Twist probe panel 4ul Universal sealer 8ul Blocking agent solution 5μl Methylation Enhancer 2ul

[0317] 1.8.1.4. Dry the mixed pre-hybridization reagents in a vacuum concentrator at room temperature (if heating is required, please use low temperature).

[0318] 1.8.2. Hybridization:

[0319] 1.8.2.1. Incubate Fast Hybridization Mix at 65℃ for 10min or until all precipitates are dissolved. Vortex quickly and add 20ul of freeze-dried sample to resuspend the sample (do not let the hybridization solution return to room temperature). Mix by flicking gently with your fingertips to avoid creating bubbles.

[0320] 1.8.2.2. Rapidly centrifuge to remove bubbles and add 30ul Hybridization Enhancer to the surface of the above reagents.

[0321] 1.8.2.3. Place the PCR tube in the preheated PCR instrument for hybridization.

[0322] 1.8.2.4. Set the following program and run: Heated lid 85°C.

[0323] Table 19

[0324] temperature time 95℃ ∞ 95℃ 5min 60℃ 15min-4h

[0325] 1.8.3. Combination:

[0326] 1.8.3.1. Shake the pre-equilibrated streptavidin magnetic beads until completely mixed, and add 100 μl of magnetic beads to a 1.5 ml centrifuge tube.

[0327] 1.8.3.2. Add 200ul of binding buffer and mix well by pipetting.

[0328] 1.8.3.3. Place the centrifuge tube on the magnetic rack for 1 minute or until the solution becomes clear, discard the supernatant and remove the centrifuge tube.

[0329] 1.8.3.4. Repeat the above washing steps 2 times, for a total of 3 times.

[0330] 1.8.3.5. After the last wash, add 200ul of binding buffer and resuspend by vortexing to mix thoroughly.

[0331] 1.8.3.6. After hybridization, open the lid of the PCR instrument and quickly transfer all the hybridization solution to the balanced magnetic beads.

[0332] 1.8.3.7. Mix the magnetic beads with hybridization solution thoroughly on a shaker, rocker or rotator at room temperature for 30 minutes.

[0333] 1.8.3.8. Remove the centrifuge tube from the mixer, centrifuge quickly and place it on the magnetic rack for 1 minute, remove the supernatant and remove the tube.

[0334] 1.8.3.9. Add 200ul preheated Fast Wash Buffer 1 and mix well.

[0335] 1.8.3.10.Incubate at 63°C or 65°C for 5 min.

[0336] 1.8.3.11. Place the centrifuge tube on the magnetic rack for 1 minute, remove the supernatant and take out the tube.

[0337] 1.8.3.12. Repeat the above steps, add 200ul of preheated Wash Buffer 1 again and mix well.

[0338] 1.8.3.13. Incubate at 63°C or 65°C for 5 min.

[0339] 1.8.3.14. Transfer the liquid to a new tube; place it on the magnetic rack for 1 min, remove the supernatant and take out the tube.

[0340] 1.8.3.15. Add 200ul preheated wash buffer 2 and mix well using a pipette tip.

[0341] 1.8.3.16.Incubate at 48℃ for 5 min.

[0342] 1.8.3.17. Place on the magnetic rack for 1 minute, remove the supernatant and take out the tube.

[0343] 1.8.3.18. Repeat (steps 3.15-3.17) and wash twice, for a total of three times.

[0344] 1.8.3.19. For the last time, use a 10ul pipette tip to suck up the wash solution.

[0345] 1.8.3.20. Add 45ul of water, mix well, and incubate the solution on ice.

[0346] 1.8.4. Post-capture PCR amplification, purification and quality control:

[0347] 1.8.4.1. Set the following program and run: Heated lid 105°C.

[0348] Table 20

[0349]

[0350] 1.8.4.2. Mix the magnetic bead mixture in step 1.8.3.20 and pipette 22.5ul into a 0.2ml PCR tube.

[0351] 1.8.4.3. Add 2.5ul amplification primers and 25ul KAPA HiFi HotStartReadyMix to a 0.2ml PCR tube, for a total of 50ul reaction system.

[0352] 1.8.4.4. Mix gently with a pipette tip, centrifuge quickly, place in PCR instrument and start amplification.

[0353] 1.8.4.5. Vortex to thoroughly mix the pre-equilibrated DNA purification magnetic beads.

[0354] 1.8.4.6. Add 90ul (1.8*) DNA purification magnetic beads to the amplified PCR product and vortex to mix thoroughly.

[0355] 1.8.4.7. Incubate at room temperature for 5 min.

[0356] 1.8.4.8. Place the centrifuge tube on the magnetic rack for 1 minute and remove the supernatant after the solution becomes clear.

[0357] 1.8.4.9. Without removing the centrifuge tube from the magnetic rack, directly add 200ul of freshly prepared 80% ethanol, incubate for 1 minute, and discard the supernatant; repeat the 80% ethanol wash once (2 times in total) and keep the centrifuge tube on the magnetic rack.

[0358] 1.8.4.10. Carefully remove the remaining ethanol with a 10ul pipette tip and leave at room temperature for 5-10 minutes or until the magnetic beads are dry. Be careful not to overdry the magnetic beads.

[0359] 1.8.4.11. Remove the tube from the magnetic rack and add 32ul of water, mix thoroughly with a pipette tip, and incubate at room temperature for 2 minutes.

[0360] 1.8.4.12. Place the centrifuge tube on a magnetic rack for 3 minutes or until the solution becomes clear.

[0361] 1.8.4.13. Transfer 30ul of supernatant to a clean 0.2ml centrifuge tube.

[0362] 1.8.4.14. Take 1 μl of library and use Qubit to quantify and record the library concentration.

[0363] 1.8.4.15. Take 1 μl of sample and use Agilent 2100 to measure the library fragment length.

[0364] 1.8.4.16. Sequencing was performed using the Illumina high-throughput sequencing platform.

[0365] 1.9. Methylation bioinformatics analysis process. It is roughly as follows: use fastp quality control software to check the sequencing quality, remove low-quality reads, then use Bismark alignment software to align the clean data after quality control to the reference genome, and use Bismar_methylation_extractor software to extract the corresponding methylation sites. Finally, calculate the methylation level of the target region. If the value exceeds the threshold, it is judged as cancer, and if it is lower than the threshold, it is judged as normal.

[0366] 1.10. Based on the training set of 51 lung nodule samples and 73 normal human samples, the above-mentioned methylation library construction method was used to screen out biomarkers related to lung nodules by using the differences in methylation levels in different groups (lung nodules and normal), and the site data was verified in independent data sets in normal and lung nodule samples. A total of two DNA fragments (SEQ ID NO: 1 and SEQ ID NO: 2) that most significantly distinguished normal and cancer samples were screened out. The two methylation biomarkers (hereinafter referred to as sites or markers) and the discrimination thresholds are shown in Table 21;

[0367] The calculation method for the methylation level threshold is: draw the ROC curve according to the data set (including the type and methylation level of each sample), and the confusion matrix corresponding to the optimal threshold point on the ROC curve will be the basis for us to calculate indicators such as sensitivity, specificity and accuracy. Usually we will make a selection through the Youden index. The Youden index, also known as the correct index, refers to the sum of sensitivity and specificity minus 1: Youden index = Sensitivity + Specificity – 1. The Youden index ranges from 0 to 1, representing the total ability of the classification model to detect real patients and non-patients. The larger the Youden index, the better the performance of the classification model:

[0368] Table 21 Specific performance data of methylation markers

[0369] SEQ ID Threshold Specificity Sensitivity AUC SEQ ID NO.1 0.55 0.918 0.902 0.882 SEQ ID NO.2 0.55 0.904 0.882 0.876

[0370] Example 2

[0371] 6 human samples (S1-3 are samples from patients with benign pulmonary nodules, and S4-6 are samples from patients with lung cancer) were collected from peripheral blood using the methylation marker detection method of the present application according to the method of Example 1; a library was constructed and sequenced using the Illumina platform; the sequencing data was subjected to the above-mentioned bioinformatics analysis process to obtain the methylation level of each marker, and the patient's condition was predicted based on the threshold of each marker. If the threshold was exceeded, the sample was a lung cancer patient sample, and if the threshold was lower than the threshold, the sample was a benign pulmonary nodule patient sample. The specific results are shown in Table 22 below:

[0372] The judgment result is that 0 represents normal classification, that is, benign; 1 represents abnormal classification, that is, malignant.

[0373] Table 22

[0374]

[0375] It can be seen from Table 22 above that the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 can specifically detect lung nodule samples.

[0376] In summary, the inventors of the present application have obtained methylation genes associated with benign and malignant pulmonary nodules, and determined the target sequence of abnormal methylation of the methylation genes of benign and malignant pulmonary nodules. Moreover, through the target sequence of this methylation gene, the methylation state of the gene can be sensitively and specifically detected, which can be used for the detection of free DNA in peripheral blood. The composition described in the present application can realize real-time monitoring with higher sensitivity and accuracy.

[0377] Although the present invention has been disclosed as above by way of embodiments, it is not intended to limit the present invention. Any person having ordinary knowledge in the technical field may make some changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention shall be determined by the scope of the patent application attached hereto.

Claims

1. A marker for detecting benign or malignant pulmonary nodules, wherein: The markers are CSMD2 gene and / or TRPM4 gene.

2. The marker according to claim 1, wherein The target sequence of the CSMD2 gene is as shown in any one of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:19, or the target sequence of the CSMD2 gene includes the sequence shown in any one of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:19; or The target sequence of the TRPM4 gene is as shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:20, or the target sequence of the TRPM4 gene includes the sequence shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:

20.

3. A probe composition, wherein: The probe composition comprises a probe targeting the methylation of the marker according to any one of claims 1 or 2.

4. The probe composition according to claim 3, wherein The probe composition comprises a first hypermethylated probe composition and a second hypomethylated probe composition, wherein the first probe composition is used for hybridizing with a CG hypermethylated region converted by bisulfite, and the second probe composition is used for hybridizing with a CG hypomethylated region converted by bisulfite.

5. The probe composition according to claim 4, wherein The first probe composition includes n probes, and the n probes hybridize to each nucleotide of the sense strand and / or antisense strand of the CG hypermethylated region converted by bisulfite; Preferably, The second probe composition includes m probes, and the m probes hybridize to each nucleotide of the sense strand and / or antisense strand of the CG hypomethylated region converted by bisulfite; More preferably, Both n and m are any integers from 1 to 10.

6. The probe composition according to claim 5, in, There are x1 nucleotide overlaps between the n-1th probe and the nth probe, preferably, x1 is any integer between 0 and 100; Preferably, There are x2 nucleotide overlaps between the m-1th probe and the mth probe, and preferably, x2 is any integer between 0-100.

7. The probe composition according to claim 6, wherein The first probe composition includes the nucleotide sequence shown in SEQ ID NO: 3-6; The second probe composition includes the nucleotide sequences shown in SEQ ID NOs: 7-10.

8. Use of a nucleic acid for detecting a marker in the preparation of a kit for detecting benign or malignant pulmonary nodules, wherein: The markers are CSMD2 gene and / or TRPM4 gene.

9. The use according to claim 8, wherein The target sequence of the CSMD2 gene is as shown in any one of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:19, or the target sequence of the CSMD2 gene includes the sequence shown in any one of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:19; or The target sequence of the TRPM4 gene is as shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:20, or the target sequence of the TRPM4 gene includes the sequence shown in any one of SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:

20.

10. The use according to claim 8 or 9, wherein The nucleic acid is used to target methylated markers of benign and malignant pulmonary nodules.

Images