A biological marker for diagnosis and treatment of preeclampsia and application thereof
By using diagnostic and therapeutic reagents for FBP2 and leveraging the high expression mechanism of FBP2 in placental tissues in preeclampsia, the problem of unclear etiology of preeclampsia has been solved, enabling early prediction and treatment in clinical practice.
Patent Information
- Application Number
- CN202411511838.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-28
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2044-10-28
AI Technical Summary
The etiology and pathogenesis of preeclampsia are still unclear, and current technologies lack effective diagnostic and therapeutic targets, which affects the health of pregnant women and perinatal infants.
The study found that FBP2 is significantly upregulated in placental tissue in preeclampsia. As a transcriptional repressor of HEY1, a classic downstream target gene of NOTCH3, FBP2 binds to and binds to the FBP2 promoter region, inhibiting FBP2 expression and thereby regulating c-MYC and TFAM, affecting the migration and invasion ability of trophoblast cells. This provides FBP2 reagents for diagnosis and treatment.
FBP2 can serve as a biological marker for preeclampsia, aiding in early prediction and diagnosis, and providing a theoretical basis for clinical treatment. By inhibiting FBP2 expression, trophoblast function can be improved, reducing the incidence of preeclampsia.
Smart Images

Figure CN119351541B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of clinical medicine, and particularly relates to a preeclampsia diagnosis and treatment biological marker and application thereof. BACKGROUND
[0002] Preeclampsia (PE) is one of the idiopathic diseases of pregnancy, which occurs after 20 weeks of gestation, and is characterized by elevated blood pressure (systolic pressure ≥ 140 mmHg or diastolic pressure ≥ 90 mmHg) combined with proteinuria, and can also be accompanied by symptoms such as headache, blurred vision, nausea, vomiting, and upper abdominal discomfort. It is one of the key factors leading to an increase in maternal and perinatal mortality (Gestational Hypertension and Preeclampsia: ACOG Practice Bulletin, Number 222 [J]. Obstet Gynecol, 2020, 135(6): e237-e60.; KARUMANCHI S A, GRANGER J P. Preeclampsia and Pregnancy-Related Hypertensive Disorders [J]. Hypertension, 2016, 67(2): 238-42). It is reported that 10-15% of pregnant women usually develop PE within 1-5 weeks (Kong Beihua, Ma Duan-tao. Obstetrics and Gynecology (10th Edition) [M]. People's Medical Publishing House, 2024. ARUTYUNYAN A, ROBERTS K, TROULÉ K, et al. Spatial multiomics map of trophoblast development in early pregnancy [J]. Nature, 2023, 616(7955): 143-51). So far, the etiology and pathogenesis of preeclampsia are not clear.
[0003] PE is a pregnancy-induced syndrome caused by multiple factors, multiple pathways and multiple mechanisms. Its occurrence is mainly related to abnormal placenta formation and abnormal interaction between fetus and mother at the maternal-fetal interface. The decreased ability of extravillous trophoblast cells (EVTs) to invade the decidua, uterine muscle and blood vessels, and the disturbance of spiral arterial remodeling (SAR) lead to placental dysplasia, which promotes the release of various inflammatory and anti-angiogenic factors from the placenta into the maternal circulation, resulting in systemic arteriolar spasm and activation of multiple system and diverse clinical syndromes (NGENE N C, MOODLEY J. Role of angiogenic factors in the pathogenesis and management of pre-eclampsia [J]. Int J Gynaecol Obstet, 2018, 141(1): 5-13.; HOLLAND O J, CUFFE J S M, DEKKER NITERT M, et al. Placental mitochondrial adaptations in preeclampsia associated with progression to term delivery [J]. Cell Death Dis, 2018, 9(12): 1150). Therefore, in-depth study of the pathogenesis of PE is of great significance for the prevention, diagnosis and treatment of PE, and can even be used as a potential target for clinical prediction, diagnosis and treatment of PE, which is of great significance to protect maternal and infant health and reduce the incidence and maternal mortality. SUMMARY
[0004] To solve the above problems, the application discloses a PE diagnosis and treatment biological marker and application thereof. The application demonstrates the mechanism of FBP2 causing PE by inhibiting the invasion of trophoblast cells from the clinical sample, cell and in vivo level. The application verifies that the transcriptional repressor HEY1, as a classic downstream target gene of NOTCH3, can bind and bind to the FBP2 promoter region, and inhibit the expression of FBP2. FBP2 binds and down-regulates the transcriptional activity of c-MYC, inhibits the transcriptional expression of TFAM, leads to mitochondrial dysfunction, reduces the migration and invasion ability of trophoblast cells, and participates in the mechanism of PE occurrence. It is a new mechanism clue obtained by the application according to the pre-experiment results and information analysis. No relevant reports have been found in literature retrieval. The application is a new target for in-depth exploration of PE clinical diagnosis and treatment. The research results can provide a theoretical basis for guiding early prediction and intervention of PE in the future.
[0005] To achieve the above object, the technical scheme of the present application is as follows:
[0006] The present application provides the application of the reagent for detecting FBP2 in the preparation of PE diagnostic kit, and the sequence of the FBP2 is shown as SEQ ID NO. 1.
[0007] SEQ ID NO. 1
[0008] FBP2 (NM_003837)
[0009] CCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCTATCGATA GGTACCCTCGAG ATCTGCGATCTAAGTAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGGAAGACGCCAAAAACATAAAGAAAGG.
[0010] Further, the reagent for detecting FBP2 comprises a primer pair for specifically detecting FBP2 expression.
[0011] Further, the sequence of the upstream primer of the primer pair is shown as SEQ ID NO. 2, and the sequence of the downstream primer of the primer pair is shown as SEQ ID NO. 3.
[0012] SEQ ID NO. 2: 5'-3' GACCCGCTACGTTATGGAAA;
[0013] SEQ ID NO. 3: 5'-3' TCACCAGGGAATTGGATAGC;
[0014] The application also provides use of the low-expression reagent of FBP2 in preparation of a drug for treating PE, wherein the sequence of the FBP2 is shown as SEQ ID NO. 1.
[0015] Further, the low-expression reagent comprises FBP2 siRNA-1#, FBP2 siRNA-2# and FBP2 siRNA-3#.
[0016] The sequence of FBP2 siRNA-1# is shown as SEQ ID NO. 4 and SEQ ID NO. 5.
[0017] SEQ ID NO. 4: 5'-3' GCGCUGUACGGUAGUGCAATT;
[0018] SEQ ID NO. 5: 5'-3' UUGCACUACCGUACAGCGCTT.
[0019] The sequence of FBP2 siRNA-2# is shown as SEQ ID NO. 6 and SEQ ID NO. 7.
[0020] SEQ ID NO. 6: 5'-3' GGUAGCUAUGAGUAUACAATT;
[0021] SEQ ID NO. 7: 5'-3' UUGUAUACUCAUAGCUACCTT.
[0022] The sequence of the FBP2 siRNA-3# is shown as SEQ ID NO. 8, SEQ ID NO. 9.
[0023] SEQ ID NO. 8: 5'-3' CCUGGCUACA AUGGUGAUATT;
[0024] SEQ ID NO. 9: 5'-3' UAUCACCAUUGUAGCCAGGTT.
[0025] The application also provides the application of the FBP2 low expression reagent in promoting the proliferation, migration and invasion ability of the trophoblast cells, and the sequence of the FBP2 is shown as SEQ ID NO. 1. The low expression reagent includes FBP2 siRNA-1#, FBP2 siRNA-2# and FBP2 siRNA-3#, the sequence of the FBP2 siRNA-1# is shown as SEQ ID NO. 4, SEQ ID NO. 5, the sequence of the FBP2 siRNA-2# is shown as SEQ ID NO. 6, SEQ ID NO. 7, and the sequence of the FBP2 siRNA-3# is shown as SEQ ID NO. 8, SEQ ID NO. 9.
[0026] The application also provides a kit for diagnosing PE disease, and the kit includes the primer pair of SEQ ID NO. 2 and SEQ ID NO. 3.
[0027] The application also provides a drug for PE treatment, and the drug includes the FBP2 low expression reagent, and the sequence of the FBP2 is shown as SEQ ID NO. 1.
[0028] The application has the following beneficial effects:
[0029] The application firstly finds that the expression of FBP2 in the placental tissue of PE is significantly higher than that in the normal pregnancy tissue, and FBP2 can be used as a biological marker for the diagnosis and treatment of PE.
[0030] The application further uses a large number of mitochondrial function experiments (OCR experiment, IF MitoTracker Red CMXRos experiment, flow cytometry analysis experiment, etc.) to prove that the overexpressed FBP2 can inhibit the mitochondrial function and affect the cell biological functions such as the migration and invasion of the trophoblast cells, and then cause SAR and lead to the occurrence and development of PE.
[0031] The activation of the HEY1-FBP2 / c-MYC-TFAM signal pathway plays a certain role in the regulation of the mitochondrial function and the biological processes such as the invasion and migration of the extravillous trophoblast cells A.
[0032] The application helps prediction and diagnosis of PE, deeply understands embryo implantation mechanism, and provides a new theoretical basis for treatment of PE targeting FBP2 in clinic. BRIEF DESCRIPTION OF DRAWINGS
[0033] Figure 1 FBP2 is significantly highly expressed in PE placental tissues;
[0034] Wherein, (a) RT-qPCR detects FBP2 mRNA expression level in normal placental tissues (n=40) and PE placental tissues (n=40); (b) Western blotting experiment detects FBP2 protein expression in 6 pairs of normal placental and PE placental tissues; (c) Western blotting experiment is used to detect the relative expression of FBP2 after transfection of FBP2 specific siRNA in trophoblast cell lines HTR-8 / SVneo and BeWo; (d) Western blotting experiment is used to detect the relative expression of FBP2 after transfection of FBP2 overexpression plasmid in trophoblast cell lines HTR-8 / SVneo and BeWo; the above experiments are repeated three times; * P<0.05, ** P<0.01);
[0035] Figure 2 FBP2 high expression inhibits migration and invasion ability of trophoblast HTR-8 / SVneo and BeWo;
[0036] Wherein, (a-b) Transwell experiment is used to detect the change of cell invasion and migration ability after FBP2 is knocked down and overexpressed in HTR-8 / SVneo; (c-d) Transwell experiment is used to detect the change of cell invasion and migration ability after FBP2 is knocked down and overexpressed in BeWo, scale: 100 μm;
[0037] Figure 3 HEY1 regulates FBP2 expression by binding to FBP2 promoter region;
[0038] (a) Prediction of the specific binding sites of HEY1 in the FBP2 promoter region using the JASPAR website; (b) Detection of the specific binding sites of HEY1 in the FBP2 promoter region using luciferase reporter gene assay; (c) Analysis of the specific binding sites of HEY1 in the FBP2 promoter region and the specific regulatory mechanism using ChIP-qPCR assay; (d-e) Detection of the mRNA and protein levels of FBP2 in the HTR-8 / SVneo trophoblast cell line transfected with si-Control and si-HEY1 using RT-qPCR and western blotting assay; (f-g) Detection of the mRNA and protein levels of FBP2 in the BeWo trophoblast cell line transfected with si-Control and si-HEY1 using RT-qPCR and western blotting assay; (h-i) Detection of the expression difference of FBP2 in the HTR-8 / SVneo trophoblast cell line overexpressing HEY1 using RT-qPCR and western blotting assay; (j-k) Detection of the expression difference of FBP2 in the BeWo trophoblast cell line overexpressing HEY1 using RT-qPCR and western blotting assay; the above experiments were repeated three times; (*P<0.05, **P<0.01);
[0039] Figure 4 To inhibit the expression of c-MYC by overexpressing FBP2, and FBP2 and c-MYC are co-localized in the TFAM promoter region;
[0040] wherein, (a) Co-IP experiment combined with western blotting experiment verified that the antibody of FBP2 pulled down c-MYC protein at the cellular level, and the antibody of c-MYC pulled down FBP2 protein; (b-c) RT-qPCR and western blotting experiments were used to detect the mRNA and protein expression changes of c-MYC and TFAM in si-Control or si-FBP2 transfected HTR-8 / SVneo trophoblast cells; (d-e) RT-qPCR and western blotting experiments were used to detect the mRNA and protein expression changes of c-MYC and TFAM in si-Control or si-FBP2 transfected BeWo trophoblast cells; (f-g) RT-qPCR and western blotting experiments were used to analyze the mRNA expression of c-MYC and TFAM in HTR-8 / SVneo trophoblast cells after overexpression of FBP2; (h-i) RT-qPCR and western blotting experiments were used to analyze the mRNA expression of c-MYC and TFAM in BeWo trophoblast cells after overexpression of FBP2; (j) ChIP-qPCR experiment verified the binding of c-MYC to TFAM promoter region. The above experiments were repeated three times; * P <0.05, ** P <0.01);
[0041] Figure 5 FBP2 and its downstream c-MYC expression abnormality affects mitochondrial morphology and quality change;
[0042] wherein, (a-b) RT-qPCR and western blotting experiments were used to detect the relative expression of c-MYC in extravillous trophoblast cell lines HTR-8 / SVneo and BeWo after transfection of c-MYC specific siRNA; (c-d) RT-qPCR and western blotting experiments were used to analyze the mRNA and protein expression of TFAM in trophoblast cell line HTR-8 / SVneo after knockdown of c-MYC; (e-f) RT-qPCR and western blotting experiments were used to analyze the mRNA and protein expression of TFAM in trophoblast cell line BeWo after knockdown of c-MYC; the above experiments were repeated three times; * P <0.05, ** P <0.01);
[0043] Figure 6 FBP2 and its downstream c-MYC expression abnormality affects mitochondrial morphology and quality change;
[0044] Wherein, (a) the ratio of mtDNA / nDNA in HTR-8 / SVneo and BeWo trophoblast cells after knocking down FBP2 was verified by mitochondrial separation experiment and RT-qPCR experiment; (b) the ratio of mtDNA / nDNA in HTR-8 / SVneo and BeWo trophoblast cells after overexpressing FBP2 was verified by mitochondrial separation experiment and RT-qPCR experiment; (c) the ratio of mtDNA / nDNA in HTR-8 / SVneo and BeWo trophoblast cells after knocking down c-MYC was verified by mitochondrial separation experiment and RT-qPCR experiment; (d-e) the changes of mitochondrial morphology and fluorescence intensity in HTR-8 / SVneo and BeWo trophoblast cell lines after overexpressing FBP2, the fluorescence intensity of TFAM and the corresponding quantification diagram under confocal microscope; scale: 20 μm; (f-g) the changes of mitochondrial morphology and fluorescence intensity in HTR-8 / SVneo and BeWo trophoblast cell lines after knocking down c-MYC, the fluorescence intensity of TFAM and the corresponding quantification diagram under confocal microscope; scale: 20 μm; (h) the mitochondrial fluorescence intensity in HTR-8 / SVneo and BeWo trophoblast cell lines after overexpressing FBP2 was verified by flow cytometry analysis experiment; Mitochondrial dye was Mitotracker Green FM; all the above experiments were repeated three times; * P <0.05, ** P <0.01);
[0045] Figure 7 FBP2 and its downstream c-MYC expression abnormality affect mitochondrial oxidative phosphorylation;
[0046] Wherein, (a-b) the abnormal changes of OCR in HTR-8 / SVneo and BeWo trophoblast cells after knocking down FBP2 were detected and quantitatively analyzed by Seahorse XF experiment; (c-d) the abnormal changes of OCR in HTR-8 / SVneo and BeWo trophoblast cells after overexpressing FBP2 were detected and quantitatively analyzed by Seahorse XF experiment; (e-f) the abnormal changes of OCR in BeWo trophoblast cells after knocking down c-MYC were detected and quantitatively analyzed by Seahorse XF experiment; (g-h) the differences of TFAM protein expression in HTR-8 / SVneo and BeWo trophoblast cells after transfecting Vector, OE-FBP2, OE-FBP2 & OE-c-MYC respectively and the quantification diagram were detected by Western blotting experiment; all the above experiments were repeated three times; * P<0.05, ** P<0.01).
[0047] Figure 8 Verification of FBP2 pathway in human tissue experiment;
[0048] Wherein, (a) qPCR experiment verified the difference of HEY1, FBP2, c-MYC and TFAM mRNA levels in 6 pairs of normal and PE patient placental tissues; (b) Western Blotting experiment verified the difference of HEY1, FBP2, c-MYC and TFAM protein expression in 6 pairs of normal and PE patient placental tissues; (c) IF experiment detected the positive expression of TFAM in PE group and control placental tissues and the quantification figure. Scale bar, 50 μm; (d) After identifying primary trophoblast cells by immunofluorescence experiment and related antibodies (HCG & HLA-G antibodies), qPCR experiment was used to verify the difference of HEY1, FBP2, c-MYC and TFAM mRNA levels; scale bar, 10 μm. (f-g) IF experiment detected the positive expression of FBP2 and TFAM in PE group and control placental tissues and the quantification figure; scale bar, 50 μm; the above experiments were repeated three times. * P<0.05, ** P<0.01);
[0049] Figure 9 Verification of HEY1-FBP2 / c-MYC-TFAM pathway in animal in vivo experiment;
[0050] Wherein, (a) a simplified diagram of L-NAME induced PE pregnant mouse model and a time axis of injection of drugs and sampling; (b) changes of blood pressure (systolic and diastolic pressure) of control group and L-NAME group pregnant mice during pregnancy; (c) placenta and fetus figures of control group pregnant mice and L-NAME induced PE pregnant mice; (d) Western blotting experiment verified the expression difference of HEY1, FBP2, c-MYC and TFAM in control group and PE placental tissues and the quantification figure; the above experiments were repeated three times; * P <0.05, ** P <0.01).
[0051] Figure 10 Schematic diagram of HEY1 regulating c-MYC / FBP2-TFAM regulatory axis as a classic downstream target gene of NOTCH3. DETAILED DESCRIPTION
[0052] The present application will be further illustrated below in conjunction with the drawings and specific embodiments, and it should be understood that the following specific embodiments are only used to illustrate the present application and not to limit the scope of the present application. Example 1
[0053] RT-qPCR and western blotting experiments were performed to detect the mRNA expression level of FBP2 in placental tissue, and Transwell experiments were used to verify that FBP2 was involved in inhibiting the invasion and migration ability of trophoblasts.
[0054] Methods
[0055] Sample collection
[0056] Placental tissues from 40 pairs of normal and PE pregnant women who underwent cesarean section delivery in Nanjing Maternal and Child Health Hospital from January 2021 to December 2021 were collected. The placental tissue samples were taken from the maternal side of the umbilical cord attachment site, avoiding placental calcified infarction, and the size of the sample was 1*1*1 cm, which was stored in liquid nitrogen for extraction of tissue RNA and tissue protein. This study has obtained the approval of the Ethics Committee of Nanjing Maternal and Child Health Hospital, and all patients have signed the written informed consent form. The general conditions of normal control group and PE group pregnant women were collected, including age, pre-pregnancy weight, blood pressure, termination of gestational weeks and neonatal weight, see Table 1 for details.
[0057] Table 1 Comparison of clinical characteristics of patients in control group and PE group
[0058]
[0059] Extraction of tissue (cell) RNA and RT-qPCR
[0060] Total RNA was isolated from tissues and cultured cells using Trizol reagent (Invitrogen), and its quality and quantity were evaluated by anoDrop2000c (Fisher Scientific, Waltham, Massachusetts, USA). RNA was reverse transcribed to cDNA by HIScriptIII All-in-one RT SuperMix kit (Vazyme). Then quantitative PCR was performed using Taq Prouniversal SYBR qPCR master mix kit (Vazyme) and FBP2 primers, the sequence of which is shown in SEQ ID NO. 2, SEQ ID NO. 3.
[0061] Western blotting experiment
[0062] HTR-8 / SVneo, BeWo cells transfected in 6-well plates were harvested. Then, total protein was extracted using RIPA protein extraction reagent (MCE, USA) and protease inhibitor (MCE, USA). Proteins were separated by 10% SDS-PAGE and transferred to 0.22 μm PVDF membrane (Sigma). PVDF membranes were blocked in 5% skim milk and then placed in a 4 ℃ shaker, immersed in diluted FBP2 primary antibody (1:1000, Proteintech). The next day, after TBST washing, secondary antibody (1:10000, Proteintech) was incubated, and images were collected and processed by FusionCapt Advance Fx5 software (Vilber Lourmat). All experiments were repeated independently three times.
[0063] Transwell experiment
[0064] Cells transfected in 6-well plates for 24-48 h were digested and resuspended, and the cell density was adjusted (cell density 1 x 10 5 / ml), 700 μl of complete medium was added to the lower chamber of the 24-well plate, and 300 μl of cell suspension with a cell number of 3 x 10 4 After incubation until a specific time point (30 h), 4% paraformaldehyde was used for fixation and crystal violet staining, and then PBS was washed several times, and the results were counted and photographed.
[0065] Statistical analysis
[0066] Normally distributed data are shown as mean ± SEM and compared by two-tailed Student's t test using GraphPad Prism 7.0 (www.GraphPad.com). The number of independent experiments is shown in the figure legend. A p value less than 0.05 was considered statistically significant (*p < 0.05 and **p < 0.01; ns, not statistically significant).
[0067] Results
[0068] FBP2 was significantly overexpressed in PE placental tissues, and overexpression of FBP2 could inhibit the invasion and migration of trophoblasts
[0069] The general conditions (age, BMI, systolic / diastolic blood pressure, etc.) of 40 pairs of normal and PE pregnant women were compared and analyzed. The systolic and diastolic blood pressures of the PE group were significantly higher than those of the normal control group (P < 0.01), and the proportion of proteinuria in the PE group was significantly higher than that in the control group (P < 0.05). In terms of newborns, the newborns in the PE group were nearly 300 g lighter than those in the control group, and the difference was statistically significant. There was no significant difference between the two groups in other aspects (P > 0.05) Table1) To confirm the differential expression of FBP2 in placental tissues of PE patients, first, the FBP2 mRNA and protein levels between PE group placental tissues and control group were detected by RT-qPCR and western blotting, the results showed that compared with the control group, the FBP2 mRNA and protein expression levels in the placental tissues of the PE group were significantly up-regulated Figure 1 a-b).
[0070] Based on the fact that the invasion of trophoblast cells is the key factor leading to the remodeling disorder of uterine spiral arteries, the present application further analyzes the effect of FBP2 on the invasion and migration ability of trophoblast cell lines, first, the present application verifies the FBP2 siRNA knockdown efficiency by western blotting experiment, and selects FBP2-siRNA-1# and 2# as siRNA for subsequent experiments ( Figure 1 c), and the present application also verifies the overexpression effect of FBP2 plasmid ( Figure 1 d). The Transwell experiment is used to verify that the reduction of FBP2 expression can promote the migration and invasion ability of trophoblast cell lines HTR-8 / SVneo and BeWo ( Figure 2 a-b), and the migration and invasion ability of trophoblast cell lines HTR-8 / SVneo and BeWo is inhibited after overexpression of FBP2 ( Figure 2 c-d). Example 2
[0071] Fluorescent reporter and ChIP-qPCR experiments verify that HEY1 inhibits FBP2 expression by binding and methylation of FBP2 promoter region
[0072] Methods
[0073] Fluorescent reporter experiment
[0074] The amplified cDNA fragments of HEY1 and FBP2 promoter region are subcloned into the downstream of luciferase gene in pGL3 plasmid, the sequence of HEY1 is SEQ ID NO. 10, and the sequence of FBP2 promoter region is SEQ ID NO. 11. DNA polymerase is used to obtain mutant plasmid (i.e. pGL3-HEY1-30-UTR-MUT and pGL3-FBP2-MUT). The luciferase activity is determined using the dual luciferase reporter assay system (Promega, Madison, WI). Briefly, HTR-8 / SVneo cells (1 x 10 5 ) are placed in 24-well plates for 36 hours. At 48 hours post-transfection, cells are lysed and collected. The relative luciferase activity is normalized to the Renilla luciferase activity.
[0075] SEQ ID NO. 10
[0076] HEY1 (NM_012258)
[0077] CCACTCCCAGGTCCAACTGCACCTCGGTTCTGCTAGCGTTTAAACGGGCCC TCTAGACGCCACCATGAAGCGAGCTCACCCCGAGTACAGCTCCTCGGACAGCGAGCTGGACGAGACCATCGAGGTGGAGAAGGAGAGTGCGGACGAGAATGGAAACTTGAGTTCGGCTCTAGGTTCCATGTCCCCAACTACATCTTCCCAGATTTTGGCCAGAAAAAGACGGAGAGGAATAATTGAGAAGCGCCGACGAGACCGGATCAATAACAGTTTGTCTGAGCTGAGAAGGCTGGTACCCAGTGCTTTTGAGAAGCAGGGATCTGCTAAGCTAGAAAAAGCCGAGATCCTGCAGATGACCGTGGATCACCTGAAAATGCTGCATACGGCAGGAGGGAAAGGTTACTTTGACGCGCACGCCCTTGCTATGGACTATCGGAGTTTGGGATTTCGGGAATGCCTGGCAGAAGTTGCGCGTTATCTGAGCATCATTGAAGGACTAGATGCCTCTGACCCGCTTCGAGTTCGACTGGTTTCGCATCTCAACAACTACGCTTCCCAGCGGGAAGCCGCGAGCGGCGCCCACGCGGGCCTCGGACACATTCCCTGGGGGACCGTCTTCGGACATCACCCGCACATCGCGCACCCGCTGTTGCTGCCCCAGAACGGCCACGGGAACGCGGGCACCACGGCCTCACCCACGGAACCGCACCACCAGGGCAGGCTGGGCTCGGCACATCCGGAGGCGCCTGCTTTGCGAGCGCCCCCTAGCGGCAGCCTCGGACCGGTGCTCCCTGTGGTCACCTCCGCCTCCAAACTGTCGCCGCCTCTGCTCTCCTCAGTGGCCTCCCTGTCGGCCTTCCCCTTCTCTTTCGGCTCCTTCCACTTACTGTCTCCCAATGCACTGAGCCCTTCAGCACCCACGCAGGCTGCAAACCTTGGCAAGCCCTATAGACCTTGGGGGACGGAGATCGGAGCTTTTTAA T CTAGATAGTTAAACCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCC.
[0078] SEQ ID NO. 11
[0079] FBP2(80685-1)-p1: TTTCTCTATCGATAGGTACCTTGGACATCTTCCCATAATATTTG;
[0080] FBP2(80685-1)-p2: CTTAGATCGCAGATCTCGAGTTTGGCTGGAATGCTTCAAATCC.
[0081] Chromatin immunoprecipitation
[0082] This experiment uses Merck EZ Magna ChIP A / G (Merck, 17-10086) to fix the intracellular DNA cross-linking with formaldehyde, then use cell lysis and nuclear lysis to lyse the cells and release the chromatin, further use ultrasonic to break the chromatin, then add FBP2 antibody (1:50) to the cell lysis solution and place it in the vertical suspension instrument at 4°C overnight, the next day, add EZ Magna ChIP A / G magnetic beads (Merck, 17-10086) to the antibody-cell lysis solution, incubate at 4°C for 4-6 hours, then collect the precipitated complex and wash to remove non-specific binding proteins; elute to obtain the enriched target protein-DNA complex, after de-crosslinking and purification of the enriched DNA fragments, use the primer sequence of FBP2 for qPCR analysis for verification, the primer sequence of FBP2 is shown in SEQ ID NO. 2 and SEQ ID NO. 3.
[0083] Extraction of tissue (cell) RNA and RT-qPCR
[0084] Total RNA was isolated from tissues and cultured cells using Trizol reagent (Invitrogen) and its quality and quantity were evaluated by ananoDrop2000c (Fisher Scientific, Waltham, Massachusetts, USA). RNA was reverse transcribed into cDNA by HIScript III All-in-one RT SuperMix kit (Vazyme). Quantitative PCR was then performed using Taq Prouniversal SYBR qPCR Mix kit (Vazyme) and specific FBP2 primers, the sequences of which are shown in SEQ ID NO. 2, SEQ ID NO. 3.
[0085] Cell culture and transfection
[0086] Trophoblast cell lines were cultured in a 90 % humidity, 37 °C and 5 % CO2 incubator, and two human trophoblast cell lines (HTR-8 / SVneo and BeWo) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). HTR-8 / SVneo cells were cultured in DMEM (Gibco, USA) medium containing 10 % FBS, and 100 U / ml penicillin and 100 mg / ml streptomycin were added to the above culture. Trophoblast cell lines HTR-8 / SVneo and BeWo cells were cultured in 6-well plates until 80 % confluence, and si-HEY1-1#, si-HEY1-2# were constructed, the sequences of which are shown in SEQ ID NO. 12, SEQ ID NO. 13; the sequences of HEY1 siRNA-2# are shown in SEQ ID NO. 14, SEQ ID NO. 15. HEY1 high expression reagent was constructed, the sequence of which is shown in SEQ ID NO. 10. Lipo 2000 (Invitrogen, USA) was used to transfect siRNA or overexpression reagent, and cells were collected 24-48 h after transfection for RT-qPCR and western blotting experiments. RT-qPCR used HEY1 and FBP2 primer pairs, the sequences of which are shown in SEQ ID NO. 16, SEQ ID NO. 17, and the sequences of FBP2 primers are shown in SEQ ID NO. 2, SEQ ID NO. 3. Western blotting experiments used HEY1 antibody (dilution ratio 1:1000, Proteintech) and FBP2 antibody (dilution ratio 1:1000, Proteintech).
[0087] SEQ ID NO. 12
[0088] 5'-3' GCAGGAGGGAAAGGUUACUUUTT;
[0089] SEQ ID NO.13
[0090] 5'-3'AAAGUAACCUUUCCCUCCUGCTT;
[0091] SEQ ID NO.14
[0092] 5'-3'CCGACGAGACCGGAUCAAUAATT;
[0093] SEQ ID NO.15
[0094] 5'-3' UUAUUGAUCCGGUCUCGUCGGTT;
[0095] SEQ ID NO.16
[0096] 5'-3' AAGCAGGTAATGGAGCAAGG;
[0097] SEQ ID NO.17
[0098] 5'-3' CGAAATCCCAAACTCCGATA.
[0099] result
[0100] Prediction using the JASPAR website revealed a binding site between the downstream classical target gene HEY1 of NOTCH3 and the promoter region of FBP2. Figure 3 a) Therefore, a reporter gene plasmid vector3.1(+)-HEY1 was constructed by inserting a specific fragment of the FBP2 promoter before the luciferase expression sequence. The reporter gene plasmid and vector3.1(+)-HEY1 were co-transfected into HEK293T cells. The results showed that the HEY1 transcription factor could activate the FBP2 promoter region, inhibiting luciferase gene expression. The expression level of luciferase was inversely proportional to the intensity of the transcription factor's effect. After mutating a specific site in the FBP2 promoter region, the expression level of luciferase significantly increased. These experimental results indicate that HEY1, by binding to the FBP2 promoter region, transcriptionally inhibits FBP2 expression. Figure 3b) By consulting the literature, the present application speculates that HEY1 usually binds histone H3 in the promoter region of downstream target genes, and regulates target gene expression by methylation. To verify the view of the literature and specifically analyze the relationship between HEY1 and FBP2, the present application uses the method of chromatin immunocoprecipitation (Chromatin immunocoprecipitation, CHIP), and the results show that HEY1 is highly combined with the promoter region of FBP2, and is highly combined with histone H3 Figure 3 c) Further, after knocking down HEY1, the expression amount of FBP2 in HTR-8 / SVneo and BeWo trophoblast cells is increased Figure 3 d-g), and after overexpressing HEY1, the expression of FBP2 in trophoblast cells is inhibited Figure 3 h-k). Example 3
[0101] Analysis of FBP2 downstream signaling pathway
[0102] Methods
[0103] Extraction of tissue (cell) RNA and RT-qPCR
[0104] Total RNA was isolated from tissues and cultured cells using Trizol reagent (Invitrogen), and its quality and quantity were evaluated by anoDrop2000c (Fisher Scientific, Waltham, Massachusetts, USA). RNA was reverse transcribed into cDNA by HIScriptIII All-in-one RT SuperMix kit (Vazyme). Then, Taq Prouniversal SYBR qPCR mixed reagent kit (Vazyme) and specific FBP2, c-MYC and TFAM primers were used for quantitative PCR, the sequence of the FBP2 primer is shown as SEQ ID NO. 2, SEQ ID NO. 3; the sequence of the c-MYC primer is shown as SEQ ID NO. 18, SEQ ID NO. 19, and the sequence of the TFAM primer is shown as SEQ ID NO. 20, SEQ ID NO. 21.
[0105] SEQ ID NO. 18
[0106] 5'-3' CCGCCTGCGATGATTTATAC;
[0107] SEQ ID NO. 19
[0108] 5'-3' CAGCCGAGCACTCTAGCTCT;
[0109] SEQ ID NO. 20
[0110] 5'-3' GCCCTAAGTCCCTGTGTCAT;
[0111] SEQ ID NO. 21
[0112] 5'-3' TGCATTTGTCCCGAGATGTT.
[0113] Cell culture and transfection
[0114] Trophoblast cell lines were cultured in a 90 % humidity, 37 °C and 5 % CO2 incubator, and two human trophoblast cell lines (HTR-8 / SVneo and BeWo) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). HTR-8 / SVneo cells were cultured in DMEM (Gibco, USA) medium containing 10 % FBS, and 100 U / ml penicillin and 100 mg / ml streptomycin were added to the above culture. The trophoblast cell lines HTR-8 / SVneo and BeWo cells were cultured in a 6-well plate until 80 % confluence, and si-Control, si-FBP2-1#, si-FBP-2#, the sequence of the FBP2 siRNA-1# is shown in SEQ ID NO. 4, SEQ ID NO. 5; the sequence of the FBP2 siRNA-2# is shown in SEQ ID NO. 6, SEQ ID NO. 7; FBP2 overexpression reagent was constructed, the sequence of FBP2 is shown in SEQ ID NO. 1; c-MYC siRNA-1, 2# was constructed, the sequence of the c-MYC siRNA-1# is shown in SEQ ID NO. 22, SEQ ID NO. 23; the sequence of the c-MYC siRNA-2# is shown in SEQ ID NO. 24, SEQ ID NO. 25; siRNA was transfected using lipo 2000 (Invitrogen, USA), and cells were collected 24-48 h after transfection for RT-qPCR and western blotting experiments. Western blotting experiments used HEY1 antibody (dilution ratio 1:1000, Proteintech), FBP2 antibody (dilution ratio 1:1000, Proteintech) and TFAM antibody (dilution ratio 1:2000, Proteintech).
[0115] SEQ ID NO. 22
[0116] 5'-3' CAGAAAUGUCCUGAGCAAUTT;
[0117] SEQ ID NO. 23
[0118] 5’-3’ AUUGCUCAGGACAUUUCUGTT;
[0119] SEQ ID NO. 24
[0120] 5’-3’ CGAGCUAAAACGGAGCUUUTT;
[0121] SEQ ID NO. 25
[0122] 5’-3’ AAAGCUCCGUUUUAGCUCGTT.
[0123] Co-Immunoprecipitation (Co-IP)
[0124] NP-40 lysis buffer (MCE, USA) and protease inhibitor cocktail (MCE, USA) were mixed at a ratio of 1:100 and then added to HTR-8 / SVneo cells, which were lysed and the proteins were extracted. The protein lysis buffer was incubated with anti-lgG (3-5 ug) and the antibody of the target gene (FBP2 or c-MYC, 3-5 ug) at 4 °C overnight. The next day, after washing the A / G agarose beads (Santa, USA) with PBST buffer several times, the protein-antibody complex was incubated with the agarose beads at 4 °C for 4-6 hours. Then the agarose beads were extracted and washed with PBST for 3 times. Finally, 1-fold loading buffer was added and heated at 95 °C for 10 minutes, followed by Western blot analysis.
[0125] Chromatin immunoprecipitation (ChIP-qPCR)
[0126] The experiment uses Merck EZ Magna ChIP A / G (Merck, 17-10086), and the DNA in the cell is fixed and cross-linked by formaldehyde, and then the cell is lysed by using a cell lysis solution and a cell nucleus lysis solution to release the chromatin in the nucleus, and then the chromatin is further broken by ultrasonic, and then the FBP2 antibody is added to the cell lysis solution (1:50) and placed in a vertical suspension instrument at 4 DEG C for suspension overnight, and the next day, the EZ Magna ChIP A / G magnetic beads (Merck, 17-10086) are added to the antibody-cell lysis solution, and incubated at 4 DEG C for 4-6 hours, and then the precipitated complex is collected and washed to remove non-specific binding proteins; elution is carried out to obtain the enriched target protein-DNA complex, and after the de-crosslinking and purification of the enriched DNA fragments, qPCR analysis is carried out for verification, and qPCR uses a TFAM primer pair, and the TFAM primer sequences are shown in SEQ ID NO. 20 and SEQ ID NO. 21.
[0127] Results
[0128] The present application verifies the combination of FBP2 and c-MYC protein by Co-IP experiment ( Figure 4 a), and then further analyzes the regulatory relationship among FBP2, c-MYC and TFAM. First, the present application verifies that the expression of c-MYC and TFAM is significantly increased after siFBP2 transfection of HTR-8 / SVneo and BeWo cells by RT-qPCR and western blotting experiment ( Figure 4 b-e). On the contrary, the RT-qPCR and western blotting experiment results show that the expression levels of c-MYC and TFAM are significantly lower than those of the control group after overexpression of FBP2 in the above two trophoblast cell lines ( Figure 4 f-i). Secondly, in order to clarify the linear regulatory relationship between c-MYC and TFAM, the present application verifies that c-MYC is combined with the TFAM promoter region and transcribes to up-regulate the expression of TFAM by ChIP-qPCR experiment ( Figure 4 j). At the same time, the present application constructs a c-MYC siRNA knockdown and transfects it into trophoblast cell lines ( Figure 5 a-b), and the RT-qPCR and western blotting experiment results show that the decrease of c-MYC expression can inhibit the expression of TFAM ( Figure 5 c-f). In summary, the present application infers that FBP2 can be combined with c-MYC protein to transcriptionally regulate the expression of TFAM. Example 4
[0129] FBP2 is involved in regulating mitochondrial function
[0130] Methods
[0131] qPCR detection of mtDNA / nDNA ratio after mitochondria isolation experiment
[0132] After the cells were broken by grinder, the mitochondria and nucleus were separated by mitochondria isolation and protein extraction kit (Proteintech, PK10016). After the nucleus and mitochondria were lysed by nucleus lysis solution and mitochondria lysis solution, the nuclear DNA and mitochondrial DNA were extracted by DNA extraction box, and then qPCR quantification and comparison were performed. The qPCR used tRNA Leu and β2M primer pairs, the tRNA Leu primer sequences are shown in SEQ ID NO. 26, SEQ ID NO. 27; the β2M primer sequence is shown in SEQ ID NO. 28, SEQ ID NO. 29.
[0133] SEQ ID NO. 26
[0134] 5'-3' CACCCAAGAACAGGGTTTGT;
[0135] SEQ ID NO. 27
[0136] 5'-3' TGGCCATGGGTATGTTGTTA;
[0137] SEQ ID NO. 28
[0138] 5'-3' TGCTGTCTCCATGTTTGATGTATCT;
[0139] SEQ ID NO. 29
[0140] 5'-3' TCTCTGCTCCCCACCTCTAAGT.
[0141] MitoTracker Red CMXRos staining and photographing by confocal microscope
[0142] After plating trophoblast cell lines HTR-8 / SVneo and BeWo on cell slides, transfecting Vector and FBP2 siRNA respectively, staining with MitoTracker Red CMXRos (100 nM, Invitrogen, USA) at 37°C for 30 min. After staining, cells were washed twice with preheated PBS and fixed with preheated 4% paraformaldehyde (biosharp, China) for 15 min. After PBS washing, cells were permeabilized with 0.1% Triton X-100 solution (biosharp, China), and then mounted with anti-quenching agent containing DAPI (biosharp, China). Fluorescence images were acquired using Zeiss LSM 700 laser scanning confocal microscope (Zeiss, Germany). The excitation wavelengths of MitoTracker Red CMXRos and DAPI were 579 nm and 405 nm, respectively. Images were collected and analyzed.
[0143] MitoTracker® Green FL staining and flow cytometry analysis
[0144] Trophoblast cells were digested and resuspended with 0.25% trypsin (Gibco, USA), and then plated in 6-well plates. After 24 h, MitoTracker® Green FL reagent (1:2 000, Invitrogen, USA) was added to the cell wells, and then incubated at 37°C for 30 min. After PBS washing (Gibco, USA), cells were digested and resuspended with trypsin without EDTA (Gibco, USA), and then analyzed on a flow cytometer (Beckman, USA).
[0145] Transmission electron microscopy for mitochondrial morphology
[0146] Cells were scraped from the wall of the culture plate using a cell scraper, and then centrifuged at 2000-3000 r / min for 5 min. Then, the supernatant was discarded and the cell pellet was fixed with high-concentration glutaraldehyde (about 4%, Invitrogen, USA). After 3-4 h of fixation, the cells were gently lifted along the tube wall of the centrifuge tube using a cell pick (note that the cells should not be scattered during picking. After the cells were grouped, the larger ones were cut into pieces ≤1 mm 3 using a double-edged blade). Then, the cell groups were fixed in 2.5%-3% glutaraldehyde (Invitrogen, USA), followed by osmium acid fixation, embedding, sectioning, staining, and observation using a transmission electron microscope.
[0147] Seahorse XF experiment
[0148] Mitochondrial stress test (Oxygen consumption rate, OCR)
[0149] Preparation before experiment: Seed cells in XF-24 cell culture plates (Agilent, USA) at appropriate density, incubate XF cell mitochondrial stress test detection solution (Agilent, USA) and XF cell mitochondrial stress test reagent (Agilent, USA) to 37 ℃ in advance. Hydrate the probe plate overnight before the experiment. (1) Take the cells transfected for 24-48 h from the CO2 cell incubator, observe the state of the cells under the optical microscope, if the cells are in good condition, continue the experiment; (2) Discard the original culture medium in the hole, wash the cells twice with XF mitochondrial stress test detection solution (1 mL), and finally add about 500 μl of detection solution, observe under the microscope to ensure that the cells are not sucked away; (3) Then incubate the cells plate treated in step (2) in a 37 ℃ incubator (without CO2) for 1 h, then dissolve the drug with mitochondrial stress test detection solution and adjust the concentration of the drug; (4) Take the hydrated probe plate (Agilent, USA) from the CO2-free incubator, add drugs to the drug holes of the probe plate: A hole-1 μM oligomycin (Agilent, USA) per hole, final concentration, B hole-1 μM carbonylcyanide p-trifluoromethoxyphenylhydrazone (FCCP) (Agilent, USA) uncoupling agent dilution, C hole-0.5 μM rotenone / antimycin A (Agilent, USA) per hole, final concentration; (5) Open the Seahorse software and set the program of the mitochondrial stress test. The default Mix-Wait-Measure time is 3 min-2 min-3 min. In the running interface, remove the support plate and cover plate, and place the probe plate for self-checking for about 20 min; (6) After the self-checking is completed, replace the cell plate with the function plate and continue the experiment. The reagents for cell transfection are (1) FBP2 siRNA-1, 2#, the sequence of FBP2 siRNA-1# is shown as SEQ ID NO. 4, SEQ ID NO. 5; the sequence of FBP2 siRNA-2# is shown as SEQ ID NO. 6, SEQ ID NO. 7; (2) FBP2 overexpression plasmid, the sequence of FBP2 is shown as SEQ ID NO. 1; (3) c-MYC siRNA-1, 2#, the sequence of c-MYC siRNA-1# is shown as SEQ ID NO. 22, SEQ ID NO. 23; the sequence of FBP2 siRNA-2# is shown as SEQ ID NO. 24, SEQ ID NO. 25;
[0150] Extracellular acidification rate (ECAR)
[0151] Preparation before experiment: seed cells with appropriate density in XF-24 well cell culture plate, pre-incubate XF cell XF glycolysis detection solution (Agilent, USA) and XF cell glycolysis detection reagent (Agilent, USA) to 37 DEG C. Hydrate the probe plate overnight before the experiment. (1) Take the cells transfected for 24-48 h from the CO2 cell incubator, observe the state of the cells under the optical microscope, if the state of the cells is good, continue the experiment; (2) discard the original hole culture medium, wash the cells with XF glycolysis detection solution (1 mL) 2 times, and finally add detection solution about 500 μl, observe under the microscope to ensure that the cells are not sucked; (3) then put the cell plate treated in step (2) in the 37 DEG C incubator (without CO2) for 1 h, then dissolve the drug with XF glycolysis detection solution and adjust the concentration of the drug; (4) take the hydrated probe plate from the CO2-free incubator, add the drug in the drug hole of the probe plate: A hole-10 mM glucose (Glucose) (Agilent, USA) final concentration per hole, B hole-1 μMoligomycin diluent, C hole-50 mM 2-deoxy-D-glucose (2-Deoxy-D-Glucose, 2-DG) (Agilent, USA) final concentration per hole; (5) open the software of Seahorse and set the glycolysis detection program. The default Mix-Wait-Measure time is 3 min-2 min-3 min. In the running interface, take off the support plate and cover plate, and put the probe plate into the self-checking for about 20 min; (6) after the self-checking is completed, replace the cell plate with the function plate and continue the experiment.
[0152] Results
[0153] The RT-qPCR experiment results after knocking down or overexpressing FBP2 at the cell level show that knocking down FBP2 can up-regulate the mtDNA / nDNA ratio in HTR-8 / SVneo and BeWo cells ( Figure 6 a), and overexpressing FBP2 leads to down-regulation of the mtDNA / nDNA ratio in HTR-8 / SVneo and BeWo cells ( Figure 6 b). In addition, knocking down c-MYC reduces the mtDNA / nDNA ratio in HTR-8 / SVneo and BeWo cells ( Figure 6 c). To further verify the effect of FBP2 on mitochondrial mass and morphological changes, the present application uses IF experiment to perform fluorescence co-localization on mitochondria and downstream gene TFAM, and finds that compared with the control group, the mitochondrial morphology in the HTR-8 / SVneo and BeWo trophoblast cell lines overexpressing FBP2 shows a punctate broken change, and the mitochondrial staining fluorescence intensity and TFAM immunofluorescence intensity are also significantly down-regulated ( Figure 6d-e). In addition, the present application also uses flow cytometry to quantify the changes in mitochondrial staining fluorescence intensity in the control group and the FBP2 overexpression group, and the results show that overexpression of FBP2 can lead to a decrease in mitochondrial mass ( Figure 6 f). Similarly, the present application also verifies the changes in mitochondrial morphology of the c-MYC gene downstream of FBP2, and the results show that the mitochondria in the trophoblast cell line with c-MYC knockdown are in a fragmented state, and the mitochondrial fluorescence intensity and TFAM protein immunofluorescence intensity are weakened ( Figure 6 g-h).
[0154] Secondly, the present application uses Seahorse XF experiments to verify the effect of FBP2 on mitochondrial oxidative phosphorylation. The OCR experiment verifies that FBP2 is involved in regulating the oxidative phosphorylation capacity of mitochondria, in which the basal respiration rate, maximum respiration rate, proton leakage and ATP output in HTR-8 / SVneo and BeWo trophoblast cells with low expression of FBP2 are significantly higher than those in the control group ( Figure 7 a-b), while the oxidative phosphorylation capacity is significantly down-regulated after overexpression of FBP2 ( Figure 7 c-d). In addition, the oxidative phosphorylation of the trophoblast cell line after c-MYC knockdown is also significantly inhibited ( Figure 7 e-f). In summary, FBP2 and its downstream c-MYC can regulate the changes in mtDNA quantity, affect the changes in mitochondrial morphology and mass, and affect the mitochondrial oxidative phosphorylation of trophoblast cells.
[0155] Finally, the present application uses western blotting experiments to verify the regulatory relationship between FBP2, c-MYC and TFAM, and the expression of TFAM is significantly down-regulated after overexpression of FBP2, while the expression of TFAM is increased after overexpression of c-MYC on the basis of overexpression of FBP2 ( Figure 7 g-h). Example 5
[0156] Immunofluorescence (IF)
[0157] Prepare tissue frozen sections and place them on slides, fix them with 4% paraformaldehyde for 15 min, and then increase the permeability of the cell membrane of the tissue by using 0.1% Triton X-100 reagent. According to the steps of immunofluorescence, after blocking with 5% BSA solution for 2 h, washing with PBS for 3 times, adding TFAM antibody (1:500, Proteintech), and incubating overnight at 4°C. The next day, sequentially add fluorescently labeled secondary antibody (1:500, Abeam), and observe and take pictures under a fluorescence microscope.
[0158] Extraction of primary placental trophoblast cells
[0159] Method
[0160] Placental tissue samples of normal group and early-onset PE patients were obtained from cesarean section surgery patients in the obstetric department of Nanjing Maternal and Child Health Hospital. After the placenta was removed from the body, it was placed on a sterile operating table and cut into pieces using sterile scissors and forceps. The placental maternal surface at the umbilical cord attachment site was selected and the vascular infarction and fibrous connective tissue were avoided. The placental tissue was repeatedly washed with sterile PBS (containing double antibodies), and the tissue was cut as much as possible and the visible blood vessels and fibrous tissue were removed. The cut placental tissue was added to a mixture of 0.3% collagenase IV (Bi Yun Tian, China) and 0.2 mg / mL DNAse I (Bi Yun Tian, China), and was digested in a 37°C shaking bed at 120 r / min for 230 min. Then, serum was added to terminate the digestion, and the tissue residue was filtered out using a 100-mesh cell sieve, and the digestion solution was collected. The digestion solution was collected and leveled and placed in a pre-cooled 4°C centrifuge. After leveling, it was centrifuged at 1500 r / min for 15 min. The precipitate was retained after centrifugation and 3 mL of DMEM / F-12 culture solution (Gibco, USA) was added for resuspension.
[0161] Purification and identification of primary placental trophoblast cells
[0162] Using discontinuous Percoll density gradient separation method, 4 densities of Percoll separation solution (Bi Yun Tian, China) (70%, 50%, 30%, 10%) were layered in 15 mL sterile centrifuge tubes according to the concentration from high to low. 3 mL of each Percoll separation solution was then added, and then 3 mL of cell suspension was slowly added to the upper layer of Percoll separation solution. The above 15 mL centrifuge tube was placed in a pre-cooled 4°C centrifuge, and after leveling, it was centrifuged at 2 000 r / min for 20 min. The cloud-like cell layer at the specific density Percoll layer (density between 30% and 50%) was carefully aspirated with a 1 mL syringe tip, and then placed in a sterile 15 mL centrifuge tube. Then, 4 mL of DMEM medium (Gibco, USA) was added for resuspension, and the centrifuge was placed in the centrifuge room temperature 1 000 r / min for 5 min, and the cell precipitate was retained. The cell precipitate in the centrifuge tube was resuspended with DMEM / F-12 containing 15% fetal bovine serum, and the cell suspension concentration was adjusted to 1×10 6 / well, and was seeded in a 6-well plate pre-coated with a cover glass and ECM glue, and was cultured in a cell culture incubator.
[0163] After 24 h of cell culture, the cell crawl sheet in the 6-well plate was taken out, washed with PBS for 3 times, fixed with 4% paraformaldehyde for 15 min, and then the cell membrane permeability was increased by using 0.1% Triton X-100 reagent. According to the steps of immunofluorescence, after 5% BSA solution was blocked for 2 h, PBS was washed for 3 times, human chorionic gonadotrophin (β-humanchorionic gonadotrophin, β-HCG) (1:200, Abcam, USA) and human leucocyte antigen-G (human leucocyte antigen-G, HLA-G) monoclonal antibody (1:200, Abcam, USA) were added, and incubated at 4 ℃ overnight. The next day, fluorescently labeled secondary antibody (1:500, Abcam, USA) was added in turn, and the purity was calculated by observing and taking pictures under a fluorescence microscope. After the purity was determined, the primary placental trophoblast cells were collected for subsequent immunofluorescence and qPCR experiments. In the qPCR experiment, specific FBP2, c-MYC and TFAM primer pairs were used, wherein the FBP2 primer sequences are shown as SEQ ID NO. 2 and SEQ ID NO. 3; the c-MYC primer sequences are shown as SEQ ID NO. 18 and SEQ ID NO. 19; and the TFAM primer sequences are shown as SEQ ID NO. 20 and SEQ ID NO. 21.
[0164] Results
[0165] In the present application, the expression differences of HEY1, FBP2 and TFAM in human normal and PE placental tissues were verified by qPCR and western blotting experiments, and the results showed that the mRNA and protein expression amounts of HEY1 and TFAM in PE placental tissues were significantly down-regulated, and the expression of FBP2 was up-regulated Figure 8 a-b). Similarly, we also verified that TFAM was significantly lowly expressed in PE placenta by using tissue IF Figure 8 c).
[0166] Secondly, the primary trophoblast cells (PTC) were extracted and purified from placental tissues in the present application. After identification by IF experiment (HLA-G and β-HCG antibody) in the present application Figure 8 d), the expression of HEY1, c-MYC and TFAM in PTC in the early-onset PE group was significantly down-regulated, and the expression of FBP2 was significantly up-regulated, which was verified by qPCR experiment results. In addition, the PTC cells were fluorescently stained by using MitoTracker Red CMXRos mitochondrial dye, FBP2 and TFAM antibodies, and photographed by confocal microscope, and the results showed that the mitochondrial staining fluorescence intensity in PTC in the PE group was significantly down-regulated, and the fluorescence intensity of FBP2 and TFAM was also significantly down-regulatedFigure 8 fg). Example 6
[0167] Animal-level observation of L-NAME-induced PE rat model - mimicking PE-like manifestations and placental damage
[0168] method
[0169] Mature female Sprague–Dawley (SD) rats (8 weeks old, weighing 200-250 g) were randomly divided into two groups after thrombus detection: a control group (n=10) and a L-NAME (nitroso-L-arginine methyl ester) model group (n=10). They were housed in separate cages in an air-conditioned room at an ambient temperature of 21±3℃. From gestation day 7.5 to 18.5, pregnant rats in the L-NAME model group received L-NAME via intraperitoneal injection every other day. Blood pressure fluctuations in both the control and L-NAME model groups were assessed using a customer-programmed electronic blood pressure monitor (BP-98A; Softron, Tokyo, Japan). Placental tissue was collected from rats after termination of pregnancy on gestation day 18.5 for subsequent experiments. This model was used to investigate the molecular mechanism of action of FBP2 in vivo. This study was approved by the Animal Care and Use Committee of Nanjing Medical University in accordance with the National Institutes of Health's Animal Use Guidelines.
[0170] <Detection and Verification of Relevant Indicators>
[0171] (1) General observation of pregnant mice in the group: The general condition of each group of pregnant mice was observed, such as weight and blood pressure. After 18.5 days of gestation, the experimental mice were euthanized and placental tissue samples were obtained. The pups and placenta were dissected and the number of pups was recorded. The fetuses and placentas were dried and weighed.
[0172] (2) Animal blood pressure: The rats in the experimental group and the control group were fixed in round rat cages with their tails fully exposed. Under quiet conditions, the blood pressure of all groups of rats was measured by the tail clip method using a programmed electronic blood pressure monitor.
[0173] (3) The expression levels of HEY1, FBP2 and their downstream related molecules c-MYC and TFAM in the placenta were detected by western blotting. The western blotting experiment used HEY1 antibody (dilution ratio: 1:000, Proteintech, China), FBP2 antibody (dilution ratio: 1:000, Proteintech, China), c-MYC antibody (dilution ratio: 1:000, Proteintech, China) and TFAM antibody (dilution ratio: 1:000, Proteintech, China).
[0174] Results
[0175] The present application constructs a control pregnant rat group and an L-NAME induced PE pregnant rat group model Figure 9 a), during the pregnancy of rats, we record the fluctuation of blood pressure (systolic and diastolic blood pressure) of the two groups of pregnant rats, and the results show that compared with the control group, the blood pressure of the L-NAME group of pregnant rats shows a gradually rising trend after GD 7.5 days Figure 9 b). The pregnant rats were terminated on GD 18.5 days, and the weights of the control group and the L-NAME induced PE group were collected and weighed, and the results showed that the weights of the fetus and placenta of the L-NAME induced PE rats were significantly smaller than those of the control group Figure 9 c).
[0176] The present application further verifies that the expression of HEY1, c-MYC and TFAM in the placenta of L-NAME induced PE rats is reduced, and the expression of FBP2 is up-regulated by western blotting experiment, which shows that the HEY1-FBP2 / c-MYC-TFAM regulatory axis is involved in the occurrence and progression of PE Figure 9 d).
[0177] It should be noted that the above content only illustrates the technical idea of the present application, and cannot be used to limit the protection scope of the present application. For ordinary skilled persons in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, which fall within the protection scope of the claims of the present application.
Claims
1. Use of a reagent for detecting FBP2 protein or mRNA in the manufacture of a diagnostic kit for preeclampsia, characterized in that, The sequence of the FBP2 is shown as SEQ ID NO.
1.
2. Use of the reagent for detecting FBP2 protein or mRNA according to claim 1 in the preparation of a preeclampsia diagnosis kit, characterized in that, The reagent for detecting FBP2 mRNA includes a primer pair for specifically detecting FBP2 expression.
3. Use of the reagent for detecting FBP2 protein or mRNA according to claim 2 in the preparation of a preeclampsia diagnosis kit, characterized in that, The sequence of the upstream primer of the primer pair is shown as SEQ ID NO. 2, and the sequence of the downstream primer of the primer pair is shown as SEQ ID NO.
3.
4. Use of a FBP2 low expression agent in the preparation of a drug for treating preeclampsia, characterized in that, The sequence of the FBP2 is shown as SEQ ID NO. 1; the low-expression reagent is FBP2 siRNA-1#, FBP2 siRNA-2#; the sequence of the FBP2 siRNA-1# is shown as SEQ ID NO. 4, SEQ ID NO. 5; and the sequence of the FBP2 siRNA-2# is shown as SEQ ID NO. 6, SEQ ID NO. 7.