A SNP locus associated with the wing width trait in bees and its application
By using genome sequencing and GWAS analysis, the SNP locus at position 6431988 on chromosome 12 of honeybee was screened out. Primer pairs were designed for PCR amplification, which solved the complexity and error problems in the identification of wing width in honeybees and achieved efficient and accurate wing width identification and breeding.
Patent Information
- Application Number
- CN202411403901.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-09
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2044-10-09
AI Technical Summary
In existing technologies, the identification of wing width in honeybees relies on morphological measurements, which are complex to operate, prone to human error, and lack standardized criteria. Furthermore, there is a lack of clearly defined SNP sites for genome sequencing identification.
By using genome sequencing and GWAS analysis, the SNP locus at position 6431988 of honeybee chromosome 12 (polymorphism C/G) was screened out, and primer pairs were designed for PCR amplification to achieve molecular marker identification of wing width trait.
It enables efficient and accurate identification of wing width traits in bees, simplifies the operation process, reduces human error, and provides a tool for selecting high-quality bee germplasm resources.
Smart Images
Figure CN119351565B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of animal breeding technology, and in particular to a SNP locus related to the wing width trait of bees and its application. Background Technology
[0002] Chinese honeybee ( Apis cerana The Chinese honeybee (Apis cerana), also known as the Chinese honeybee, has developed rich local resource types (ecotypes) in diverse geographical environments, exhibiting different morphological characteristics, biological properties, and production performance. Effectively evaluating the morphological traits of the Chinese honeybee is an important means of discovering, protecting, identifying, and utilizing bee resources, and it is also a necessary method for evaluating bee performance in apiculture production.
[0003] Traditional and classic methods for bee species identification and performance evaluation focus on morphological markers. While morphological markers offer advantages such as low cost and ease of operation, they also have inherent drawbacks and are not applicable to Chinese honeybees. First, morphological markers are directly related to the individual development of bees and are easily affected by external interference factors such as nutritional conditions during development. Second, morphological measurements of Chinese honeybees are highly precise, requiring strict standards for instrument accuracy and the anatomical proficiency of the personnel. Furthermore, the sheer volume of work involved in bee morphological measurements makes them less practical. Finally, the lack of standardized morphological measurement criteria for Chinese honeybees leads to human error among measurement personnel, significantly impacting result interpretation. Wing width is one of the important morphological traits of honeybees, influencing their flight ability, energy consumption, and pollen collection efficiency to a certain extent. Developing molecular markers related to wing width is beneficial for breeding high-quality bee species.
[0004] First-generation sequencing (FGS) molecular techniques are mature, easy to operate, and currently available in the market, enabling rapid sequencing of target gene fragments at low cost and without significant technological limitations. By combining genome sequencing with GWAS analysis of the wing width trait in Apis cerana, SNP loci associated with wing width can be identified, allowing for the identification of wing width using FGS, replacing the cumbersome wing width measurement process. However, the SNP loci associated with wing width in Apis cerana are currently unclear, making it impossible to identify this trait using simple first-generation sequencing. Summary of the Invention
[0005] In order to solve the problems existing in the prior art, the present invention provides an SNP site related to the wing width trait of bees and its application.
[0006] In a first aspect, the present invention provides a SNP site based on genome version PRJNA738447, wherein the SNP site is located at position 6431988 on chromosome 12 of honeybee and has a polymorphism of C / G.
[0007] The present invention further provides an SNP site located at position 125 of the nucleotide sequence shown in SEQ ID NO.1, with a polymorphism of C / G.
[0008] Such as SEQ ID The nucleotide sequence shown in NO.1 is as follows: TAGCTCGCGTGATAGGATGGTATCAAGCTCGATGAAAAAAGGAAGAAAGAAAAGGAAAGGGAAAAAAAATCTAAAATCTTCCGATACAAAAAGTTGCTCTCGTGTAATCGACTCGATTACAGATGATCGATCAAAACTAGATCGACTCGTGAAAATCTCTTTTCTC CAATTACCAGCATTGGAGGATTTAAATTCGAATCGTGTTTCCCAAGTATCGACGAAAGATTCGGATCTACACGCGCAATCTACCTAATCGTTTACGTATCTCGCGCCAACTACAACAGGATTCCTATTAAAATCTACTCTACATCGCGTACATACGCATCGGTATATTCGCATCGGTGGT.
[0009] In a second aspect, the present invention provides a primer pair comprising the nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO.3.
[0010] The nucleotide sequence shown in SEQ ID NO.2 is as follows: TAGCTGCGTGATAGGATGG; the nucleotide sequence shown in SEQ ID NO.3 is as follows: ACCACCGATGCGAATATACC.
[0011] Thirdly, the present invention further provides a kit comprising the SNP site or the primer pair.
[0012] Fourthly, the present invention provides the application of the SNP site, the primer pair, or the kit in identifying the wing width trait of bees.
[0013] The present invention further provides the application of the SNP site, the primer pair, or the kit in the breeding of bees with different wing width traits.
[0014] Furthermore, the bee in question is the Oriental honeybee.
[0015] Fifthly, the present invention provides a method for identifying characteristics of bee wings, comprising:
[0016] Using the DNA of the bee to be tested as a template, the primer pair was used for amplification, and the wing width of the bee to be tested was determined based on the amplification results.
[0017] Further, based on a total system volume of 25 μL, the amplified system comprises:
[0018] Template DNA 1-2 μL, upstream primer 1-2 μL, downstream primer 1-2 μL, Dntp mix 1-2 μL, 10×Taq Buffer 2-4 μL, Taq enzyme 0.2-0.4 μL, the remainder is water;
[0019] The amplification procedure includes:
[0020] Pre-denaturation at 95℃ for 5-10 minutes;
[0021] The process involves denaturation at 92-96℃ for 30-60 seconds, annealing at 62-65℃ for 30-60 seconds, and extension at 70-74℃ for 30-60 seconds, repeated 10-15 times, with the annealing temperature decreasing by 0.4-0.6℃ each time.
[0022] Denaturation at 93~96℃ for 30~60s, annealing at 56~60℃ for 30~60s, extension at 70~74℃ for 30~60s, cycle 25~35 times;
[0023] Repair and extend the treatment at 70~74℃ for 10~15 minutes.
[0024] Furthermore, determining the wing width of the bee under test based on the amplification results includes:
[0025] In the amplification results, the primer pair identified that bees with the GG genotype had longer wing widths than bees with the GC genotype.
[0026] The present invention has the following beneficial effects:
[0027] This invention, based on wing width data from multiple Chinese honeybees, identifies a single Special Nominated Participant (SNP) locus through genomic association analysis. This SNP locus is associated with the wing width trait in honeybees, and its detection allows for the identification of this trait. The SNP locus provided by this invention can be used for breeding honeybees with specific wing width traits, which is of great significance in the field of cultivating high-quality honeybee germplasm resources. Attached Figure Description
[0028] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0029] Figure 1 This is a comparison diagram of wing width of individuals with different genotypes at the Chr12_6431988 locus of the Chinese honeybee provided in Example 2 of the present invention.
[0030] Figure 2 This is a gel electrophoresis image of the amplification results of the primer pair provided in Example 3 of the present invention (targeting site 6431988 on honeybee chromosome 12); the left band is the marker and the three right bands are the amplification products. Detailed Implementation
[0031] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.
[0032] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.
[0033] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.
[0034] Example 1
[0035] This invention provides the screened SNP site (Chr12_6431988), and the screening process is as follows:
[0036] 1. This invention is based on a sample of 110 colonies of Chinese honeybees. One worker bee from each colony was selected and its forewing width was measured. Genomic DNA was extracted from the thoracic tissue of the dissected worker bees, and library construction was performed using the Trussq Nano DNA HT kit (Illumina, USA). The DNA was randomly fragmented into 350bp fragments, and after end repair, addition of polyA tails, addition of sequencing adapters, amplification, and purification, a DNA library was obtained. The insert size of the library was quality checked using an Agilent 2100, and the effective concentration of the library was accurately quantified using qPCR. Once the quality met the standards, the DNA library construction was complete.
[0037] 2. Genome Sequencing, Alignment, and SNP Identification: After successful library construction, genome sequencing was performed on the Illumina Hiseq PE150 platform (Illumina, USA). Low-quality reads were removed during sequencing to ensure result quality [quality control standards: remove reads containing more than 10% unknown nucleotides, remove reads containing adapter sequences, remove reads with low-quality (phred quality < 5) bases exceeding 50% in length]. Finally, each bee sample generated over 4.5G of high-quality, clean reads with paired ends, with Q20 and Q30 values exceeding 90% and 85%, respectively.
[0038] 3. The high-quality paired-end clean reads obtained were aligned to the reference genome Apis cerana (Genbank accession number: PRJNA738447) using BWA 0.7.8 software. The alignment results were then deduplicated using SAMTOOLS 1.15 software. The average alignment rate for the population sample was maintained above 95%, and the average sequencing depth of the genome was above 20X.
[0039] 4. SNPs were detected using a Bayesian model in SAMTOOLS 1.15 software. High-quality SNPs were selected based on quality control criteria: SNPs with a sequencing error rate >1% (Q20 quality control) were deleted; SNPs with a gap of <5 bases between adjacent SNP sites were deleted; and SNPs with a coverage depth exceeding 1 / 3 to 5 times the average depth were deleted. The detected SNPs were annotated using ANNOVAR 20130520 software to identify exon regions, intron regions, alternative splicing sites, upstream and downstream gene regions, and intergenic regions, distinguishing between synonymous and non-synonymous SNPs.
[0040] 5. Genome-wide association studies (GWAS): Genome-wide association studies (GWAS) were conducted using mrMLM 1.3 software to clarify the association between wing width traits and SNP loci. The quality control standard for SNPs was based on MAF > 5%, and a multi-locus randomized mixed linear model was selected.
[0041] Finally, a SNP locus Chr12_6431988 was obtained, which is located at position 6431988 on chromosome 12 of honeybee, with a polymorphism of C / G. The polymorphism of this locus is highly correlated with the wing width trait of honeybees.
[0042] Example 2
[0043] This invention selected 107 samples of Chinese honeybees for verification to verify the effect of the SNP sites involved in Example 1. Specifically, sequencing was performed on these 107 Chinese honeybees, and the wing width of the 107 honeybees was measured using a microscopic measurement system to obtain wing width data and SNP data of the 107 honeybees.
[0044] The wing width data of different groups were grouped according to the genotype at the SNP locus, and SPSS 16.0 software was used to perform significance analysis on the differences in wing width between different groups to compare whether there are differences in wing width among different genotypes.
[0045] Ultimately, 16 Chinese honeybees exhibited the C / C genotype, 53 exhibited the G / C genotype, and 38 exhibited the G / G genotype. LSD data analysis (as shown in Table 1) was then conducted. Figure 1 As shown in the figure, there was a significant difference in wing width between the G / C genotype and the G / G genotype (P<0.05), with the wing width of the G / C genotype honeybee being significantly smaller than that of the G / G genotype honeybee.
[0046] Table 1. Comparison of wing width among individuals with different genotypes at the Chr12_6431988 locus in honeybees.
[0047]
[0048] *express P <0.05, the difference is significant.
[0049] Example 3
[0050] This invention further amplifies the SNP sites involved in Example 1 using three samples, specifically including:
[0051] 1. Primer pairs are as follows:
[0052] Upstream primer: 5'-TAGCTCGCGTGATAGGATGG-3',
[0053] Downstream primer: 5'-ACCACCGATGCGAATATACC-3'.
[0054] 2. The PCR system is as follows:
[0055]
[0056] The PCR procedure is as follows:
[0057]
[0058] 3. Test Results
[0059] The results are as follows Figure 2As shown in the results, the electrophoretic bands of the amplified DNA fragments are clear, bright, and free of impurities, indicating that the primers, amplification system, and program are highly specific and can achieve the purpose of detecting polymorphisms at target SNP sites when combined with sequencing and other methods.
[0060] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. Application of SNP sites, primer pairs, or kits in identifying the wing width trait of the Chinese honeybee; Based on genome version PRJNA738447, the SNP site is located at position 6431988 on honeybee chromosome 12, and the polymorphism is C / G; The primer pair is used to amplify the SNP site, and its nucleotide sequence is shown in SEQ ID NO.2 and SEQ ID NO.3; The kit includes the primer pair.
2. Application of SNP sites, primer pairs, or kits in the breeding of Chinese honeybees with different wing width traits; Based on genome version PRJNA738447, the SNP site is located at position 6431988 on honeybee chromosome 12, and the polymorphism is C / G; The primer pair is used to amplify the SNP site, and its nucleotide sequence is shown in SEQ ID NO.2 and SEQ ID NO.3; The kit includes the primer pair.
3. A method for identifying wing characteristics of the Chinese honeybee, characterized in that, include: Using the DNA of the bee to be tested as a template, amplification is performed using the primer pairs described in claim 1 or 2, and the wing width of the bee to be tested is determined based on the amplification results. The determination of the wing width of the bee under test based on the amplification results includes: In the amplification results, the primer pair identified that bees with the GG genotype had longer wing widths than bees with the GC genotype.
4. The method according to claim 3, characterized in that, Based on a total volume of 25 μL, the amplified system comprises: Template DNA 1-2 μL, upstream primer 1-2 μL, downstream primer 1-2 μL, Dntp mix 1-2 μL, 10×Taq Buffer 2-4 μL, Taq enzyme 0.2-0.4 μL, the remainder is water; The amplification procedure includes: Pre-denaturation at 95℃ for 5-10 minutes; The process involves denaturation at 92-96℃ for 30-60 seconds, annealing at 62-65℃ for 30-60 seconds, and extension at 70-74℃ for 30-60 seconds, repeated 10-15 times, with the annealing temperature decreasing by 0.4-0.6℃ each time. Denaturation at 93~96℃ for 30~60s, annealing at 56~60℃ for 30~60s, extension at 70~74℃ for 30~60s, cycle 25~35 times; Repair and extend the treatment at 70~74℃ for 10~15 minutes.