Three molecular markers associated with flowering phase of camellia oleifera and application of three molecular markers in early identification
Through the development of three SNP molecular marks related to the camellia period, the problem of difficulty to efficiently identify the oil and camellia period in the existing technology, realize the fast and accurate cashmeal period identification, promote the stability of the yield of the camellia and the cultivation of the early flowering varieties Essence
Patent Information
- Application Number
- CN202410983039.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-22
- Publication Date
- 2025-01-24
AI Technical Summary
The prior art is difficult to efficiently identify the tea flowering period, resulting in low and unstable tea production.
Three SNP molecular labels related to the camellia period (CCH05T003147.1, CCH05T003177.1, and CCH05T003279.1) were developed. Through the genotype of the SNP sites of these tags, the camellia period was quickly identified.
Realize the efficient and fast cashmeal period identification. It can predict the flowering time of carite, avoid disadvantaged weather, promote the cultivation of early flowering oil and tea varieties, and improve the stability of the yield of camellia.
Smart Images
Figure QLYQS_1 
Figure QLYQS_2 
Figure BDA0004956626050000021
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of oil-tea camellia molecular biology, and specifically relates to three molecular markers associated with the flowering period of oil-tea camellia and their application in early identification. Background Art
[0002] Camellia oleifera Abel. belongs to the Theaceae and Camellia plants, and is an important woody edible oil tree species in my country. It is a plant that blooms in autumn and winter and is self-incompatible. It needs to realize outcrossing with the help of insect pollination to pollinate well and bear fruit. However, the temperature of the oil camellia flowering period in autumn and winter is low, and few insects come out to pollinate and realize outcrossing, so it causes its low and unstable yield, which has become a scientific problem that has long troubled the healthy development of my country's oil camellia industry. Developing molecular markers related to the flowering time of oil camellia can conveniently and quickly predict the flowering time of oil camellia, avoid unfavorable weather during the flowering period of oil camellia, and accelerate the cultivation of new varieties of oil camellia that bloom early. Therefore, it is very necessary to provide a molecular marker that is highly efficient, highly applicable, and can be quickly applied to detect the relevant flowering period of oil camellia. Summary of the invention
[0003] The technical problem to be solved by the present invention is to overcome the deficiencies of the prior art and develop a SNP molecular marker related to the flowering period of oil-tea camellia with high identification efficiency and strong applicability and its application.
[0004] In order to solve the above technical problems, the present invention adopts the following technical solutions.
[0005] The invention discloses three SNP molecular markers associated with the flowering period of Camellia oleifera, wherein the SNP molecular markers are Cch05T003147.1, Cch05T003177.1 and Cch05T003279.1, and the SNP sites of the SNP molecular markers are located at the bases 136885395, 138308185 and 142947689 of chromosome 5 of Camellia oleifera, respectively, and the bases of the SNP sites are A or T, C or T and A or G, respectively.
[0006] Therefore, the present invention provides 1. A SNP molecular marker associated with the flowering period of Camellia oleifera, characterized in that: it is a molecular marker Cch05T003147.1, which is composed of a marker site where the A changes to T at the 195407115 base of chromosome 5 of Camellia oleifera; a molecular marker Cch05T003177.1, which is composed of a marker site where the base C changes to T at the 138308185 base of chromosome 5 of Camellia oleifera; or a molecular marker Cch05T003279.1, which is composed of a marker site where the A changes to G at the 142947689 base of chromosome 5 of Camellia oleifera.
[0007] Specifically, the SNP molecular marker includes DNA fragment 1, DNA fragment 2 or DNA fragment 3; the nucleotide sequence of the DNA fragment 1 is shown as SEQ ID NO.1; the nucleotide sequence of the DNA fragment 2 is shown as SEQ ID NO.2; the nucleotide sequence of the DNA fragment 3 is shown as SEQ ID NO.3.
[0008] More specifically, the three primers of Cch05T003147.1 markers F1, F2, and R are as follows:
[0009] Specific primer Primer F1 GAAGGTGACCAAGTTCATGCTTTTTGAACACCCACCACAAA Primer F2 GAAGGTCGGAGTCAACGGATTCTTTTGAACACCCACCACAAT Universal Primer Primer R TTTCTTTGCACCTCCATTCTCTTCA
[0010] The three primers of Cch05T003177.1 markers F1, F2, and R are as follows:
[0011] Specific primer Primer F1 GAAGGTGACCAAGTTCATGCTGGGTTGCGAAAGCAAATATAG Primer F2 GAAGGTCGGAGTCAACGGATTGGGTTGCGAAAGCAAATATAA Universal Primer Primer R CCCATGTATGTCTCCATAGCTCAA
[0012] ; Cch05T003279.1 markers F1, F2, R three primers are as follows:
[0013]
[0014] Among them, the universal primer is optionally included and is not essential.
[0015] The present invention provides the use of the SNP molecular marker in identifying or assisting in identifying the flowering period of oil-tea camellia or verifying oil-tea camellia varieties or cultivating oil-tea camellia varieties.
[0016] Specifically, the method comprises the following steps:
[0017] S1. Extracting genomic DNA of the tea leaves to be tested;
[0018] S2, detecting the genotype of the SNP sites of the three SNP molecular markers in the genomic DNA of the tested Camellia oleifera;
[0019] S3. According to the genotype of the SNP sites of the three SNP molecular markers in the genomic DNA of the oil-tea camellia to be tested, the flowering period of the oil-tea camellia and the variety of the oil-tea camellia are identified or assisted in identification.
[0020] The present invention also provides a primer combination for identifying or assisting in identifying the flowering period of Camellia oleifera or verifying Camellia oleifera varieties or cultivating Camellia oleifera varieties, and the primer combination is as follows:
[0021] Specific primer Primer F1 GAAGGTGACCAAGTTCATGCTTTTTGAACACCCACCACAAA Primer F2 GAAGGTCGGAGTCAACGGATTCTTTTGAACACCCACCACAAT Universal Primer Primer R TTTCTTTGCACCTCCATTCTCTTCA
[0022] or as follows:
[0023]
[0024]
[0025] or as follows:
[0026]
[0027] The primer combination is mixed or packaged separately, and the specific primer Primer F1 and the specific primer Primer F2 are connected to different fluorescent labels. Among them, the universal primer is optionally included and is not necessary.
[0028] The present invention also provides an application of the primer combination in identifying or assisting in identifying the flowering period of Camellia oleifera, verifying Camellia oleifera varieties, cultivating Camellia oleifera varieties, or detecting the SNP molecular marker.
[0029] Specifically, the primer combination is used to identify or assist in identifying the flowering period of Camellia oleifera, comprising the following steps:
[0030] S1 extracts genomic DNA from the tea leaves to be tested;
[0031] S2 uses the primer combination to perform PCR amplification on the genomic DNA of the tea leaves to be tested to obtain an amplified product;
[0032] S3 performs fluorescence data analysis on the amplified product. If the amplified product shows the color of the fluorescent marker connected to the specific primer Primer F1, the tested tea oil tree is an early-flowering phenotype; if the amplified product shows the color of the fluorescent marker connected to the specific primer Primer F2, the tested tea oil tree is a late-flowering phenotype.
[0033] More specifically, when the primer combination is used to detect the SNP molecular marker, the following steps are included:
[0034] S1 extracts genomic DNA from the tea leaves to be tested;
[0035] S2 uses the primer combination to perform PCR amplification on the genomic DNA of the tea leaves to be tested to obtain an amplified product;
[0036] S3 performs fluorescence data analysis on the amplified product. If the amplified product shows the color of the fluorescent marker connected to the specific primer Primer F1, the base correspondences of the tested tea oil at the SNP site of the SNP molecular marker are A, C or A respectively; if the amplified product shows the color of the fluorescent marker connected to the specific primer Primer F2, the base correspondences of the tested tea oil at the SNP site of the SNP molecular marker are T, T or G respectively; if the amplified product shows both the color of the fluorescent marker connected to the specific primer Primer F1 and the color of the fluorescent marker connected to the specific primer Primer F2, the base correspondences of the tested tea oil at the SNP site of the SNP molecular marker are A and T, C and T or A and G respectively.
[0037] The SNP sites of the present invention are directly presented in the form of DNA, and the corresponding sites of the three molecular markers show a certain correlation with the phenotype. The present invention has the advantages of high detection efficiency and universal applicability, and is used for identifying and assisting in identifying the type of oil-tea camellia, and can quickly predict the flowering time of oil-tea camellia, facilitate the screening of early-flowering oil-tea camellia varieties, achieve cost savings, and accelerate the breeding process and efficiency of oil-tea camellia varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0038] Figure 1 .Flowering period ED positioning map. DETAILED DESCRIPTION
[0039] Embodiment 1:
[0040] A method for obtaining a SNP molecular marker associated with the flowering period of oil-tea camellia comprises the following steps:
[0041] (1) The parents 'Youza 2' (YZ2), 'Huashuo' and their offspring DY2*YZ2 population were used as experimental materials. The flowering time of the parents and their backcross offspring populations was first counted. The physical location of the candidate region associated with the target trait was located based on the BSA resequencing results. The specific information was as follows: Figure 1 And as shown in Table 4.
[0042] Table 1. ED related area information statistics
[0043] Chromosome Start End Length(bp) Chr5 135，011，027 143，455，448 8，444，421
[0044] Subsequently, the SNP sites with progeny depth ≥10 in the target interval were annotated, and the genes at important sites such as non-synonymous mutations, upstream, stop loss, and stop gain in the annotation results were selected as candidate genes, and then three SNP molecular markers associated with the flowering period of Camellia oleifera were screened. The three SNP molecular markers were Cch05T003147.1, Cch05T003177.1, and Cch05T003279.1, as shown in Table 2.
[0045] Table 5. Annotation table of information on flowering period-related sites
[0046] CHROM POS ANN[*].EFFECT ANN[*].IMPACT ANN[*].FEATUREID Chr5 136885395 stop_gained HIGH Cch05T003147.1 Chr5 138308185 missense_variant MODERATE Cch05T003177.1 Chr5 142947689 stop_gained HIGH Cch05T003279.1
[0047] The SNP sites of the SNP molecular markers are located at the bases 136885395, 138308185 and 142947689 of chromosome 5 of Camellia oleifera, respectively. The bases of the SNP sites are A or T, C or T and A or G, respectively. The three SNP markers have A / T, C / T and A / G polymorphisms, respectively. The three SNP molecular markers include DNA fragment 1, DNA fragment 2 and DNA fragment 3.
[0048] The nucleotide sequence of the Cch05T003147.1 marker is specifically shown in SEQ ID NO: 1, specifically: TATTAAGTAACAAGTTTTCAAAACGGAAATTAGGCTTTAGTTTAATATCCATACAACTGATTTTTGTCTAAAATTCGATGTCCAAATTTGAATGTCGATATCCGAACAATATAAATGGTGTGTATTAAAATAAAAAATG ATGTACAAATACAATGATCCTAATTTTTTTAATTTTTTTTCCCCTTTTGAACACCCACCACAA[A / T]CAA AAATTGAAGAGAATGGAGGTGCAAAGAAAAAAAAGGTGGGGGACAAAATAACAGCACTCTTAATCA AATCACATTGGATACTAATTTCTGTGAATTTTTGTCACTGAACACATTATTTGATCTGTGCTCTATTGAACCCCATCTAGTAAGCAACCAATCTATTAAAGCATTCAAAAAGAGATCATATTGAAAGAACATAT.
[0049] The marker primers and positions are shown in Table 3.
[0050] Table 3. Cch05T003147.1 marking information
[0051] Molecular marker name Cch05T003147.1 Reference genome safflower camellia oleifera chromosome location Chr5.136885395 Polymorphism of SNP loci A / T Specific primer Primer F1 GAAGGTGACCAAGTTCATGCTTTTTGAACACCCACCACAAA Primer F2 GAAGGTCGGAGTCAACGGATTCTTTTGAACACCCACCACAAT Universal Primer Primer R TTTCTTTGCACCTCCATTCTCTTCA
[0052] The specific nucleotide sequence of Cch05T003177.1 marker is as SEQ ID As shown in NO:2, specifically: TTTGTGAGCATAAAAGGCTTCGTTTTCTTTTAAGTTATGAACAAGTTTTCTGTTATTTGTATATTGGGGCTAAGTCCCTTTTGGCTATATTTGTAATGAATGTGACGTAGGACTATTGCATTGTGTCGTCACGTATATGTGTATAAGGTTTAAAATTTTTGTCCCATGTATGTCTCCATAGCTCAATGAACTATATATG TTT[C / T]TATATTTGCTTTCGCAACCCTAATTATATGTTATTCTGTTCAGAGGCCTTTGGTAATCCAAGGATTACTGGCCGGTTACGACGCTAAACTTATAGAGATCGGTTTTGGATTGTGACAGATGATTAATGTAATATCTACTATTGATTAAAGAAAATTACTGTTACTTTTATTTAATATTAGCCATTTTGGTTCATTATAATAT.
[0053] The marker primers and positions are shown in Table 4.
[0054] Table 2. Cch05T003177.1 marking information:
[0055] Molecular marker name Cch05T003177.1 Reference genome safflower camellia oleifera chromosome location Chr5.138308185 Polymorphism of SNP loci C / T Specific primer Primer F1 GAAGGTGACCAAGTTCATGCTGGGTTGCGAAAGCAAATATAG Primer F2 GAAGGTCGGAGTCAACGGATTGGGTTGCGAAAGCAAATATAA Universal Primer Primer R CCCATGTATGTCTCCATAGCTCAA
[0056] The specific nucleotide sequence of Cch05T003279.1 marker is as SEQ ID NO: 3 is shown, specifically: AGAATCACAAGGGGTAATTTGTAATTTAAGTAAATATCATGAGATGTGTTTGTAATTTACCCAATTGATTAAGATGGGAAATTTTAGAAGAAAAAGTTAAAGAAATTTGAAAGTTGAATTATAATTAACTCTTTAAATGGACAAATTTAAACTTTTTAAATTTTATTTTTTATTTTTGTTGAAGGGGGGGTAAGAAAAC ATA[A / G]AGTTAATTATAATGTTCTTTTAATAACTCTATCTGGATTGACTAATCCGAAGGACCAATGTTAATATCAGTTGTTAAGAAAAATTGTAATGCCCTCAAAATGATATAATAAATATGATCCAAAACATGATTAACAATTTCATCAATCAAAGTAAATAGTCCTTTCATTACATGATTTTAATGATACAAAATAGTCTAACATA.
[0057] The marker primers and positions are shown in Table 5.
[0058] Table 3. Cch05T003279.1 marking information:
[0059]
[0060] Embodiment 2:
[0061] The following method is used to identify or assist in identifying the flowering period of oil-tea camellia or verifying the oil-tea camellia variety or cultivating the oil-tea camellia variety, including the following steps:
[0062] S1 extracts genomic DNA from the tea leaves to be tested;
[0063] S2 uses the primer combination to perform PCR amplification on the genomic DNA of the tea leaves to be tested to obtain an amplified product;
[0064] The specific primer Primer F1 and the specific primer Primer F2 are connected to different fluorescent labels respectively.
[0065] S3 performs fluorescence data analysis on the amplified product. If the amplified product shows the color of the fluorescent marker connected to the specific primer Primer F1, the tested tea oil tree is an early-flowering phenotype; if the amplified product shows the color of the fluorescent marker connected to the specific primer Primer F2, the tested tea oil tree is a late-flowering phenotype.
[0066] Embodiment three:
[0067] The detection of the SNP molecular marker comprises the following steps:
[0068] S1 extracts genomic DNA from the tea leaves to be tested;
[0069] S2 uses the primer combination to perform PCR amplification on the genomic DNA of the tea leaves to be tested to obtain an amplified product;
[0070] The specific primer Primer F1 and the specific primer Primer F2 are connected to different fluorescent labels respectively.
[0071] S3 performs fluorescence data analysis on the amplified product. If the amplified product shows the color of the fluorescent marker connected to the specific primer Primer F1, the base correspondences of the tested tea oil at the SNP site of the SNP molecular marker are A, C or A respectively; if the amplified product shows the color of the fluorescent marker connected to the specific primer Primer F2, the base correspondences of the tested tea oil at the SNP site of the SNP molecular marker are T, T or G respectively; if the amplified product shows both the color of the fluorescent marker connected to the specific primer Primer F1 and the color of the fluorescent marker connected to the specific primer Primer F2, the base correspondences of the tested tea oil at the SNP site of the SNP molecular marker are A and T, C and T or A and G respectively.
Claims
1. A SNP molecular marker associated with the flowering period of Camellia oleifera, characterized in that: The molecular marker Cch05T003147.1 is composed of a marker site where the base 195407115 of chromosome 5 of safflower oil tea changes from A to T; the molecular marker Cch05T003177.1 is composed of a marker site where the base 138308185 of chromosome 5 of safflower oil tea changes from C to T; or It is the molecular marker Cch05T003279.1, which is composed of the marker site where the 142947689 base of chromosome 5 of Camellia oleifera changes from A to G.
2. The SNP molecular marker according to claim 1, characterized in that: The SNP molecular marker includes DNA fragment 1, DNA fragment 2 or DNA fragment 3; the nucleotide sequence of the DNA fragment 1 is shown as SEQ ID NO.1; the nucleotide sequence of the DNA fragment 2 is shown as SEQ ID NO.2; the nucleotide sequence of the DNA fragment 3 is shown as SEQ ID NO.
3.
3. The SNP molecular marker according to claim 1, characterized in that: The three primers of Cch05T003147.1 markers F1, F2, and R are as follows: The three primers of Cch05T003177.1 markers F1, F2, and R are as follows: The three primers of Cch05T003279.1 markers F1, F2, and R are as follows:
4. Use of the SNP molecular marker according to any one of claims 1 to 3 in identifying or assisting in identifying the flowering period of Camellia oleifera or verifying Camellia oleifera varieties or cultivating Camellia oleifera varieties.
5. The use according to claim 4, characterized in that: The following steps are involved: S1. Extracting genomic DNA of the tea leaves to be tested; S2, detecting the genotype of the SNP sites of the three SNP molecular markers in the genomic DNA of the tested Camellia oleifera; S3. According to the genotype of the SNP sites of the three SNP molecular markers in the genomic DNA of the oil-tea camellia to be tested, the flowering period of the oil-tea camellia and the variety of the oil-tea camellia are identified or assisted in identification.
6. A primer combination for identifying or assisting in identifying the flowering period of Camellia oleifera or verifying Camellia oleifera varieties or cultivating Camellia oleifera varieties, characterized in that: The primer combination is as follows: or as follows: or as follows: The primer combination is mixed or packaged separately; wherein the universal primer is optionally included but not required.
7. Use of the primer combination as claimed in claim 6 in identifying or assisting in identifying the flowering period of Camellia oleifera, verifying Camellia oleifera varieties, cultivating Camellia oleifera varieties, or detecting the SNP molecular markers as claimed in any one of claims 1 to 3.
8. The use according to claim 7, characterized in that: The primer combination is used for identifying or assisting in identifying the flowering period of Camellia oleifera, and comprises the following steps: S1 extracts genomic DNA from the tea leaves to be tested; S2 uses the primer combination to perform PCR amplification on the genomic DNA of the tea leaves to be tested to obtain an amplified product; S3 performs fluorescence data analysis on the amplified product. If the amplified product shows the color of the fluorescent marker connected to the specific primer Primer F1, the tested tea oil tree is an early-flowering phenotype; if the amplified product shows the color of the fluorescent marker connected to the specific primer Primer F2, the tested tea oil tree is a late-flowering phenotype.
9. The use according to claim 7, characterized in that: When the primer combination is used to detect the SNP molecular marker according to any one of claims 1 to 3, the method comprises the following steps: S1 extracts genomic DNA from the tea leaves to be tested; S2 uses the primer combination to perform PCR amplification on the genomic DNA of the tea leaves to be tested to obtain an amplified product; S3 performs fluorescence data analysis on the amplified product. If the amplified product shows the color of the fluorescent marker connected to the specific primer Primer F1, the bases of the tested tea oil at the SNP site of the SNP molecular marker are A, C or A respectively; if the amplified product shows the color of the fluorescent marker connected to the specific primer Primer F2, the bases of the tested tea oil at the SNP site of the SNP molecular marker are T, T or G; if the amplified product shows both the color of the fluorescent marker connected to the specific primer Primer F1 and the color of the fluorescent marker connected to the specific primer Primer F2, the bases of the tested tea oil at the SNP site of the SNP molecular marker are A and T, C and T or A and G respectively.