A KASP molecular marker related to identification of larch cellulose content and its application

By developing the KASP molecular marker closely linked to the cellulose content of larch and utilizing competitive allele-specific PCR technology, the problem of difficulty in rapidly identifying cellulose content in existing technologies has been solved, and rapid, accurate, and low-cost cellulose content identification has been achieved, simplifying the larch breeding process.

CN119351603BActive Publication Date: 2025-09-23NORTHEAST FORESTRY UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411559192.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-04
Publication Date
2025-09-23
Estimated Expiration
2044-11-04

Smart Images

  • Figure CN119351603B_ABST
    Figure CN119351603B_ABST
Patent Text Reader

Abstract

A KASP molecular marker associated with identifying larch cellulose content and its application are designed based on a single nucleotide polymorphism (SNP) site in the larch genome. This SNP site contains an A / T base mutation, wherein the A:A and T:T genotypes represent genotypes with low cellulose content, while the A:T genotype represents a genotype with high cellulose content. Also disclosed are primers for detecting the KASP molecular marker and a method for identifying the cellulose content of larch using the primer. Also disclosed are reagents, primers, or methods for detecting the molecular marker for identifying the cellulose content of larch at the seedling stage and the application of molecular marker-assisted breeding for larch. The primers of the present invention can rapidly identify the cellulose content of larch and have the advantages of accuracy, rapidity, low cost, short identification cycle, and ease of operation. They can assist in the selection and breeding of superior larch strains and have broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of forest tree molecular marker assisted breeding, and particularly relates to a KASP molecular marker related to identifying larch cellulose content and an application thereof. Background Art

[0002] Larches, a member of the genus Larix (Pinaceae), are characterized by strong adaptability, rapid early growth, rapid forest maturity, few pests and diseases, and high-quality wood. Therefore, developing molecular markers tightly linked to cellulose content and using them to assist in selection for high and low cellulose content in larch will effectively save breeding time and land, accelerate the breeding process, and have important practical significance for the selection and promotion of improved larch varieties. KASP (Kompetitive Allele-Specific PCR), or competitive allele-specific PCR, offers advantages over traditional PCR methods such as high throughput, low cost, high efficiency, and the absence of electrophoresis detection. Summary of the Invention

[0003] The first object of the present invention is to provide a KASP molecular marker that is closely linked to the cellulose content of larch and a primer for detecting the KASP molecular marker.

[0004] The present invention also aims to provide a method for identifying the cellulose content of larch.

[0005] The final object of the present invention is to provide a reagent, primer or method for detecting the above-mentioned KASP molecular marker and its application in identifying the high and low cellulose content phenotypes of larch and its application in molecular marker-assisted breeding of larch.

[0006] The above-mentioned first object of the present invention can be achieved by the following technical solution: a KASP molecular marker (nucleotide sequence shown in SEQ ID NO.4) that is tightly linked to the cellulose content of larch. The KASP molecular marker is designed based on a SNP site on the larch genome. The SNP site has an A / T base mutation, and the corresponding genotypes include A:A, A:T and T:T, among which the T:T and A:A genotypes show genotypes with low cellulose content, and the A:T genotype shows a genotype with high cellulose content. The KASP molecular marker can be obtained by amplification using primers shown in SEQ ID NO.1 to SEQ ID NO.3, respectively.

[0007] The nucleotide sequence of the KASP molecular marker is as follows:

[0008] TCGCTTTCACTTAAACTCACTCTGGAGTAGATTTTGTGGACATCTGAAAGGTAG ATAACTCCTCTTGCTCCACACATACAAACCTTTCCTTGACAAGTTCCATAAAAAAAG GCCCAAGGTTGTGACTTATCTACCTCCAATGGTTTGATC(A / T)TTCTTGGTTTTTTTGG TATTGGCACTCTCTTGATTCCATCAAATAAAAAAATATTATGTTGAAATTGGAATGGT GGAGAAAGCTTACCTTCAAATATGCTTGCATTTGTTGTCTGACACTATTAAGGAAACCACTCTAAACTACTTGGGT.

[0009] A SNP site of the present invention is heterozygous when the cellulose content is high, and is homozygous when the cellulose content is low.

[0010] The present invention also provides a set of primers for detecting a KASP molecular marker that is closely linked to the high or low cellulose content of larch. The set of primers includes two specific upstream primers sca3332:283854-F1 and sca3332:283854-F2 and a universal downstream primer sca3332:283854-R, wherein the nucleotide sequence of the upstream primer sca3332:283854-F1 is shown in SEQ ID NO.1, the nucleotide sequence of the upstream primer sca3332:283854-F2 is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer sca3332:283854-R is shown in SEQ ID NO.3. A FAM fluorescent label sequence is added to the 5' end of the upstream primer sca3332:283854-F1, and a VIC fluorescent label sequence is added to the 5' end of the upstream primer sca3332:283854-F2.

[0011] After the PCR products of the present invention are subjected to fluorescence detection, typing detection is performed on the PCR amplification products and the results are presented in the form of a graph; the graph is divided into X and Y axes, each data point represents an independent DNA sample, and samples of the same genotype are clustered together. Among them, if the genotype is T:T type, the fluorescent signal is blue and clustered near the Y axis, which is determined to be a homozygous material with a low cellulose content; if the genotype is A:T type, the fluorescent signal is green and clustered near the middle position, which is determined to be a heterozygous material with a high cellulose content; if the genotype is A:A type, the fluorescent signal is red and clustered near the X axis, which is determined to be a homozygous material with a low cellulose content.

[0012] The last object of the present invention can be achieved by the following technical solution: use of a reagent for detecting the KASP molecular marker in identifying the high and low cellulose content phenotypes of larch.

[0013] The present invention has the following advantages:

[0014] The KASP molecular marker primers in the present invention can quickly identify the phenotype of larch with high cellulose content, and have the advantages of accuracy, rapidity, low cost, short identification cycle, and simple operation. They can assist in the breeding of new larch varieties and have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the genotyping diagram of the larch population using the KASP molecular marker primers sca3332:283854 in Example 2. The genotype is T:T type, the fluorescent signal is blue, and the material is concentrated near the Y-axis, which is determined to be a homozygous material with low cellulose content; the genotype is A:T type, the fluorescent signal is green, and the material is concentrated near the middle position, which is determined to be a heterozygous material with high cellulose content; the genotype is A:A type, the fluorescent signal is red, and the material is concentrated near the X-axis, which is determined to be a homozygous material with low cellulose content. DETAILED DESCRIPTION

[0016] In order to make the objectives, technical solutions and advantages of the embodiments of the present invention more clearly understood, the spirit of the contents disclosed in the present invention will be described in detail below. After understanding the embodiments of the contents of the present invention, any technician in the relevant technical field can change and modify the contents of the present invention based on the techniques taught by the contents of the present invention without departing from the spirit and scope of the contents of the present invention.

[0017] The exemplary embodiments of the present invention and the description thereof are used to explain the present invention but are not intended to limit the present invention.

[0018] Example 1

[0019] In this example, a gene pool was constructed using 310 hybrid larch plants from 39 populations. RAD-seq was performed to obtain SNP sites for genome-wide association analysis of cellulose content traits, and the SNP site sca3332:283854 that was closely linked to the high and low cellulose content traits of larch was identified (as shown in Table 1).

[0020] Based on the SNP locus information, KASP markers were developed using PrimerPicker Lite for KASPar Version 0.26 (https: / / www.biosearchtech.com / ). Each marker consists of three primers. The two upstream primers, sca3332:283854-F1 and sca3332:283854-F2, are specific primers designed based on the SNP locus sca3332:283854, and the downstream primer sca3332:283854-R is a universal primer. The 3' end of the upstream primer contains a variant base, and the 5' end is connected to the fluorescent signal tag sequence of carboxyfluorescein FAM (GAAGGTGACCAAGTTCATGCT) and phosphoramidite fluorescein VIC (GAAGGTCGGAGTCAACGGATT), respectively. The three primer sequences are shown below:

[0021] 1)sca3332:283854-F1:

[0022] 5'-GAAGGTGACCAAGTTCATGCTTTTCAGATCTGTTTGATCTTTATAAGGAC-3' (SEQ ID NO. 1), the underlined portion is the sequence of fluorescein FAM.

[0023] 2)sca3332:283854-F2:

[0024] 5'-GAAGGTCGGAGTCAACGGATTACTTATCTACCTCCAATGGTTTGATCT-3' (SEQ ID NO. 2), the underlined portion is the sequence of fluorescein VIC.

[0025] 3)sca3332:283854-R:

[0026] 5'-TTCTCCACCATTCCAATTTCAACAT-3' (SEQ ID NO. 3).

[0027] The primers can also be developed into a kit for use.

[0028] Example 2

[0029] PCR amplification of a single larch plant using the labeled primers and detection of the PCR product include the following steps:

[0030] (1) Larch DNA extraction

[0031] The experimental material is fresh leaves from a single larch plant. The steps for extracting genomic DNA are as follows:

[0032] ① Take a small amount of fresh leaves and place them in a 2 mL centrifuge tube. Add steel balls and grind them in a grinder at 30 times per second for 2 minutes. Add 800 μL of 2% CTAB extract, mix well, and place in a 65°C water bath for 1 hour (shake well every 10 minutes).

[0033] ② After allowing to cool to room temperature, add 800 μL of chloroform:isoamyl alcohol (volume ratio 24:1), mix gently for 10 minutes, and then centrifuge at 12000 rpm for 15 minutes. Transfer the supernatant (about 600 μL) to a new 1.5 mL centrifuge tube;

[0034] ③ Add 2 / 3 volume of isopropanol to the supernatant, mix gently, and place at -20℃ for 30 minutes to 1 hour;

[0035] ④ Centrifuge at 12000 rpm for 10 min and discard the supernatant;

[0036] ⑤ Wash the DNA pellet once with anhydrous ethanol, then wash it once with 75% (volume percentage) ethanol, and blow dry it on a clean bench;

[0037] ⑥ Add 50 μL TE (or ddH2O) to dissolve and use as larch genomic DNA.

[0038] (2) Using larch genomic DNA as a template, PCR amplification was performed using the KASP molecular marker primers in Example 1.

[0039] PCR amplification was performed in a CFX fluorescence quantitative instrument from BIO-RAD. The 5 μL reaction system included: 1.25 μL of genomic DNA at a concentration of 100 ng / μL, 2.5 μL of HiGeno2×ProbeMixA, 0.25 μL of each upstream primer at a concentration of 10 mM, and 0.75 μL of a downstream primer at a concentration of 10 mM.

[0040] The PCR amplification program was as follows: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 20 s, annealing at 61-55°C for 1 min, with the annealing temperature decreasing by 0.6°C per cycle for a total of 10 cycles, followed by denaturation at 95°C for 20 s and extension at 55°C for 1 min. After 27 cycles, the fluorescence signal was read at 25°C for 1 min.

[0041] (3) Amplification results:

[0042] PCR amplification was performed using the primers of Example 1, and fluorescence detection was performed on the amplified product. The fluorescence signal was combined with the marker information to complete the genotyping and present it in the form of a chart; Figure 1 As shown, the figure is divided into X and Y axes, each data point represents an independent DNA sample, and samples with the same genotype are clustered together.

[0043] like Figure 1 After the PCR products were read by fluorescence, there was one genotype with high cellulose content, and the fluorescence signal of the genotype "A:T" was green and concentrated near the middle position. There were two genotypes with low cellulose content, of which the fluorescence signal of the genotype "A:A" was red and concentrated near the X-axis position, and the fluorescence signal of the genotype "T:T" was blue and concentrated near the Y-axis position.

[0044] The results showed that when cellulose content was assisted in selection, the high cellulose content phenotype of individual plants in the population was consistent with the band pattern amplified by the primers for the molecular markers. This example used KASP molecular markers to screen for cellulose content in larch, achieving assisted breeding of larch.

[0045] Table 1 Gene mapping results of SNP site sca3332:283854

[0046] CHROM POS REF ALT sca3332 283854 A T

Claims

1. A primer application for identifying KASP molecular markers related to larch cellulose content, characterized in that The molecular marker is used to assist larch breeding; the assisted larch breeding is achieved by screening larch based on the cellulose content of the larch; the KASP molecular marker has an A / T base mutation at position 283854 of chromosome sca3332:283854; the A / T base mutation corresponds to genotypes A:A, A:T, and T:T, wherein the A:T genotype exhibits a high cellulose content, and the A:A and T:T genotypes exhibit a low cellulose content; the nucleotide sequence of the KASP molecular marker is TCGCTTTCACTTAAACTCACTCTGGAGTAGATTTTGTGGACATCTGAAAGGTAGATA ACTCCTCTTGCTCCACACATACAAACCTTTCCTTGACAAGTTCCATAAAAAAAGGCCCAAGGTTGTGACTTATCTACCTCCAATGGTTTGATC(A / T)TTTCTTGGTTTTTGGTATTGGCACTCTCTTGATTCCATCAAATAAAAAAATATTATGTTGAAATTGGAATGGTGGAGAAAGCTTACCTTCAAATATGCTTGCATTTGTTGTCTGACACTATTAAGGAAACCACTCTAAACTACTTGGGT.

Citation Information

Patent Citations

  • SNP marker related with lignin content of larix olgensis and applications thereof

    CN105936939A

  • SNP marker related to Changbai larch cellulose content in CesA1 gene and application of SNP marker

    CN106011255A