Application of substance for detecting SNP (Single Nucleotide Polymorphism) in wheat genome in identifying sedimentation value of wheat flour

Abstract

The invention discloses application of a substance for detecting SNP (Single Nucleotide Polymorphism) in a wheat genome in identifying a sedimentation value of wheat flour. An SNP variation (24 site of a sequence 1, C / T) located on a TaAGAP-3D coding region is analyzed based on candidate gene association, a KASP marker is developed according to the site and is named as TaAGAP-3D-SNP + 24, and 20 parts of wheat materials with known genotypes are utilized to prove that the marker has good repeatability and accuracy. The marker is used for scanning a natural wheat population, correlation analysis is carried out on the marker and settlement value data of the population, and it is found that TaAGAP-3D-SNP + 24 allelic variation is remarkably related to the wheat settlement value (Plt; the KASP marker is good in repeatability, convenient to detect and low in cost, and has a better application prospect in molecular marker-assisted selection and molecular design breeding for improving the quality of wheat.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to the application of a substance for detecting SNP polymorphism in wheat genome in identifying the sedimentation value of wheat flour. Background Art

[0002] Wheat is the second largest grain crop in my country and the main staple food for people in northern provinces. It plays a vital role in ensuring national food security. With the improvement of people's living standards, their diet has become more colorful, and the requirements for the quality of wheat have also increased. The goal of wheat breeding has changed from high yield to high yield and high quality. How to further improve the quality of wheat under the premise of high yield is an urgent problem to be solved in current breeding.

[0003] Wheat quality can be divided into nutritional quality and processing quality. Among them, edible quality in processing quality is the main focus in wheat quality breeding. Wheat edible quality is mainly related to the physical and chemical properties of the dough, which can be measured by multiple parameters such as SDS-sedimentation value (SDS-SV), gluten content, tensile area, and stability time. SDS-SV is significantly correlated with the baking quality of wheat flour and is an important indicator for evaluating flour protein quality (Axford et al. 1979). Past studies have found that the SDS-SV of wheat flour is controlled by multiple genes. Conti et al. (2011) found Glu-B1 It is a stable site controlling SDS-SV. High molecular weight glutenin subunit gene Glu-A1 Loss-of-function mutants have significantly reduced SDS-sedimentation values ​​(Yang et al. 2014). Alleles of wheat high molecular weight glutenin subunit (HMW-GS) Glu-1 and low molecular weight glutenin subunit (LMW-GS) alleles Glu-3 It has an important control effect on the sedimentation value, and the 1BL / 1RS translocation has a significant negative effect on the SDS sedimentation value (Liu Li et al., 2004). Pinb-D1b Allelic variation positively regulates SDS-SV (Würschum et al. 2016). In addition, Yao Yingyin's team from China Agricultural University used a near-isogenic line population constructed from the low SDS-SV parent ND3331 and the high SDS-SV parent Zang1817 to identify 10 QTLs controlling SDS-SV, of which the effects of four major loci on SDS-SV were similar to those of high molecular weight glutenin subunits. 1Ax1 , 1B / 1R heterotopic system, Pina-D1 and Pinb-D1 Related, it was found that Zang1817 carried Pinb-D1pIt is an excellent allele of high SDS-SV (Changet al. 2022). In summary, SDS-SV is mainly regulated by wheat quality genes. Therefore, exploring and utilizing genes that control wheat SDS-SV not only provides new gene resources for molecular marker-assisted breeding and transgenic breeding, but also helps to improve the speed and level of wheat quality breeding, which is of great significance for high-yield and high-quality wheat breeding. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to quickly and accurately screen wheat with different flour sedimentation values.

[0005] In order to solve the above problems, the present invention first provides an application of a substance for detecting the polymorphism or genotype of a SNP site in a wheat genome, wherein the SNP site is a site in the wheat genome, the nucleotide type of which is C or T, and is the 24th nucleotide of sequence 1 in the sequence table; the application may be any of the following: A1) Use of the substance in identifying or assisting in identifying the sedimentation value of wheat flour, A2) Application of the substance in wheat breeding, A3) Use of the substance in the preparation of a product for identifying or assisting in identifying the sedimentation value of wheat flour, A4) Use of the substance in preparing wheat breeding products.

[0006] The substance may be the following B1), B2) or B3): B1) the substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP site, B2) The substance is a PCR reagent containing the primer combination described in B1), B3) The substance is a kit containing the primer composition described in B1) or the PCR reagent described in B2).

[0007] The SNP single nucleotide polymorphism site is a SNP in the wheat genome, which is the 24th nucleotide of SEQ ID No.1 in the sequence list, which is C or T; located on the 3D chromosome of wheat TaAGAP In genes, TaAGAP-3D Genes associated with wheat flour sedimentation value.

[0008] In the above applications, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight measurement, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid sequence or a protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleic acid is directly detected (e.g., directly reading the sequence) without a marker.

[0009] In the present application, the sedimentation value may be an SDS sedimentation value.

[0010] The present invention also provides a method for identifying or assisting in identifying the sedimentation value of wheat flour, the method comprising detecting the genotype of the SNP site in the wheat genome to be tested, and identifying or assisting in identifying the sedimentation value of wheat flour according to the genotype.

[0011] In the above-mentioned method for identifying or assisting in identifying the sedimentation value of wheat flour, the genotype is CC or TT, the CC is the homozygous type when the SNP site is C, and the TT is the homozygous type when the SNP site is T. According to the genotype identification or assisting in identifying the wheat grain traits, the sedimentation value of the wheat to be tested with the genotype of TT is higher than that of the wheat to be tested with the genotype of CC.

[0012] The present invention also provides a method for wheat breeding, which comprises detecting the genotype of the above-mentioned SNP site in the wheat genome, and selecting wheat whose genotype of the SNP site is CC and / or TT as a parent for breeding, wherein the CC is a homozygous type when the SNP site is C, and the TT is a homozygous type when the SNP site is T.

[0013] In the above-mentioned wheat breeding method, the wheat breeding index includes wheat flour sedimentation value.

[0014] Furthermore, the purpose of wheat breeding includes cultivating wheat with increased / or decreased wheat flour sedimentation value. The increased / or decreased wheat flour sedimentation value means that the wheat flour sedimentation value is higher / lower than that of the parent.

[0015] In the above method for identifying or assisting in identifying the sedimentation value of wheat flour and the above method for wheat breeding, the wheat may be an inbred line or a pure line.

[0016] The invention also provides application of the method in wheat breeding.

[0017] The present invention also provides a product for detecting the polymorphism or genotype of a SNP site in a wheat genome, wherein the SNP site is the above-mentioned SNP site, and the product contains the substance described above, and the product may be any of the following: C1) Products for detecting or assisting in detecting single nucleotide polymorphisms or genotypes related to wheat flour sedimentation value, C2) Products that identify or assist in identifying the sedimentation value of wheat flour. C3) Products for wheat breeding, C4) Products of screening or breeding wheat plants, plant lines, strains or varieties according to the wheat flour sedimentation value.

[0018] Specifically, the product may be as follows: D1), D2) or D3): D1) The product is a primer combination for amplifying a wheat genomic DNA fragment including the SNP site, D2) The product is a PCR reagent containing the primer combination described in D1), D3) The product is a kit containing the primer combination described in D1) or the PCR reagent described in D2).

[0019] In the above, the primer composition consists of primer F1, primer F2 and / or primer R; The primer F1 is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 45th position of sequence 2 in the sequence list, The primer F2 is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 45th position of sequence 3 in the sequence list. The primer R is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence list.

[0020] The F1 sequence is: 5'- GAAGGTGACCAAGTTCATGCT CGGGTATCGATAGCAGAAGTCTTT-3', The F2 sequence is: 5'- GAAGGTCGGAGTCAACGGATT CGGGTATCGATAGCAGAAGTCTTC-3', The R sequence is: 5'-TGACACTCCAGATCCCCTTTTT-3'.

[0021] Primer F1 is a primer with a 6-carboxyfluorescein (FAM) dye tag sequence (underlined bases) at the 5' end, and primer R amplifies TaAGAP-3D-_SNP+24is a fragment of T; Primer F2 is a primer with a hexachloro-6-methylfluorescein (HEX) dye tag sequence (underlined bases) at the 5' end, and primer R amplifies TaAGAP-3D-_SNP+24 A fragment of C.

[0022] In the above applications and methods, the substance for detecting SNP polymorphism or genotype can be a nucleotide type of the SNP site in the wheat genome determined by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescent molecule DNA binding reaction.

[0023] The present invention also provides a DNA molecule, the nucleotide sequence of the DNA molecule is sequence 1 in the sequence list.

[0024] The application of the above DNA molecules is also within the scope of protection of the present invention, and the application may be any of the following: E1) Application of the DNA molecule in identifying or assisting in identifying the sedimentation value of wheat flour, E2) Application of the DNA molecule in wheat breeding, E3) Use of the DNA molecule in the preparation of a product for identifying or assisting in identifying the sedimentation value of wheat flour, E4) Use of the DNA molecule in preparing wheat breeding products, E5) Use of the DNA molecule in screening or breeding wheat plants, strains, lines or varieties according to the wheat flour sedimentation value, E6) Use of the DNA molecule in assisting the screening or breeding of wheat plants, strains, lines or varieties according to the sedimentation value of wheat flour.

[0025] The product may be a kit.

[0026] The kit comprises a primer combination for amplifying a wheat genomic DNA fragment including the SNP site.

[0027] The above amplification products can be placed in the QuantStudioTM 7 Flex fluorescence quantitative instrument (Applied Biosystemsby Life Technologies) for fluorescence signal detection of the amplification products, and the QuantStudioTM Real-timePCR Software v1.3 (Applied Biosystems by Life Technologies) software can realize data visualization and result interpretation.

[0028] The invention discloses wheat sedimentation value candidate gene TaAGAP-3D The amplified sequence of the SNP variation on it is located on the wheat chromosome 3D and can be used for rapid and accurate identification or auxiliary identification of wheat flour sedimentation value. The KASP marker was developed based on this site and named TaAGAP-3D-_SNP+24 , and used 20 wheat materials with known genotypes to prove that the marker has good repeatability and accuracy. The marker was used to scan the natural wheat population and conduct association analysis with the wheat flour sedimentation value data of the population, and it was found that TaAGAP-3D-_SNP+24 The allelic variation was significantly correlated with the wheat flour sedimentation value ( P <0.05). The KASP marker has good repeatability, convenient detection and low cost, and has good application prospects in molecular marker-assisted selection and molecular design breeding to improve wheat quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 for TaAGAP-3D Variant site information and marker development in coding regions.

[0030] Figure 2 for TaAGAP-3D-_SNP+24 Marker association analysis. DETAILED DESCRIPTION

[0031] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0032] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0033] The wheat varieties in the following examples are commercial varieties, which can be found on the China Crop Germplasm Information Network (http: / / www.cgris.net / ).

[0034] The present invention will be further described below in conjunction with specific examples, but the present invention is not limited to the following examples. In the following examples, unless otherwise specified, all are conventional methods.

[0035] Embodiment 1, TaAGAP-3D cDNA cloning, SNP site discovery and primer design Based on population genetics and association analysis, this paper identified a new gene controlling wheat flour sedimentation value through genome-wide association analysis (GWAS) in natural populations. TaAGAP-3D . A SNP site (C / T) at +726 bp in the coding region of the gene was located through association analysis of candidate genes. The KASP marker was developed using this SNP site and 116 wheat materials were identified. Association analysis of genotype and phenotypic data of sedimentation value showed that the marker was significantly correlated with the sedimentation value of wheat flour, indicating that the marker is an effective molecular marker for screening wheat with different sedimentation values.

[0036] Using the wheat Chinese spring reference genome to obtain wheat TaAGAP-3D Sequence information, using wheat resequencing data previously published by the research group, to obtain detailed SNP site information. Candidate gene association analysis was used to locate TaAGAP- 3D A SNP site in the gene coding region has a C / T polymorphism. Based on the allelic variation of this site, the CAPS / KASP (Beta) function of the WheatOmics1.0 website was used to design specific KASP primers. The amplification product of the specific KASP primer is sequence 1 in the sequence list. The specific SNP site is located at the 24th position of sequence 1 and is named TaAGAP-3D-SNP+ 24 The specific sequence of sequence 1 (SEQ NO: 1, 150 bp) is as follows: 5'-CGGGTATCGATAGCAGAAGTCTTCCATTCCATACAGGATTCAGGCTGCTCTTTATCACCTTCGTTTTCATCGACTACAAGGGCAAAAAGGGGATCTGGAGTGTCA-3'.

[0037] The specific KASP primers include specific forward primers F1 (SEQ ID NO. 2) and F2 (SEQ ID NO. 3), and a universal reverse primer R (SEQ ID NO. 4).

[0038] F1: 5'- GAAGGTGACCAAGTTCATGCT CGGGTATCGATAGCAGAAGTCTTT-3'; F2: 5'-GAAGGTCGGAGTCAACGGATT CGGGTATCGATAGCAGAAGTCTTC-3'; R: 5'-TGACACTCCAGATCCCCTTTTT-3'.

[0039] Primer F1 is a primer with a 6-carboxyfluorescein (FAM) dye tag sequence (underlined bases) at the 5' end, and primer R amplifies TaAGAP-3D-_SNP+24 is a fragment of T; Primer F2 is a primer with a hexachloro-6-methylfluorescein (HEX) dye tag sequence (underlined bases) at the 5' end, and primer R amplifies TaAGAP-3D-_SNP+24 A fragment of C.

[0040] Finally, the fluorescence quantitative PCR instrument is used to read the signal, and the software is used to collect the signal to distinguish the allele type. The specific experimental steps are as follows: KASP labeling reaction system: template DNA concentration is 20-40ng / μl; primer concentrations F1, F2 and R are all 100μM; primer mix is ​​mixed according to F1:F2:R=3:3:7.5, and ddH2O is added to 25μl. The reaction system is as follows: Table 1 KASP labeling reaction system

[0041] KASP-labeled amplification reaction procedure: The amplification reaction was carried out in a 384-well fluorescent quantitative PCR plate, with a total of 5.0 μl of the mixed reaction system in each well. The procedure was as follows: 95°C pre-denaturation, 10 min; 95°C, 20 s, 62°C, 40 s, 10 cycles; 95°C, 20 s, 58°C, 40 s, 37 cycles; 28°C plate reading, 1 min.

[0042] Detection and interpretation of KASP amplification products: QuantStudioTM 7 Flex fluorescence quantifier (Applied Biosystems by Life Technologies) is used to detect the fluorescent signal of the amplification products, and QuantStudioTM Real-time PCR Software v1.3 (Applied Biosystems by Life Technologies) is used to realize data visualization and result interpretation. After the reaction is completed, different allelic variations at the same site appear in different colors on the two-dimensional cluster diagram, and materials with the same allelic variation type are marked with the same color. Red and blue represent different allelic variations at the same site, green represents heterozygous type, black is negative control, and "×" represents sites with unidentified allelic variation types. Taking the negative control (KASP master mix) as the judgment base point, different materials are presented in different colors on the corresponding coordinates according to the type of allelic variation they carry. Specifically, the TT homozygous type (that is, in the wheat genome) TaAGAP-3D-_SNP+24 The homozygous type of T) is blue, the homozygous type of CC (i.e. TaAGAP-3D-_SNP+24 The homozygous type of C) is red, and the heterozygous type of TC (i.e. TaAGAP-3D-_SNP+24 The heterozygous type of T and C is green.

[0043] Embodiment 2, TaAGAP-3D-_SNP+24 Functional verification 116 wheat materials were used for TaAGAP-3D-_SNP+24 116 representative natural varieties from home and abroad were planted in Xinxiang, Henan Province in October every year from 2018 to 2022, and in Shunyi, Beijing in October every year from 2019 to 2022. A completely randomized block design was used with three replications, 4 rows, 2 m long, 0.25 m wide, and 40 seeds were evenly sown in each row. Mature grains were harvested.

[0044] use TaAGAP-3D-_SNP+24 Mark and detect all experimental materials. The specific methods are as follows: (1) PCR amplification system and procedure. Wheat leaf genomic DNA was extracted and dissolved in 200ul TE. DNA quality was tested using 1% agarose gel electrophoresis. The extracted DNA was required to be free of obvious impurities, with clear bands and no degradation. After the DNA concentration was measured, it was uniformly diluted to 28.3ng / μl, and PCR amplification was performed using the diluted wheat genomic DNA as a template.

[0045] The PCR amplification system is as follows: the template DNA concentration is 20-40 ng / μl; the primer concentrations F1, F2 and R are all 100 μM; the primer mix is ​​mixed according to F1:F2:R=3:3:7.5, and ddH2O is added to 25 μl. The reaction system is as follows: DNA 2.2μl, Primer mix 0.3μl, KASP master mix 2.5μl, total 5.0μl.

[0046] The amplification reaction was performed in a 384-well fluorescent quantitative PCR plate, with a total of 5.0 μl of the mixed reaction system in each well. The program was as follows: 95°C pre-denaturation, 10 min; 95°C, 20 s, 62°C, 40 s, 10 cycles; 95°C, 20 s, 58°C, 40 s, 37 cycles; 28°C plate reading, 1 min.

[0047] (2) Genotyping. QuantStudioTM 7 Flex fluorescence quantification instrument (Applied Biosystems by Life Technologies) was used to detect the fluorescence signal of the amplified products, and QuantStudioTM Real-time PCR Software v1.3 (Applied Biosystems by Life Technologies) was used to visualize the data and interpret the results.

[0048] The excitation wavelength of FAM is 485nm, and the emission wavelength is 520nm. The excitation wavelength of HEX is 535nm, and the emission wavelength is 556nm. The excitation wavelength of the system reference fluorescence ROX is 575nm, and the emission wavelength is 610nm.

[0049] If a blue fluorescent signal is displayed, the wheat to be tested is TaAGAP-3D-_SNP+24 The genotype is TT (i.e. TaAGAP-3D-_SNP+24 is homozygous for T); if a red fluorescent signal is displayed, the wheat to be tested TaAGAP-3D-_SNP+24 The genotype is CC (i.e. TaAGAP-3D-_SNP+24 is homozygous for C); if a green fluorescent signal is displayed, the wheat to be tested TaAGAP-3D-_SNP+24 The genotype is TC (i.e. TaAGAP-3D-_SNP+24 is a heterozygous type of T and C).

[0050] The results of genetic testing are shown in Table 2.

[0051] Table 2 Genotypes and wheat flour sedimentation value test results of 116 wheat varieties

[0052]

[0053]

[0054] The "wheat flour sedimentation value" in Table 2 is the average wheat flour sedimentation value of two locations in Xinxiang, Henan from 2018 to 2022 and Shunyi, Beijing from 2019 to 2022.

[0055] (3) Determination of wheat flour sedimentation value. The measurement was carried out according to the wheat flour sedimentation value (SDS-SV (ml)) determination method in GB / T15685-1995. Weigh 2g of whole wheat flour and place it in a 35ml special stoppered test tube. Add 16.7ml of bromophenol blue solution and mix well. Then shake it on a sedimentation value measuring instrument for 5 minutes. Then add 16.7ml of SDS-lactic acid mixture, shake it again and shake it for 5 minutes. Finally, stand the test tube upright for 5 minutes and record the sedimentation volume. Repeat twice for each sample and take the average value. See the results. Figure 2 , 116 Figure 2 E1: planted in Xinxiang, Henan in 2018-2019; E2: planted in Xinxiang, Henan in 2019-2020; E3: planted in Shunyi, Beijing in 2019-2020; E4: planted in Xinxiang, Henan in 2020-2021; E5: planted in Shunyi, Beijing in 2020-2021; E6: planted in Xinxiang, Henan in 2021-2022; E7: planted in Shunyi, Beijing in 2021-2022; E8: best linear unbiased estimate (BLUP) value.

[0056] The difference analysis was performed by combining the micro-sedimentation value (SDS-SV) data of multiple years and multiple points. SPSS27.0 statistical software was used to process the data, and the experimental results were expressed as mean ± standard deviation, and the One-way ANOVA test was used. The results showed that under multiple environments, the genotype CC ( Figure 2 The average wheat flour sedimentation value of wheat with genotype TT ( Figure 2 The average wheat flour sedimentation value (denoted by "T" in Figure 2 ). The above results show the effectiveness of this marker, which can be used as a functional marker for wheat sedimentation value screening.

[0057] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of a substance for detecting polymorphism or genotype of a SNP site in a wheat genome, characterized in that: The SNP site is a site in the wheat genome, the nucleotide type of which is C or T, and is the 24th nucleotide of sequence 1 in the sequence list; the application is any of the following: A1) Use of the substance in identifying or assisting in identifying the sedimentation value of wheat flour, A2) Application of the substance in wheat breeding, A3) Use of the substance in the preparation of a product for identifying or assisting in identifying the sedimentation value of wheat flour, A4) Use of the substance in preparing wheat breeding products.

2. The use according to claim 1, characterized in that: The substance is as follows (B1), B2) or B3): B1) the substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP site, B2) The substance is a PCR reagent containing the primer combination described in B1), B3) The substance is a kit containing the primer composition described in B1) or the PCR reagent described in B2).

3. A method for identifying or assisting in identifying the sedimentation value of wheat flour, characterized in that: The method comprises detecting the genotype of the SNP site in the wheat genome to be tested, and identifying or assisting in identifying the wheat flour sedimentation value according to the genotype, wherein the SNP site is the SNP site described in claim 1.

4. Application of the method according to claim 3 in wheat breeding.

5. A method for wheat breeding, characterized in that: The method comprises detecting the genotype of the SNP site in claim 1 in the wheat genome, and selecting wheat whose genotype of the SNP site is CC or TT as a parent for breeding, wherein the CC is a homozygous type of the SNP site being C, and the TT is a homozygous type of the SNP site being T.

6. A product for detecting polymorphism or genotype of SNP sites in wheat genome, characterized in that: The SNP site is the SNP site described in claim 1, the product contains the substance described in claim 1, and the product is any one of the following: C1) Products for detecting or assisting in detecting single nucleotide polymorphisms or genotypes related to wheat flour sedimentation value, C2) Products that identify or assist in identifying the sedimentation value of wheat flour. C3) Products for wheat breeding, C4) Products of screening or breeding wheat plants, plant lines, strains or varieties according to the wheat flour sedimentation value.

7. The product according to claim 6, characterized in that: The product is as follows (D1), D2) or D3): D1) The product is a primer combination for amplifying a wheat genomic DNA fragment including the SNP site, D2) The product is a PCR reagent containing the primer combination described in D1), D3) The product is a kit containing the primer combination described in D1) or the PCR reagent described in D2).

8. The use according to claim 2 or the product according to claim 7, characterized in that: The primer composition consists of primer F1, primer F2 and / or primer R; The primer F1 is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 45th position of sequence 2 in the sequence list, The primer F2 is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 45th position of sequence 3 in the sequence list. The primer R is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence list.

9. A DNA molecule, characterized in that: The nucleotide sequence of the DNA molecule is sequence 1 in the sequence list.

10. The use of the DNA molecule according to claim 9, wherein the use is any of the following: E1) Application of the DNA molecule in identifying or assisting in identifying the sedimentation value of wheat flour, E2) Application of the DNA molecule in wheat breeding, E3) Use of the DNA molecule in the preparation of a product for identifying or assisting in identifying the sedimentation value of wheat flour, E4) Use of the DNA molecule in preparing wheat breeding products, E5) Use of the DNA molecule in screening or breeding wheat plants, strains, lines or varieties according to the wheat flour sedimentation value, E6) Use of the DNA molecule in assisting the screening or breeding of wheat plants, strains, lines or varieties according to the sedimentation value of wheat flour.

Images