Use of a substance for detecting SNP polymorphisms in the genome of wheat in the identification of the sedimentation value of wheat flour

Abstract

This invention discloses the application of substances that detect SNP polymorphisms in the wheat genome in identifying the sedimentation value of wheat flour. Based on candidate gene association analysis, [the following was discovered / identified / discovered]. TaAGAP‑3D A SNP variant in the coding region (position 24 of sequence 1, C / T) was used to develop a KASP marker, named […]. TaAGAP‑3D‑_SNP+24 The marker demonstrated good reproducibility and accuracy using 20 wheat accessions with known genotypes. The marker was then used to scan natural wheat populations, and correlation analysis was performed with the population sedimentation data, revealing… TaAGAP‑3D‑_SNP+24 Allelic variation was significantly correlated with wheat sedimentation value. P <0.05). This KASP marker has good repeatability, is easy to detect, and is low in cost, showing promising application prospects in molecular marker-assisted selection and molecular design breeding to improve wheat quality.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to the application of substances for detecting SNP polymorphism in the genome of wheat in identifying the sedimentation value of wheat flour. BACKGROUND

[0002] Wheat is the second largest food crop in China, and is the main food of people in northern provinces, playing a vital role in ensuring national food security. With the improvement of people's living standards, the diet is more colorful, and the requirement for the quality of flour is also increasing. The breeding goal of wheat has changed from high yield to high yield and high quality. How to further improve the quality of wheat under the premise of high yield is a problem that needs to be solved in current breeding.

[0003] Wheat quality can be divided into nutritional quality and processing quality. Among them, the eating quality in processing quality is the main concern in wheat quality breeding. The eating quality of wheat is mainly related to the physicochemical properties of dough, which can be measured by SDS-sedimentation value (SDS-SV), gluten content, stretching area, and stability time. SDS-SV is significantly related to the baking quality of wheat flour and is an important indicator for evaluating the quality of flour protein (Axford et al. 1979). Past studies have found that the SDS-SV of wheat flour is controlled by multiple genes. Conti et al. (2011) found that Glu-B1 is a stable site controlling SDS-SV. The SDS-sedimentation value of the functional deletion mutant of the high molecular weight glutenin subunit gene Glu-A1 will be significantly reduced (Yang et al. 2014). The alleles of the high molecular weight glutenin subunit (HMW-GS) and the alleles of the low molecular weight glutenin subunit (LMW-GS) have important control effects on the sedimentation value, and the 1BL / 1RS translocation has a significant negative effect on the SDS sedimentation value (Liu et al. 2004). The gene controlling hardness in wheat Glu-1 allelic variation positively regulates SDS-SV (Würschum et al. 2016). In addition, the team of Yao Yingyin of China Agricultural University used the near-isogenic line population constructed by the parent ND3331 with low SDS-SV and the parent Zang1817 with high SDS-SV, and identified 10 QTLs controlling SDS-SV. Among them, the effects of four major loci on SDS-SV are related to the high molecular weight glutenin subunit Glu-3 , 1B / 1R translocation, Pinb-D1b and 1Ax1 , and it was found that Zang1817 carries Pina-D1 . Pinb-D1 Pinb-D1p ​is an excellent allele of high SDS-SV (Chang et al. 2022). In summary, SDS-SV is mainly regulated by wheat quality genes. Therefore, mining and utilizing the genes controlling wheat SDS-SV not only provides new genetic resources for molecular marker-assisted breeding and transgenic breeding, but also helps to improve the speed and level of wheat quality breeding, which is of great significance for high-yield and high-quality wheat breeding. SUMMARY

[0004] The technical problem to be solved by the present application is how to quickly and accurately screen wheat with different flour sedimentation values.

[0005] To solve the above problems, the present application first provides the use of a substance for detecting the polymorphism or genotype of a SNP site in the wheat genome, the SNP site being a site in the wheat genome, the nucleotide species being C or T, the 24th nucleotide of SEQ ID No. 1 in the sequence listing; the application can be any of the following:

[0006] A1) the use of the substance in identifying or assisting in identifying the sedimentation value of wheat flour,

[0007] A2) the use of the substance in wheat breeding,

[0008] A3) the use of the substance in preparing a product for identifying or assisting in identifying the sedimentation value of wheat flour,

[0009] A4) the use of the substance in preparing a product for wheat breeding.

[0010] The substance can be B1), B2) or B3) as follows:

[0011] B1) the substance is a primer composition for amplifying a DNA fragment of the wheat genome including the SNP site,

[0012] B2) the substance is a PCR reagent containing the primer composition of B1),

[0013] B3) the substance is a kit containing the primer composition of B1) or the PCR reagent of B2).

[0014] The SNP single nucleotide polymorphism site is a SNP in the wheat genome, which is the 24th nucleotide of SEQ ID No. 1 in the sequence listing, which is C or T; located in the TaAGAP gene on wheat chromosome 3D, TaAGAP-3D The gene is related to the sedimentation value of wheat flour.

[0015] In the above applications, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative) or, optionally, charge-neutral. The marker can include a nucleic acid sequence or a protein sequence or a combination thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without a marker (e.g., direct sequence reading).

[0016] In this application, the settlement value may be the SDS settlement value.

[0017] The present invention also provides a method for identifying or assisting in the identification of wheat flour sedimentation value, the method comprising detecting the genotype of the SNP locus in the genome of the wheat to be tested, and identifying or assisting in the identification of wheat flour sedimentation value based on the genotype.

[0018] In the above-mentioned method for identifying or assisting in the identification of wheat flour sedimentation value, the genotype is CC or TT, where CC is a homozygous type with the SNP locus C and TT is a homozygous type with the SNP locus T. Based on the identification or assistance in the identification of wheat grain traits according to the genotype, the sedimentation value of the wheat to be tested with the genotype TT is higher than that of the wheat to be tested with the genotype CC.

[0019] The present invention also provides a method for wheat breeding, the method comprising detecting the genotype of the above-mentioned SNP loci in the wheat genome, selecting wheat with the genotype of CC and / or TT at the SNP loci as parents for breeding, wherein CC is a homozygous type of the SNP locus C, and TT is a homozygous type of the SNP locus T.

[0020] In the above-mentioned wheat breeding method, the wheat breeding indicators include wheat flour sedimentation value.

[0021] Furthermore, the purpose of the wheat breeding includes cultivating wheat with increased / decreased flour sedimentation value. Increased / decreased flour sedimentation value refers to a flour sedimentation value higher than / lower than that of the parent wheat.

[0022] In the above-mentioned methods for identifying or assisting in the identification of wheat flour sedimentation value and the above-mentioned methods for wheat breeding, the wheat can be an inbred line or a pure line.

[0023] This invention also provides the application of the above method in wheat breeding.

[0024] This invention also provides a product for detecting polymorphisms or genotypes of SNP sites in the wheat genome, wherein the SNP sites are those described above, and the product contains the substances described above. The product may be any of the following:

[0025] C1) Products that detect or assist in the detection of single nucleotide polymorphisms or genotypes related to wheat flour sedimentation values.

[0026] C2) Products used for identifying or assisting in the identification of wheat flour sedimentation value.

[0027] C3) Products used in wheat breeding

[0028] C4) Products of wheat single plants, lines, strains or varieties selected or bred according to the sedimentation value of wheat flour.

[0029] Specifically, the product may be as follows: D1), D2), or D3).

[0030] D1) The product is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites.

[0031] D2) The product is a PCR reagent containing the primer composition described in D1).

[0032] D3) The product is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0033] In the above text, the primer composition consists of primer F1, primer F2 and / or primer R;

[0034] The primer F1 is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing, or a single-stranded DNA molecule whose nucleotide sequence is positions 22-45 of sequence 2 in the sequence listing.

[0035] The primer F2 is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing, or a single-stranded DNA molecule whose nucleotide sequence is positions 22-45 of sequence 3 in the sequence listing.

[0036] The primer R is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence listing.

[0037] The F1 sequence is: 5'- GAAGGTGACCAAGTTCATGCT CGGGTATCGATAGCAGAAGTCTTT-3',

[0038] The F2 sequence is: 5'- GAAGGTCGGAGTCAACGGATTCGGGTATCGATAGCAGAAGTCTTC-3',

[0039] The R sequence is: 5'-TGACACTCCAGATCCCCTTTTT-3'.

[0040] Primer F1 is a primer with a 6-carboxyfluorescein (FAM) dye tag sequence (underlined base) at the 5' end, and primer R amplifies... TaAGAP-3D-_SNP+24 For segment T;

[0041] Primer F2 is a primer with a hexachloro-6-methylfluorescein (HEX) dye tag sequence (underlined base) at the 5' end, and primer R amplifies... TaAGAP-3D-_SNP+24 The segment is C.

[0042] In the above applications and methods, the substance used to detect SNP polymorphisms or genotypes can be a nucleotide type for determining the SNP sites in the wheat genome using at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP microarrays. The SNP microarrays include microarrays based on nucleic acid hybridization reactions, microarrays based on single-base extension reactions, microarrays based on allele-specific primer extension reactions, microarrays based on one-step reactions, microarrays based on primer ligation reactions, microarrays based on restriction endonuclease reactions, microarrays based on protein-DNA binding reactions, and microarrays based on fluorescent molecule-DNA binding reactions.

[0043] The present invention also provides a DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing.

[0044] The application of the aforementioned DNA molecules is also within the scope of protection of this invention, and the application may be any of the following:

[0045] E1) The application of the DNA molecule described in the identification or auxiliary identification of wheat flour sedimentation value.

[0046] The application of the DNA molecules described in E2) in wheat breeding

[0047] E3) The application of the DNA molecule described therein in the preparation of products for identifying or assisting in the identification of the sedimentation value of wheat flour.

[0048] The application of the DNA molecules described in E4 in the preparation of wheat breeding products.

[0049] E5) The application of the DNA molecule described therein in screening or breeding wheat individual plants, lines, strains, or varieties based on wheat flour sedimentation values.

[0050] E6) The application of the DNA molecule described therein in the screening or breeding of wheat single plants, lines, strains or varieties based on the sedimentation value of wheat flour.

[0051] The product may be a reagent kit.

[0052] The kit contains a primer composition for amplifying wheat genomic DNA fragments, including the SNP sites.

[0053] The amplified products can be placed in the QuantStudio™ 7 Flex Real-Time PCR Analyzer (Applied Biosystems by Life Technologies) to detect fluorescence signals. The QuantStudio™ Real-time PCR Software v1.3 (Applied Biosystems by Life Technologies) enables data visualization and result interpretation.

[0054] This invention discloses candidate genes for wheat sedimentation value. TaAGAP-3D The amplified sequence of the SNP variation on this gene, located on wheat chromosome 3D, can be used for rapid and accurate identification or auxiliary identification of wheat flour sedimentation value. A KASP marker was developed based on this site and named... TaAGAP-3D-_SNP+24 The marker demonstrated good reproducibility and accuracy using 20 wheat accessions with known genotypes. A correlation analysis was performed using this marker to scan natural wheat populations and compared with wheat flour sedimentation data from these populations, revealing… TaAGAP-3D-_SNP+24 Allelic variation was significantly correlated with wheat flour sedimentation value. P <0.05). This KASP marker has good repeatability, is easy to detect, and is low in cost, showing promising application prospects in molecular marker-assisted selection and molecular design breeding to improve wheat quality. Attached Figure Description

[0055] Figure 1 for TaAGAP-3D Information on variant sites and marker development in the coding region.

[0056] Figure 2 for TaAGAP-3D-_SNP+24 Label association analysis. Detailed Implementation

[0057] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0058] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0059] The wheat varieties used in the following examples are commercial varieties and can be found on the China Crop Germplasm Information Network (http: / / www.cgris.net / ).

[0060] The present invention will be further described below with reference to specific embodiments, but the present invention is not limited to the following embodiments. Unless otherwise specified, the following embodiments are all conventional methods.

[0061] Example 1 TaAGAP-3D cDNA cloning, SNP site discovery, and primer design

[0062] Based on population genetics and association analysis, this invention identifies a novel gene controlling wheat flour sedimentation value in a natural population through genome-wide association analysis (GWAS). TaAGAP-3D A SNP (C / T) at +726 bp in the coding region of the candidate gene was located through association analysis. A KASP marker was developed using this SNP and identified in 116 wheat accessions. Association analysis between genotype and sedimentation value phenotypic data revealed a significant correlation between the marker and wheat flour sedimentation value, indicating that this marker is an effective molecular marker for screening wheat with different sedimentation values.

[0063] Using the wheat Chinese spring reference genome to obtain wheat TaAGAP-3D Sequence information was obtained using wheat resequencing data previously published by the research group, providing detailed SNP locus information. Candidate gene association analysis was then used to locate... TaAGAP- 3D A single SNP site in the coding region of a gene exhibits C / T polymorphism. Based on the allelic variation at this site, specific KASP primers were designed using the CAPS / KASP (Beta) function on the WheatOmics 1.0 website. The amplification product of the specific KASP primers is sequence 1 in the sequence listing. The specific SNP site is located at position 24 of sequence 1 and is named... TaAGAP-3D-SNP+ 24 The specific sequence of sequence 1 (SEQ NO: 1, 150bp) is as follows:

[0064] 5'-CGGGTATCGATAGCAGAAGTCTTCCATTCCATACAGGATTCAGGCTGCTCTTTATCACCTTCGTTTTCATCGACTACAAGGGCAAAAAGGGGATCTGGAGTGTCA-3'.

[0065] The specific KASP primers include specific forward primers F1 (SEQ ID NO.2) and F2 (SEQ ID NO.3), and a universal reverse primer R (SEQ ID NO.4).

[0066] F1: 5'- GAAGGTGACCAAGTTCATGCT CGGGTATCGATAGCAGAAGTCTTT-3';

[0067] F2: 5'- GAAGGTCGGAGTCAACGGATT CGGGTATCGATAGCAGAAGTCTTC-3';

[0068] R: 5'-TGACACTCCAGATCCCCTTTTT-3'.

[0069] Primer F1 is a primer with a 6-carboxyfluorescein (FAM) dye tag sequence (underlined base) at the 5' end, and primer R amplifies... TaAGAP-3D-_SNP+24 For segment T;

[0070] Primer F2 is a primer with a hexachloro-6-methylfluorescein (HEX) dye tag sequence (underlined base) at the 5' end, and primer R amplifies... TaAGAP-3D-_SNP+24 The segment is C.

[0071] Finally, a real-time PCR instrument was used to read the signals, and software was used to acquire the signals and determine the allele types. The specific experimental steps are as follows:

[0072] The KASP-labeled reaction system is as follows: template DNA concentration is 20-40 ng / μl; primer concentrations F1, F2, and R are all 100 μM; primer mix is ​​prepared according to F1:F2:R = 3:3:7.5, and ddH2O is added to a final volume of 25 μl. The reaction system is as follows:

[0073] Table 1. Reaction system labeled with KASP

[0074]

[0075] KASP-labeled amplification reaction procedure: The amplification reaction was performed on a 384-well real-time PCR plate, with a total of 5.0 μl of mixed reaction mixture per well. The procedure was as follows: 95℃ pre-denaturation, 10 min; 95℃, 20 s, 62℃, 40 s, 10 cycles; 95℃, 20 s, 58℃, 40 s, 37 cycles; plate reading at 28℃, 1 min.

[0076] Detection and interpretation of KASP amplification products: The QuantStudio™ 7 Flex PCR instrument (Applied Biosystems by Life Technologies) was used to detect the fluorescence signal of the amplification products, and the QuantStudio™ Real-time PCR Software v1.3 (Applied Biosystems by Life Technologies) was used for data visualization and result interpretation. After the reaction, different allelic variants at the same locus were displayed in different colors on the binary clustering diagram, with materials of the same allelic variant type identified by the same color. Red and blue represent different allelic variants at the same locus, green represents heterozygotes, black is the negative control, and "×" indicates a locus where no allelic variant type was identified. Using the negative control (KASP master mix) as the judgment baseline, different materials were displayed on the corresponding coordinates in different colors according to the allelic variant type they carried. Specifically, TT homozygotes (i.e., those in the wheat genome) TaAGAP-3D-_SNP+24 The homozygous form of T is blue, and the homozygous form of CC (i.e., the form in the wheat genome) is blue. TaAGAP-3D-_SNP+24 The homozygous C type is red, while the heterozygous TC type (i.e., the type in the wheat genome) is red. TaAGAP-3D-_SNP+24 (The hybrid of T and C) is green.

[0077] Example 2 TaAGAP-3D-_SNP+24 Functional verification

[0078] 116 wheat materials were used for testing TaAGAP-3D-_SNP+24 Functional validation was conducted. 116 representative domestic and international varieties were planted annually in Xinxiang, Henan Province from 2018 to 2022, and annually in Shunyi, Beijing Province from 2019 to 2022. A completely randomized block design was used, with three replicates, four rows, row length 2 m, row width 0.25 m, and 40 seeds evenly sown per row. Mature seeds were harvested.

[0079] use TaAGAP-3D-_SNP+24 All experimental materials were labeled and tested using the following method:

[0080] (1) PCR amplification system and procedure. Genomic DNA was extracted from wheat leaves and dissolved in 200 μL TE. The DNA quality was determined by 1% agarose gel electrophoresis. The extracted DNA was required to be free of obvious impurities, have clear bands, and be free of degradation. After the DNA concentration was determined, it was uniformly diluted to 28.3 ng / μL. PCR amplification was performed using the diluted wheat genomic DNA as a template.

[0081] The PCR amplification system was as follows: template DNA concentration was 20-40 ng / μl; primer concentrations F1, F2, and R were all 100 μM; primer mix was prepared according to F1:F2:R = 3:3:7.5, and ddH2O was added to a final volume of 25 μl. The reaction system was as follows:

[0082] DNA 2.2 μl, Primer mix 0.3 μl, KASP master mix 2.5 μl, total 5.0 μl.

[0083] The amplification reaction was performed on a 384-well real-time PCR plate, with a total of 5.0 μl of mixed reaction mixture per well. The program was as follows: 95℃ pre-denaturation, 10 min; 95℃, 20 s, 62℃, 40 s, 10 cycles; 95℃, 20 s, 58℃, 40 s, 37 cycles; plate reading at 28℃, 1 min.

[0084] (2) Genotyping. The QuantStudio™ 7 Flex PCR instrument (Applied Biosystems by Life Technologies) is used to detect fluorescence signals in the amplification products, and the QuantStudio™ Real-time PCR Software v1.3 (Applied Biosystems by Life Technologies) is used to visualize the data and interpret the results.

[0085] The FAM excitation wavelength is 485 nm, and the emission wavelength is 520 nm. The HEX excitation wavelength is 535 nm, and the emission wavelength is 556 nm. The system reference fluorescence ROX excitation wavelength is 575 nm, and the emission wavelength is 610 nm.

[0086] If a blue fluorescent signal is displayed, then the wheat being tested... TaAGAP-3D-_SNP+24 The genotype is TT (i.e., in the wheat genome). TaAGAP-3D-_SNP+24 (If it is the homozygous form of T); if a red fluorescent signal is displayed, then the wheat being tested... TaAGAP-3D-_SNP+24 Genotype CC (i.e., in the wheat genome) TaAGAP-3D-_SNP+24 (If it is the homozygous form of C); if it displays a green fluorescent signal, then the wheat being tested... TaAGAP-3D-_SNP+24 Genotype TC (i.e., in the wheat genome)TaAGAP-3D-_SNP+24 (It is a hybrid of T and C).

[0087] The results of the genetic testing are shown in Table 2.

[0088] Table 2. Genotypes and sedimentation values ​​of wheat flour from 116 wheat varieties.

[0089]

[0090]

[0091]

[0092] The “wheat flour sedimentation value” in Table 2 is the average wheat flour sedimentation value of two locations in Xinxiang, Henan Province from 2018 to 2022 and Shunyi, Beijing Province from 2019 to 2022.

[0093] (3) Measurement of wheat flour sedimentation value. The sedimentation value (SDS-SV (ml)) of wheat flour was measured according to GB / T15685-1995. 2g of whole wheat flour was weighed and placed in a 35ml stoppered test tube. 16.7ml of bromophenol blue solution was added and mixed thoroughly. The mixture was then shaken for 5 minutes on a sedimentation value analyzer. Next, 16.7ml of SDS-lactic acid mixture was added, and the mixture was shaken thoroughly again for 5 minutes. Finally, the test tube was stood upright for 5 minutes, and the sedimentation volume was recorded. Two replicates were performed for each sample, and the average value was taken. Results are shown in […]. Figure 2 116 Figure 2 E1: Planted in Xinxiang, Henan Province in 2018-2019; E2: Planted in Xinxiang, Henan Province in 2019-2020; E3: Planted in Shunyi, Beijing in 2019-2020; E4: Planted in Xinxiang, Henan Province in 2020-2021; E5: Planted in Shunyi, Beijing in 2020-2021; E6: Planted in Xinxiang, Henan Province in 2021-2022; E7: Planted in Shunyi, Beijing in 2021-2022; E8: Best linear unbiased estimate (BLUP) value.

[0094] Difference analysis was performed using multi-year, multi-location micro-deposition data (SDS-SV). SPSS 27.0 statistical software was used for data processing. Experimental results are expressed as mean ± standard deviation, and one-way ANOVA was used. Results showed that under multiple environmental conditions, the genotype CC (… Figure 2 The average wheat flour sedimentation value of wheat with genotype "C" was significantly higher than that of wheat with genotype TT. Figure 2 The average wheat flour settling value (represented by "T") of wheat (in Chinese) Figure 2 The above results demonstrate the effectiveness of this marker and its potential as a functional marker for screening wheat sedimentation values.

[0095] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. An application of a substance for detecting SNP loci genotypes in the wheat genome, characterized by: The SNP site is a site in the wheat genome, and its nucleotide type is C or T, specifically the 24th nucleotide of sequence 1 in the sequence listing; the application is any of the following: A1) Application of the substance described in the determination of the sedimentation value of wheat flour Application of the substance described in A2) in wheat flour sedimentation value breeding A3) The application of the substance described therein in the preparation of products for identifying the sedimentation value of wheat flour. A4) The application of the substance described therein in the preparation of products for wheat flour sedimentation value breeding; The breeding program aims to cultivate wheat with high flour sedimentation values. The test wheat with the SNP locus genotype CC has a higher flour sedimentation value than the test wheat with the genotype TT.

2. The application according to claim 1, characterized in that: The substance is B1), B2), or B3): B1) The substance described is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites. B2) The substance is a PCR reagent containing the primer composition described in B1). B3) The substance is a kit containing the primer composition described in B1) or the PCR reagent described in B2).

3. A method for determining the sedimentation value of wheat flour, characterized in that: The method includes detecting the genotype of SNP sites in the genome of the wheat to be tested, and identifying the sedimentation value of wheat flour based on the genotype. The SNP site is the SNP site described in claim 1. The sedimentation value of the wheat flour to be tested with the genotype CC is higher than that of the wheat flour to be tested with the genotype TT.

4. The application of the method of claim 3 in wheat flour sedimentation value breeding, wherein the breeding is for cultivating wheat with high wheat flour sedimentation value.

5. A method for breeding wheat flour sedimentation value, characterized in that: The method includes detecting the genotype of the SNP locus in claim 1 in the wheat genome, selecting wheat with the genotype CC at the SNP locus as a parent for breeding, wherein CC is the homozygous type of the SNP locus C.

Images