PfAgo protein mediated micropterus salmoides iridovirus nucleic acid detection kit and detection method thereof

Abstract

The invention relates to the technical field of Micropterus salmoides iridovirus, and discloses a PfAgo protein mediated Micropterus salmoides iridovirus nucleic acid detection kit and a detection method thereof, the kit comprises a PfAgo protein, an amplification primer pair, gDNA and a molecular beacon; the gDNA comprises g6 of which the sequence is as shown in SEQ ID NO: 7 and g6-1 of which the sequence is as shown in SEQ ID NO: 19; the amplification primer pair is a primer pair of which the sequence is as shown in SEQ ID NO: 21 to 22 or a primer pair of which the sequence is as shown in SEQ ID NO: 23 to 24; the sequence of the molecular beacon is as shown in SEQ ID NO: 66. The largemouth bass iridovirus detection kit provided by the invention contains gDNA obtained through screening and optimization, and compared with guide RNA of a Cas13a system, the guide ssDNA not only can be conveniently and stably obtained, but also has a cost advantage; meanwhile, by selecting the gDNA with a specific sequence, not only is the detection sensitivity increased, but also the dosage of the gDNA in the experiment process is reduced, and the necessary 5 '-phosphorylation reaction procedure in the experiment process is reduced, so that the detection cost is reduced, and the time-consuming and labor-consuming complicated process is reduced.

Description

Technical Field

[0001] The invention relates to the technical field of largemouth bass iridovirus detection, and in particular to a largemouth bass iridovirus nucleic acid detection kit mediated by a PfAgo protein and a detection method thereof. Background Art

[0002] Largemouth bass is one of the most representative and characteristic freshwater fish with huge development potential. With the success of artificial propagation and seedling raising technology of largemouth bass, largemouth bass aquaculture has developed rapidly. The annual aquaculture output of largemouth bass in my country has exceeded 700,000 tons. At the same time, the disease problem is becoming increasingly serious. The diseases of largemouth bass mainly include viral diseases, bacterial diseases and parasitic diseases. Among them, viral diseases are fast-spreading and have high incidence rates, and there are currently no effective control measures, which seriously affect the development of largemouth bass aquaculture. Among viral diseases, largemouth bass iridovirus (LMBV) is one of the most important pathogens. LMBV is the most important viral pathogen in the cultivation process of largemouth bass. It is a cytoplasmic double-stranded DNA virus that mainly infects fry and young fish, with a mortality rate of more than 80%. At present, there is still a lack of effective treatment and prevention and control measures for largemouth bass iridovirus. Early detection and diagnosis are the key links in preventing the outbreak of the disease. Therefore, the development of new virus detection technology has important application value.

[0003] At present, the main diagnostic methods for largemouth bass infected with LMBV include clinical symptom diagnosis, virus isolation and culture, electron microscopy, immunological detection and nucleic acid detection. At present, nucleic acid detection is mainly based on RT-qPCR, but it faces the problems of complex design, cumbersome operation and expensive instruments. In recent years, with the emergence of new gene editing technologies represented by CRISPR / Cas9 and their widespread application in the detection of pathogenic microorganisms, traditional molecular diagnostic technology has entered a new molecular diagnosis stage with low cost, high sensitivity and high specificity. Among them, the new detection system RAA-CRISPR / Cas13 method for LMBV virus has also been successfully established, but this method requires recombinase-assisted amplification (RAA) amplification first, and then CRISPR / Cas13a is used for detection, and its detection sensitivity reaches 3.1×10 1 This indicates that the molecular diagnostic method based on the novel gene editing enzyme CRISPR / Cas system has potential application prospects in the detection of B19 virus. However, given the high cost of gRNA synthesis in the CRISPR / Cas system and the need to improve sensitivity, the development of new molecular diagnostic methods is of great significance. Summary of the invention

[0004] The purpose of the present invention is to overcome the problems in the prior art that the synthesis cost of gRNA in the CRISPR / Cas system is expensive and the sensitivity still needs to be improved, and to provide a PfAgo protein-mediated largemouth bass iridovirus nucleic acid detection kit and a detection method thereof.

[0005] In order to achieve the above-mentioned object, the present invention provides a largemouth bass iridovirus nucleic acid detection kit on the one hand, the kit comprising PfAgo protein, amplification primer pairs, gDNA and molecular beacons;

[0006] Wherein, the gDNA comprises g6 with a sequence as shown in SEQ ID NO:7 and g6-1 with a sequence as shown in SEQ ID NO:19;

[0007] The amplification primer pair is a primer pair with a sequence as shown in SEQ ID NOs: 21 to 22 or a primer pair as shown in SEQ ID NOs: 23 to 24;

[0008] The sequence of the molecular beacon is shown in SEQ ID NO:66.

[0009] The second aspect of the present invention provides a method for detecting LMBV virus nucleic acid mediated by PfAgo protein, the method comprising the following steps:

[0010] (1) amplifying the sample to be tested using the primer pair shown in SEQ ID NOs: 21-22 or the primer pair shown in SEQ ID NOs: 23-24 to obtain tDNA;

[0011] (2) constructing a reaction system comprising 5'-phosphorylated gDNA, PfAgo protein, the tDNA, PfAgo reaction buffer and molecular beacon, and then performing a cleavage reaction;

[0012] (3) After the reaction is completed, fluorescence detection is performed on the reaction system;

[0013] The gDNA comprises g6 as shown in SEQ ID NO:7 and g6-1 as shown in SEQ ID NO:19;

[0014] The sequence of the molecular beacon is shown in SEQ ID NO:66.

[0015] The third aspect of the present invention provides the use of the above-mentioned kit in identifying or assisting in identifying LMBV virus.

[0016] The PfAgo protein-mediated largemouth bass iridovirus detection kit provided by the present invention contains gDNA (guide DNA) obtained through screening and optimization. Compared with the guide RNA of the Cas13a system, the guide ssDNA can not only be obtained conveniently and stably, but also has cost advantages. At the same time, by selecting gDNA with a specific sequence, not only the sensitivity of detection is increased, but also the amount of gDNA used in the experiment is reduced, and the necessary 5' phosphorylation reaction procedure in the experiment is reduced, thereby reducing the cost of detection and reducing the time-consuming and labor-intensive complicated process.

[0017] The detection method based on the above-mentioned kit provided by the present invention, when used in conjunction with PCR technology, can still be detected when the LMBV to be detected is as low as 1.0 copy / μL, and its detection sensitivity exceeds that of the RAA-CRISPR / Cas13 method. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a gel electrophoresis diagram of the expression product of the recombinant PfAgo expression vector in Preparation Example 1 of the present invention;

[0019] Figure 2 This is a schematic diagram of gDNA guiding PfAgo to cut simulated tDNA in Preparation Example 2 of the present invention;

[0020] Figure 3 Schematic diagram of the molecular beacon sequence guided by gn at different sites of PfAgo in Preparation Example 2 of the present invention;

[0021] Figure 4 This is the TBE-PAGE electrophoresis result of gDNA guiding PfAgo to cut the simulated tDNA in Preparation Example 2;

[0022] Figure 5 The TBE-PAGE electrophoresis results of the gn-guided PfAgo cleavage of the molecular beacon sequence at different sites in Preparation Example 2;

[0023] Figure 6 This is an analysis diagram of the fluorescence intensity detection results of the cleavage site No. 3 in Preparation Example 2;

[0024] Figure 7 This is an analysis diagram of the fluorescence intensity detection results of the cleavage site No. 6 in Preparation Example 2;

[0025] Figure 8 The agarose gel electrophoresis diagrams after PCR amplification of the positive plasmid templates with different concentrations in Example 1;

[0026] Fig. 9 This is an analysis diagram of the fluorescence intensity detection results of PfAgo cutting after PCR amplification of positive plasmid templates with different concentrations;

[0027] Fig.10 The figure shows the results of specific detection of ten species containing similar target fragments;

[0028] Fig.11 This is an analysis diagram of the fluorescence intensity detection results of the PCR amplification reaction with different primer concentrations;

[0029] Fig.12 This is an analysis diagram of the fluorescence intensity detection results of different manganese ion concentration reactions;

[0030] Fig.13 This is an analysis diagram of the fluorescence intensity detection results of reactions with different gDNA concentrations;

[0031] Fig.14 This is an analysis chart of the fluorescence intensity detection results of reactions with different PfAgo concentrations. DETAILED DESCRIPTION

[0032] The specific implementation of the present invention is described in detail below in conjunction with the accompanying drawings. It should be understood that the specific implementation described here is only used to illustrate and explain the present invention, and is not used to limit the present invention.

[0033] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0034] At present, a new detection system RAA-CRISPR / Cas13 method for LMBV virus has been successfully established. However, this method requires recombinase-assisted amplification (RAA) amplification and then detection using CRISPR / Cas13a. Its detection sensitivity reaches 3.1×10 1 This indicates that the molecular diagnostic method based on the novel gene editing enzyme CRISPR / Cas system has potential application prospects in the detection of B19 virus. However, the synthesis of gRNA in the CRISPR / Cas system is expensive and the sensitivity still needs to be improved.

[0035] Research has found that Argonaute protein is another new type of programmable nuclease, among which prokaryotic Argonaute has made important progress in the application of in vitro molecular diagnosis. PfAgo is an Argonaute protein derived from the thermophilic archaea Pyrococcus furiosus, which can cut ssDNA under the guidance of a short DNA sequence. At the same time, the short single-stranded DNA (gn) produced by PfAgo cutting can bind to the apo-PfAgo protein to initiate a second round of cutting of the downstream target in the same reaction system. In view of this, the present invention provides a PfAgo protein-mediated largemouth bass iridovirus nucleic acid detection kit, the kit comprising PfAgo protein, an amplification primer pair, gDNA and a molecular beacon;

[0036] Wherein, the gDNA comprises g6 with a sequence as shown in SEQ ID NO:7 and g6-1 with a sequence as shown in SEQ ID NO:19;

[0037] The amplification primer pair is a primer pair with a sequence as shown in SEQ ID NOs: 21 to 22 or a primer pair as shown in SEQ ID NOs: 23 to 24;

[0038] The sequence of the molecular beacon is shown in SEQ ID NO:66.

[0039] In a specific embodiment, the sequences g6 and g6-1 contained in the gDNA are as follows:

[0040] g6: 5'-CTGGCCACCACCTCTA-3' (SEQ ID NO:7);

[0041] g6-1: 5'-GCCATTCCCATCAGCA-3' (SEQ ID NO: 19).

[0042] In the kit of the present invention, the molecular beacon carries a fluorescent group and a quenching group.

[0043] In some embodiments, the gDNA further comprises g6-2 whose sequence is shown in SEQ ID NO:20.

[0044] In the present invention, the sequence of the molecular beacon is:

[0045] 5'-FAM6-CCATCAGCACTGGCCACCA-BHQ1-3' (SEQ ID NO: 66).

[0046] The present invention also provides a method for detecting LMBV virus nucleic acid mediated by PfAgo protein, which is implemented using the kit as described above, and comprises the following steps:

[0047] (1) amplifying the sample to be tested using the primer pair shown in SEQ ID NOs: 21-22 or the primer pair shown in SEQ ID NOs: 23-24 to obtain tDNA;

[0048] (2) constructing a reaction system comprising 5'-phosphorylated gDNA, PfAgo protein, the tDNA, PfAgo reaction buffer and molecular beacon, and then performing a cleavage reaction;

[0049] (3) After the reaction is completed, fluorescence detection is performed on the reaction system;

[0050] The gDNA comprises g6 as shown in SEQ ID NO:7 and g6-1 as shown in SEQ ID NO:19;

[0051] The sequence of the molecular beacon is shown in SEQ ID NO:66.

[0052] The detection principle of the PfAgo protein-mediated LMBV virus nucleic acid detection method provided by the present invention is as follows: first, a primer pair shown in SEQ ID NO: 21-22 or a primer pair shown in SEQ ID NO: 23-24 is selected, and the MCP gene of the virus to be detected is amplified by PCR technology, and the amplified target fragment is 180bp; 2 μL of the amplified product tDNA is added to a reaction system containing two phosphorylated input gDNAs and PfAgo protein, and gDNAs mediate PfAgo to cut the amplified product tDNA, releasing a single-stranded DNA with a length of 16nt and a phosphate group at the 5' end, and the single-stranded DNA can mediate the PfAgo protein in the system to cut a molecular beacon complementary to its sequence, thereby generating a fluorescent signal, and the presence of the virus to be detected is judged by generating fluorescence.

[0053] In the detection method of the present invention, in step (1), after the gDNA is 5' phosphorylated, the PfAgo protein, the tDNA, the PfAgo reaction buffer and the molecular beacon are added to obtain a reaction system.

[0054] In a preferred embodiment, the PfAgo reaction buffer comprises HEPES, sodium chloride and manganese chloride.

[0055] Further preferably, in the reaction system, a 10×PfAgo reaction buffer is used, wherein the PfAgo reaction buffer comprises: 150-250 mM HEPES, 2-3 M sodium chloride and 20-30 mM manganese chloride.

[0056] Further preferably, the optimized PfAgo reaction buffer comprises: 200 mM HEPES (PH=8.0), 2.5 M sodium chloride and 20 mM manganese chloride.

[0057] In a preferred embodiment, the pH of HEPES in the PfAgo reaction buffer is 7.5-8.5.

[0058] In a preferred embodiment, in step (2), the conditions of the cleavage reaction include: a temperature of 93 to 98° C. and a time of 20 to 40 min. Specifically, the temperature of the cleavage reaction may be 93° C., 94° C., 95° C., 96° C., 97° C. or 98° C., and the time of the cleavage reaction may be 20 min, 22 min, 23 min, 25 min, 30 min, 32 min, 34 min, 35 min, 38 min or 40 min.

[0059] In a preferred embodiment, in step (2), the concentration of PfAgo protein in the reaction system is 2 to 2.5 uM.

[0060] In a preferred embodiment, in step (2), in the reaction system, the final concentration of a single input gDNA is 0.4 to 2 uM, more preferably 0.5 to 1.5 uM.

[0061] The present invention also proposes the use of the above-mentioned kit in identifying or assisting in identifying the LMBV virus.

[0062] The present invention will be described in detail below by way of examples, but the protection scope of the present invention is not limited thereto. The reagents, materials, etc. used in the examples of the present invention, unless otherwise specified, can all be obtained through commercial channels.

[0063] Preparation Example 1

[0064] 1. Construction of recombinant PfAgo expression vector

[0065] (1) Amplify the PfAgo gene and pET-23a expression vector using a high-fidelity PCR kit. The specific primer sequences (5'-3') are as follows:

[0066] PfAgo-F:tacatatgcatcaccatcaccaccatagcatgaaagccattgtggtgattaacc;

[0067] PfAgo-R:gaattgtgagcgctctaaacaaaatatagaaatccttctg;

[0068] Pet23a-F:gagcgctcacaattctcgagc;

[0069] Pet23a-R:gctatgatgatgatgatggtgcatatgtatatctcc.

[0070] The PCR program was as follows: ① pre-denaturation at 95°C for 30 s; ② denaturation at 95°C for 10 s, annealing at 64°C for 15 s, and extension at 72°C; 25 cycles in total; ③ complete extension at 72°C for 5 min. The PfAgo PCR product and the pET 23a vector PCR product were detected by agarose gel electrophoresis, recovered, and connected.

[0071] (2) The ligation product was transformed into Escherichia coli DH5α competent cells by heat shock method.

[0072] E. coli DH5α competent cells were spread on LB agar plates containing ampicillin (Amp) resistance to screen positive clone transformants.

[0073] (3) Single colonies on the LB agar plate were picked for colony PCR and inoculated into LB broth medium containing ampicillin resistance, cultured overnight at 37°C, and plasmids were extracted from the bacteria with correct sequencing results to obtain the recombinant plasmid pET-23a-PfAgo.

[0074] 2. Expression and identification of recombinant PfAgo expression vector

[0075] The constructed pET-23a-PfAgo expression vector was transformed into E.coli BL21-DE3 (pLysS) strain, and the expression was induced by 1.0mM IPTG at low temperature for 20h. The cells were collected, the bacteria were broken by ultrasound, and the supernatant was centrifuged and removed by 80℃ water bath. The supernatant was centrifuged again, filtered with a filter membrane, and added to the Ni column affinity chromatography purification column. After sealing, it was placed on a silent mixer and incubated at 4℃ for 1h. The PfAgo lysis buffer (containing 20mM Tris-hydrochloric acid pH=8.0, 200mM sodium chloride and 2mM manganese chloride) containing final concentrations of 10mM, 20mM, 50mM, 100mM, 200mM, and 300mM imidazole was used to elute and collect the target protein. After ultrafiltration and concentration, the protein concentration was measured to be 0.583mg / mL.

[0076] The gel electrophoresis of the expression product of the recombinant PfAgo expression vector is shown in Figure 1 shown. Figure 1M is protein marker, 1 is whole bacteria, 2 is supernatant of broken bacteria, 3 is flow-through, and 4 to 9 are 10mM, 20mM, 50mM, 100mM, 200mM and 300mM imidazole elutions, respectively. The results showed that after high temperature treatment, the PfAgo protein was clearly visible and consistent with the expected size of 90kDa. Ni column affinity chromatography purification showed that the target protein was well purified.

[0077] 3. Design and synthesis of amplification primer pairs

[0078] PCR primers were designed using Snap Gene software based on the sequence SEQ ID No: 23. The specific design principles adopted were: the Tm value of the PCR primers was 60°C and the GC content was between 40% and 60%. The sequence of the PCR primers for Lp-1 is as follows:

[0079] Fp-1: 5'-GCGTAGAGTACTATTCCCTG-3' (SEQ ID NO: 21);

[0080] Rp-1: 5'-TTCCGGCCTCGGCAG-3' (SEQ ID NO: 22);

[0081] 4. Construction of LMBV-mcp virus positive plasmid

[0082] The positive plasmid was obtained by transforming and screening the nucleic acid sequence shown in SEQ ID NO: 25 into the cloning vector pUC-19.

[0083] 5. PfAgo reaction buffer (10x): 200 mM HEPES (pH=8.0), 2.5 M sodium chloride and 20 mM manganese chloride, mix well.

[0084] 6. Sequence of molecular beacon:

[0085] 5'-FAM6-CCATCAGCACTGGCCACCA-BHQ1-3' (SEQ ID NO: 66).

[0086] Preparation Example 2

[0087] 1. Preliminary screening of gDNA and identification of endonuclease activity of PfAgo fusion protein

[0088] (1) Design of gDNA:

[0089] Please refer to Figure 2, design a complementary ssDNA (50 nt) covering the sequence to be detected as a simulated target sequence, specifically ttDNA-1 with a sequence as shown in SEQ ID NO: 1, and design a gDNA with a length of 16 nt every 4 bases of the target sequence, specifically g1 to 7 with sequences as shown in SEQ ID NO: 2 to 8;

[0090] Please refer to Figure 3 , design ssDNA (50nt) complementary to the simulated target sequence as the target sequence of the simulated gn cutting molecular beacon, specifically ttDNA-2 as shown in SEQ ID NO:9, design the corresponding gs according to the cutting site of gDNA, specifically gs1~7 as shown in SEQ ID NO:10~16 for gDNA screening.

[0091] (2) Test method:

[0092] A1. Synthesize g1-7 and their target DNA (ttDNA-1), and gs1-7 and their target DNA (ttDNA-2), respectively.

[0093] A2. Set up a reaction system: 10 pmol of the purified PfAgo protein obtained in Preparation Example 1, 10 pmol of the above-mentioned 5'-phosphorylated gDNA (specifically one of g1-7 and gs1-7), 10 pmol of the corresponding target DNA, 1 μL of 10×PfAgo reaction buffer, and add enzyme-free water to 10 μL; react the above reaction system at 95°C for 30 min.

[0094] A3. After the reaction, add 2×TBE-PAGE electrophoresis loading buffer, incubate at 95℃ for 5 minutes, perform 20% TBE-PAGE electrophoresis, and stain with super RED nucleic acid dye in the dark for 15 minutes to verify the enzyme cleavage.

[0095] (3) Test results

[0096] The TBE-PAGE electrophoresis results of g1-7 guiding PfAgo to cleave target DNA are shown in Figure 4 As shown, the results showed that g1, g2, g3, g4, and g6 had higher cleavage abilities for target DNA.

[0097] The TBE-PAGE electrophoresis results of gs1-7 guiding PfAgo to cleave the molecular beacon sequence are shown in Figure 5 As shown, the results showed that gs1-7 all had high cleavage abilities for the target sequence.

[0098] 2. Selection of PfAgo cleavage sites and determination of gDNA combinations

[0099] According to the above-mentioned results of g1-7 and gs1-7 cutting the corresponding target DNA, it is shown that the site 3 cut by g3 and gs3 and the site 6 cut by g6 and gs6 are theoretically suitable detection target sites, and two additional gDNAs are designed at each site, such as g3-1 shown in SEQ ID NO: 17, g3-2 shown in SEQ ID NO: 18, g6-1 shown in SEQ ID NO: 19, and g6-2 shown in SEQ ID NO: 20. Each site is set up with a reaction system in which the input gDNA is one gDNA (g3 or g6), the input gDNA is two gDNAs (g3, g3-1 or g6, g6-1), and the input gDNA is three gDNAs (g3, g3-1, g3-2 and / or g6, g6-1, g6-2), and the fluorescence intensity of each reaction system is detected after the reaction is completed.

[0100] Further, the above reaction system is:

[0101] 10 pmol of the purified PfAgo protein obtained in Preparation Example 1, 10 pmol of the above 5'-phosphorylated input gDNA, 1 uM of the target to be detected, 1 μL of 10×PfAgo reaction buffer, and enzyme-free water to 10 μL; the above reaction system was reacted at 95°C for 30 minutes. Then the fluorescence intensity was measured with a fluorescence photometer.

[0102] Test results such as Figure 6 and Figure 7 shown.

[0103] Figure 6 This is an analysis chart of the fluorescence intensity detection results of cutting site No. 3. The results show that the fluorescence intensity of cutting site No. 3 is low. At the same time, there is no obvious difference between the detection results of inputting 1 gDNA, inputting 2 gDNAs, inputting 3 gDNAs and the detection result of inputting 0 gDNA.

[0104] Figure 7 This is an analysis chart of the fluorescence intensity detection results of cutting site No. 6. The results show that the intensity of cutting site No. 6 is relatively high. At the same time, among the detection results of inputting 1 gDNA, 2 gDNAs, and 3 gDNAs, the detection results of inputting 2 gDNAs and 3 gDNAs are significantly different from the detection results of inputting 0 gDNA and 1 gDNA.

[0105] Therefore, it is preferred to use 2 input gDNAs or 3 input gDNAs for site 6.

[0106] In subsequent experiments, two input gDNAs (g6 and g6-1) from site 6 were used.

[0107] Example 1

[0108] This example is used to illustrate the PfAgo protein-mediated largemouth bass iridovirus nucleic acid detection kit and detection method thereof according to the present invention.

[0109] The kit comprises: the PfAgo protein obtained in Preparation Example 1, an amplification primer pair (Lp-1), gDNA (g6 and g6-1), and a molecular beacon.

[0110] The PfAgo protein-mediated LMBV virus nucleic acid detection method is implemented using the above-mentioned kit, and the method comprises the following steps:

[0111] (1) Use amplification primer pairs to amplify LMBV-mcp virus positive plasmid to obtain tDNA.

[0112] (2) Construct the reaction system: 10 pmol of purified PfAgo protein, 10 pmol of 5' phosphorylated gDNA (g6 and g6-1), 2 μL of PCR amplified product tDNA, 1 μL of 10×PfAgo reaction buffer, 10 pmol of molecular beacon, and add enzyme-free water to 10 μL; react the above reaction system at 95°C for 30 min.

[0113] (3) After the reaction is completed, the reaction system is subjected to fluorescence detection.

[0114] 1. Sensitivity detection

[0115] The LMBV-mcp positive plasmid synthesized in the above preparation example 1 was diluted to 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1×10 0 copy / μL, used as a sensitivity test.

[0116] According to the above reaction detection system, 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, 1×10 0The LMBV-mcp positive plasmid with a concentration of 1.5 copy / μL was used as a template, and water was used as a negative control. After PCR amplification, 2 μL of the amplified product was taken for PfAgo cleavage reaction, and the fluorescence values ​​of different positive plasmid concentrations were detected.

[0117] Figure 8 The agarose gel electrophoresis diagrams after PCR amplification of positive plasmid templates with different concentrations are shown in Figure 2. Fig. 9 This is an analysis chart of the fluorescence intensity detection results of PfAgo cutting after PCR amplification of positive plasmid templates with different concentrations. Figure 8-9 The results show that the detection sensitivity of the detection method provided by the present invention for LMBV virus can be as low as 1.0 copy / μL.

[0118] 2. Specificity detection

[0119] By sequence comparison, PCR primers were designed, including:

[0120] cyhv1-1 to cyhv1-4, specifically cyhv2-1 to cyhv2-4 as shown in SEQ ID NO: 30 to SEQ ID NO: 33, specifically cyhv3-1 to cyhv3-4 as shown in SEQ ID NO: 34 to SEQ ID NO: 37, specifically enhv-1 to enhv1-4 as shown in SEQ ID NO: 38 to SEQ ID NO: 41, specifically gcrv1-1 to gcrv1-4 as shown in SEQ ID NO: 42 to SEQ ID NO: 45, specifically isknv1-1 to isknv1-4 as shown in SEQ ID NO: 46 to SEQ ID NO: 49, specifically lycv1-1 to lycv1-4 as shown in SEQ ID NO: 50 to SEQ ID NO: 53, specifically mscv1-1 to mscv1-4 as shown in SEQ ID NO: 54 to SEQ ID NO: 57, specifically SEQ ID NO: 58 to SEQ ID nnv1-1 to nnv1-4 as shown in NO:61, and specifically sgrv1-1 to sgrv1-4 as shown in SEQ ID NO:62 to SEQ ID NO:65.

[0121] By overlapping PCR, fragments of 10 relatively common aquatic virus MCP sequences containing similar recognition target sites were amplified, and the fluorescence values ​​of different amplified products were detected according to the above reaction detection system. The test results are as follows Fig.10 shown.

[0122] Depend on Fig.10It can be seen that the detection method provided by the present invention is specific to the LMBV virus.

[0123] Example 2

[0124] The detection was carried out according to the method described in Example 1 to explore the detection results of setting different reaction conditions.

[0125] (1) PCR reaction systems with final primer concentrations of 2.5uM, 2uM, 1.5uM, 1uM, 0.5uM, and 0.25uM were set respectively. After PCR amplification, a cleavage reaction system was configured. After reacting at 95°C for 30 minutes, the fluorescence intensity of each reaction system was detected. The detection results were as follows: Fig.11 shown.

[0126] Fig.11 The results showed that a final primer concentration of 2.5uM was more conducive to the detection of LMBV virus.

[0127] (2) 10×PfAgo reaction buffer with manganese ion concentrations of 0 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM and 70 mM was prepared respectively to set up a cleavage reaction system. After reacting at 95°C for 30 min, the fluorescence intensity of each reaction system was detected. The detection results are shown in the figure. Fig.12 shown.

[0128] Fig.12 The results showed that when the final concentration of manganese ions in the reaction system was 2mM and 3mM respectively (ie, the concentration of 10×PfAgo reaction buffer was 20mM and 30mM), it was more conducive to the detection of LMBV virus.

[0129] (3) Set up a single input gDNA cleavage reaction system with a final concentration of 0uM, 0.4uM, 1uM, and 2uM, respectively. After reacting at 95°C for 30 min, the fluorescence intensity of each reaction system was detected. The test results are as follows: Fig.13 shown.

[0130] Fig.13 The results showed that when the final concentration of a single input gDNA was 1uM, it was more conducive to the detection of LMBV virus.

[0131] (4) Cleavage reaction systems with PfAgo protein concentrations of 0, 0.5uM, 1uM, 2uM, and 2.5uM were set up respectively. After reacting at 95°C for 30 min, the fluorescence intensity of each reaction system was detected. The detection results are as follows: Fig.14 shown.

[0132] Fig.14 The results showed that when the PfAgo protein concentration was 2uM and 2.5uM, it was more conducive to the detection of LMBV virus.

[0133] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A PfAgo protein-mediated largemouth bass iridovirus nucleic acid detection kit, characterized in that: The kit contains PfAgo protein, amplification primer pairs, gDNA, and molecular beacons; Wherein, the gDNA comprises g6 with a sequence as shown in SEQ ID NO:7 and g6-1 with a sequence as shown in SEQ ID NO:19; The amplification primer pair is a primer pair with a sequence as shown in SEQ ID NOs: 21 to 22 or a primer pair as shown in SEQ ID NOs: 23 to 24; The sequence of the molecular beacon is shown in SEQ ID NO:

66.

2. The kit according to claim 1, characterized in that The molecular beacon carries a fluorescent group and a quenching group.

3. A PfAgo protein-mediated LMBV virus nucleic acid detection method, characterized in that: The method comprises the following steps: (1) amplifying the sample to be tested using the primer pair shown in SEQ ID NOs: 21-22 or the primer pair shown in SEQ ID NOs: 23-24 to obtain tDNA; (2) constructing a reaction system comprising 5'-phosphorylated gDNA, PfAgo protein, the tDNA, PfAgo reaction buffer and molecular beacon, and then performing a cleavage reaction; (3) After the reaction is completed, fluorescence detection is performed on the reaction system; The gDNA comprises g6 with a sequence as shown in SEQ ID NO:7 and g6-1 with a sequence as shown in SEQ ID NO:19; The sequence of the molecular beacon is shown in SEQ ID NO:

66.

4. The method according to claim 3, characterized in that The PfAgo reaction buffer contained HEPES, sodium chloride and manganese chloride.

5. The method according to claim 3 or 4, characterized in that: In the reaction system, 10×PfAgo reaction buffer is used, wherein the PfAgo reaction buffer contains: 150-250 mM HEPES, 2-3 M sodium chloride and 20-30 mM manganese chloride.

6. The method according to claim 5, characterized in that In the PfAgo reaction buffer, the pH of HEPES is 7.5-8.

5.

7. The method according to claim 3, characterized in that In step (2), the conditions for the cleavage reaction include: a temperature of 93 to 98° C. and a time of 20 to 40 minutes.

8. Use of the kit according to claim 1 or 2 in identifying or assisting in identifying LMBV virus.

Images