A frog iris virus attenuated vaccine strain and its application

Abstract

The present invention belongs to the field of microbial technology, and discloses a frog iris virus attenuated vaccine strain and application. The natural attenuated strain of largemouth black bass frog iris virus LMBV‑2007136 of the present invention has a deposit number of CCTCCNO: V202434, and its Latin name is classified as Ranarivus sp., which was deposited in the China Center for Type Culture Collection on March 26, 2024, and the deposit address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The results of safety and effectiveness experiments found that the attenuated vaccine made from the attenuated strain LMBV‑2007136 has good safety for largemouth black bass, and 100% immune protection effect can be obtained by intramuscular injection or immersion immunization, which can be used for the immune prevention and treatment of largemouth black bass frog iris virus disease.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and in particular to a frog iris virus attenuated vaccine strain and application thereof. Background Art

[0002] Frog iridovirus belongs to the family Iridoviridae and the genus Ranavirus. Frog iridovirus was first isolated from frogs in the United States. So far, it has been isolated and found in a variety of hosts such as amphibians, reptiles, fish and shrimp. Among them, the largemouth bass frog iridovirus (LMBV) that causes serious mortality to largemouth bass has been reported in various parts of my country and has caused serious economic losses to the bass farming industry. LMBV is a type of icosahedral virus with an envelope structure. The diameter of the virus particle is about 150nm to 170nm. The genome consists of double-stranded linear molecules of DNA, with a length of about 90kb to 100kb and a GC content of 49% to 57%. At present, there is no effective drug for this virus, and vaccination is the most effective means to prevent and treat the disease. Therefore, screening the attenuated strain of frog iridovirus to prepare an attenuated vaccine is of great significance for the immune prevention and treatment of largemouth bass frog iridovirus disease. Summary of the invention

[0003] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a frog iris virus attenuated vaccine strain and application.

[0004] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0005] In the first aspect, the present invention selects 19 LMBV strains from the virus library, and screens out a natural weak strain through fish challenge and immune test, named as largemouth bass frog iris virus LMBV-2007136. Its deposit number is CCTCC NO: V202434, and its Latin name is named Ranarivus sp., which was deposited in the China Center for Type Culture Collection on March 26, 2024, and the deposit address is Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, China.

[0006] The safety and effectiveness evaluation of the attenuated strain LMBV-2007136 in the present invention shows that the attenuated strain has good safety and immune protection effects on largemouth bass and can be used as a candidate strain for LMBV vaccine.

[0007] In a second aspect, the present invention provides a frog iridescent virus vaccine, comprising the frog iridescent virus attenuated vaccine strain.

[0008] As a preferred embodiment of the frog iridescent virus vaccine of the present invention, the vaccine is a live vaccine.

[0009] As a preferred embodiment of the frog iridescent virus vaccine of the present invention, the vaccine is used for intramuscular injection immunization or immersion immunization.

[0010] As a preferred embodiment of the frog iridescent virus vaccine of the present invention, the immune concentration of the vaccine is 10 2 TCID 50 / mL~10 4 TCID 50 / mL.

[0011] In a third aspect, the present invention provides a preparation for preventing and treating frog iridescence virus disease, comprising the attenuated vaccine strain of frog iridescence virus.

[0012] In a fourth aspect, the present invention uses the attenuated vaccine strain of frog iris virus in the preparation of a preparation for preventing and / or treating frog iris virus disease.

[0013] As a preferred embodiment of the use of the present invention, the preparation is suitable for fish.

[0014] Furthermore, the fish includes largemouth bass.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] A weak strain LMBV-2007136 was screened out from the 19 strains of LMBV virus selected by the present invention. The safety and effectiveness experimental results showed that the attenuated vaccine made from the weak strain LMBV-2007136 had good safety for largemouth black bass, and a 100% immune protection effect could be obtained by intramuscular injection or immersion immunization. The vaccine can be used for the immune prevention and treatment of largemouth black bass frog iridovirus disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The survival rate of largemouth bass infected with 19 LMBV strains.

[0018] Figure 2 This paper compares the immunogenicity of two attenuated strains against largemouth bass.

[0019] Figure 3 These are the results of the safe concentration determination experiment for the LMBV-2007136 weak strain.

[0020] Figure 4 These are the results of the safety experiment on overdose vaccination of LMBV-2007136 attenuated vaccine.

[0021] Figure 5 These are the results of the virulence reversion experiment for the LMBV-2007136 strain.

[0022] Figure 6The survival rate of largemouth bass immunized with LMBV-2007136 attenuated vaccine and then attacked with virulent vaccine;

[0023] Figure 6 Figures a and b show the changes in survival rate after strong toxin attack by intramuscular injection and immersion immunization.

[0024] Figure 7 The changes in survival rate of largemouth bass after being immunized with LMBV-2007136 attenuated vaccine and attacked with strong virus. DETAILED DESCRIPTION

[0025] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0026] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0027] Example 1: Screening of weak strains

[0028] The mandarin fish brain tissue cell line (CPB) was established by the Aquatic Disease and Immunity Research Laboratory of the Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences (reference: X. Fu, Q. Lin, L. Liu, H. Liang, Z. Huang, N. Li, The pathogenicity and biological features of Santee-Cooper Ranaviruses isolated from Chinese perchand snakehead fish, Microb Pathogenesis. 112 (2017) 269-273.). CPB was propagated in L-15 medium (GIBCO, USA) containing 8% fetal bovine serum (FBS) and cultured at 28°C.

[0029] 19 LMBV strains were selected from the virus library collected by the Aquatic Disease and Immunity Laboratory of the Pearl River Fisheries Research Institute of the Chinese Academy of Fishery Sciences. The 19 LMBV strains used were numbered: LMBV-MSRIV171028, LMBV-2007128, LMBV-2007105, LMBV-2007033, LMBV-2006124, LMBV-2007074, LMBV-20061110, LMBV-2005291, LMBV-20062802, LMBV-2007136, LMBV-21051501, LMBV-19110556, LMBV-2006305, LMBV-2006064, LMBV-21072703, LMBV-2006135, LMBV-2006032, LMBV-20092904, LMBV-2005232. These viruses can infect CPB at 28°C, and the virus storage condition is -80°C.

[0030] (1) Virus titer and copy number determination

[0031] The 19 LMBV strains were revived at -80°C and the virus titer was determined by the cytopathic effect (CPE) method. CPB in the logarithmic growth phase was inoculated into a 96-well plate at 100 μL / well. After the cells attached to the wall and formed a uniform monolayer, the virus was inoculated; the virus titer was diluted to 10 -3 ~10 -13 , 100 μL / well, 1 dilution per column, 11 columns in total, and the remaining column was added with culture medium as a blank control; after the reading was completed, the culture plate was placed in a 28°C incubator for 1 hour, and then L-15 medium with 2% FBS was added; after the addition, it was returned to the incubator, and the cell lesions were observed and recorded under a microscope every day for 10 consecutive days. The virus titer was calculated by the Reed-Muench method, and the results were expressed as the 50% infectious dose per milliliter of cell culture (TCID 50 / ml).

[0032] The number of viral copies was determined by fluorescence quantitative PCR. 200 μL of virus solution or tissue grinding solution was used to extract DNA, and the extracted DNA was amplified in a fluorescence quantitative PCR instrument, with 3 replicates for each virus. Reaction system: 2×Pro Taq HS Probe Premix 10 μL, 0.5 μL each of upstream and downstream primers, probes and ROX, 2 μL of DNA template, 6 μL of ddH2O, and a total system of 20 μL. Reaction conditions: 95°C 30s, 1 cycle; 95°C 5s, 60°C 34s, 40 cycles.

[0033] Table 1. Primer and probe sequences used for fluorescence quantitative PCR

[0034] Primer Sequence(5'-3') LMBV-F TCAGGGTCTACCAATTTC LMBV-R GATGCGGATAATGTTGTG LMBV-Probe CCTGACCAACGCAAGCATCAA

[0035] The titer test results of 19 LMBV strains are as follows:

[0036] The titers of 19 LMBV strains were determined by CPE method, and the virus titers were calculated by Reed-Muench method. The results were expressed as 1g (TCID 50 / mL) and the results are shown in Table 2.

[0037] Table 2. Titers of 19 LMBV strains determined by CPE method

[0038] Viruses <![CDATA[lg(TCID 50 / mL)]]> Viruses <![CDATA[lg(TCID 50 / mL)]]> Viruses <![CDATA[lg(TCID 50 / mL)]]> MSRIV171028 9 2005291 8.5 2006064 8 2007128 9 20062802 8.5 21072703 7.67 2007105 9 2007136 8.33 2006135 7.64 2007033 8.9 21051501 8 2006032 7.58 2006124 8.75 1911056 8 20092904 7.5 2007074 8.57 2006305 8 2005232 5.75 20061110 8.5 - - - -

[0039] (2) Fish experiments with 19 LMBV strains

[0040] According to the titers of 19 LMBV strains determined by cytopathic assay, the 19 LMBV strains were diluted to 10 3 TCID 50 / mL, the immersion method was used for the poisoning test, with 20 fish in each group. The control group was immersed in clean water and maintained at 27℃. The fish were observed for 14 consecutive days, the mortality of the fish was recorded, and the survival rate was calculated.

[0041] The immersion method was used for 10 3 TCID 50 The largemouth bass were infected with a concentration of / mL and observed for 14 consecutive days. The mortality was recorded every day and the survival rate was calculated. Figure 1 As shown, the survival rates of LMBV-20062802 and LMBV-2007136 were the highest, both 100%, while the survival rates of LMBV-2007128, LMBV-2006064 and LMBV-2007074 were the lowest, both 20%. Therefore, the virulence of LMBV-20062802 and LMBV-2007136 is relatively weak, and can be used for subsequent screening of weak strains. The LMBV-2007128 strain was selected as a strong strain.

[0042] (3) Verification of immune protection of two attenuated strains

[0043] Based on the above fish experiments, the screened attenuated strains LMBV-20062802 and LMBV-2007136 were used for immunization experiments. The immersion immunization concentration was 10 3 TCID 50 / mL, 30 in each group, the control group was immersed in clean water, maintained at 27℃, and observed for 21 days. 100μL 10 3 TCID 50 / mL of the strong strain LMBV-2007128 was observed for 14 consecutive days to verify the immune protection effect of the two weak strains and select the optimal weak strain.

[0044] The two weak strains were divided into 10 3 TCID 50 / mL concentration, and then challenged with the highly virulent LMBV-2007128 21 days after immunization, and observed for 14 consecutive days. Figure 2 As shown, the control group began to die on the 6th day and stopped dying on the 12th day, with a survival rate of 10%; the LMBV-20062802 group began to die on the 5th day and stopped dying on the 7th day, with a cumulative death of 2, a survival rate of 90%, and an RPS of 88.9%, while the LMBV-2007136 group did not die throughout the whole process, with a survival rate and RPS of 100%. This shows that the immunogenicity of the LMBV-2007136 strain is better than that of the LMBV-20062802 strain, so the LMBV-2007136 strain is used as a candidate strain for the LMBV attenuated vaccine.

[0045] Example 2: Safety evaluation of the attenuated strain LMBV-2007136

[0046] (1) Safe concentration range of attenuated vaccines

[0047] The largemouth bass were divided into 6 groups, 30 in each group. The experimental groups were immunized by immersion, with the immunization concentrations of 10 6 TCID 50 / mL, 10 5 TCID 50 / mL, 10 4 TCID 50 / mL, 10 3 TCID 50 / mL, 10 2 TCID 50 / mL, and the control group was immersed in clean water. The animals were observed for 14 consecutive days, and the deaths and abnormalities of each group were recorded, the survival rate was calculated, and the safe concentration range of the attenuated strain of LMBV-2007136 was determined.

[0048] The largemouth bass were infected with different concentrations of the attenuated strain of LMBV-2007136 and observed for 14 consecutive days to calculate the survival rate. The results showed that ( Figure 3 ), divided by 10 6 TCID 50 / mL and 10 5 TCID 50 / mL group began to die on the 2nd and 6th day, with survival rates of 40% and 83.3%, respectively; 4 TCID 50There was no death in the 10 / mL group and the concentration groups below. According to the results, the maximum safe concentration of LMBV-2007136 strain is 10 4 TCID 50 / mL, the minimum immune concentration is 10 2 TCID 50 / mL, so 10 2 TCID 50 / mL concentration immersion immunization was used for subsequent experiments.

[0049] (2) Safety of overdose vaccination

[0050] The largemouth bass were divided into 4 groups, 30 in each group. The 3 experimental groups were infected with the weak strain of LMBV-2007136 at concentrations of 10 4 TCID 50 / mL, 10 3 TCID 50 / mL, 10 2 TCID 50 / mL, and the control group was immersed in clean water. The fish were observed for 14 consecutive days, and the abnormalities and deaths of the fish were recorded, and the survival rate was calculated.

[0051] 10 4 TCID 50 / mL, 10 3 TCID 50 / mL, 10 2 TCID 50 / mL concentration to immerse and infect largemouth bass. The results showed that ( Figure 4 ), there was no death in the three experimental groups, and the survival rate was 100%. The results showed that the LMBV-2007136 attenuated vaccine was still safe under the condition of 100 times the dosage. Therefore, the LMBV-2007136 attenuated strain has safety reliability.

[0052] (3) Virulence becomes stronger

[0053] The largemouth bass were divided into 6 groups, 5 experimental groups (No. 1-5) and 1 control group, with 15 fish in each group. The control group was injected with 100 μL PBS intramuscularly; the No. 1 group was immersed in LMBV-2007136 at a concentration of 10 3 TCID 50 / mL. 96h after infection, 3 fish were randomly selected to collect liver, spleen and kidney to make tissue toxin, which was diluted 10 times and injected intramuscularly to infect experimental group 2, 100μL per fish. Similarly, 3 fish were randomly selected to collect liver, spleen and kidney tissue to make tissue toxin 10 times after 96h, which was injected intramuscularly to experimental group 3, 100μL per fish, and so on to experimental group 5. The remaining fish were observed for 21 consecutive days. A certain amount of tissue grinding fluid was reserved for qPCR and nucleic acid electrophoresis each time the tissue toxin was prepared.

[0054] After infecting largemouth bass with the attenuated strain of LMBV-2007136, the liver, spleen and kidney were collected to make tissue toxins. Four consecutive blind tests were conducted on largemouth bass to verify whether the attenuated strain of LMBV-2007136 would revert to a stronger virulence. The results showed that there were no abnormalities or deaths in the five groups of largemouth bass infected with LMBV-2007136 and the control group during the observation period ( Figure 5 a); The nucleic acid electrophoresis diagram showed that LMBV-2007136 was only detected in group 1, and no virus was detected in the other groups ( Figure 5 b). This indicates that LMBV-2007136 will not revert to virulence after passage through fish.

[0055] Example 3: Effectiveness evaluation of the attenuated strain LMBV-2007136

[0056] (1) Evaluation of the immune efficacy of different immunization methods

[0057] The largemouth bass were divided into two groups, 30 in each group. The experimental group was immunized by intramuscular injection at a concentration of 10 2 TCID 50 / mL, and the control group was injected intramuscularly with 100μL PBS. 21 days after immunization, 100μL of virulent LMBV-2007128 was injected intramuscularly with a concentration of 10 3 TCID 50 / mL, and then observe for 14 days, record the abnormalities and deaths of the fish, and calculate the relative immune protection rate RPS.

[0058] The immersion immunization method is to soak the largemouth bass in 8L of immunization concentration of 10 2 TCID 50 / mL virus solution, and the control was immersed in clean water for 30 minutes and then transferred to the prepared 25L water tank. The rest of the steps were the same as above.

[0059] The largemouth bass were immunized by intramuscular injection and immersion, respectively. After 21 days of immunization, they were challenged with the highly virulent LMBV-2007128 and observed for 14 days. The RPS was calculated. Figure 6As shown, the intramuscular injection experimental group did not die after the strong poison attack, while the intramuscular injection control group began to die on the 3rd day and stopped dying on the 8th day, with a total of 27 deaths and a survival rate of 10%. Therefore, the RPS of the intramuscular injection experimental group was 100%; the immersion experimental group did not die after the strong poison attack, while the immersion control group began to die on the 4th day and stopped dying on the 8th day, with a total of 27 deaths and a survival rate of 10%. Therefore, the RPS of the immersion experimental group was 100%. In summary, whether it is intramuscular injection immunization or immersion immunization, the LMBV-2007136 weak strain can provide good immune protection.

[0060] (2) Evaluation of immune efficacy at different immune concentrations

[0061] The largemouth bass were divided into 4 groups, 30 in each group. The immune concentrations of the three experimental groups were 10 4 TCID 50 / mL, 10 3 TCID 50 / mL, 10 2 TCID 50 / mL, and the control group was immersed in clean water. 21 days after immunization, 100 μL of virulent LMBV-2007128 was injected intramuscularly at a concentration of 10 3 TCID 50 / mL, observe for 14 consecutive days, record fish abnormalities and deaths, and calculate the relative immune protection rate RPS.

[0062] 10 4 TCID 50 / mL, 10 3 TCID 50 / mL, 10 2 TCID 50 / mL LMBV-2007136 attenuated vaccine concentration was used to immunize largemouth bass by immersion. After 21 days of immunization, the virulent LMBV-2007128 was challenged and observed for 14 days to calculate RPS. The results are shown in the figure. No death occurred in the three experimental groups after the virulent attack. The control group began to die on the third day after the virulent attack and stopped dying on the eighth day. A total of 28 fish died, and the survival rate was 6.67%. Therefore, the RPS of the three experimental groups was 100% ( Figure 7 ). Therefore, within the safe concentration range, the LMBV-2007136 weak strain can provide good immune protection.

[0063] The present invention names the attenuated strain LMBV-2007136 as the largemouth bass frog iris virus LMBV-2007136 attenuated strain (2007136 strain), and its Latin name is classified as Ranarivus sp., which was deposited in the China Center for Type Culture Collection on March 26, 2024, with a deposit number of CCTCC NO: V202434, and the deposit address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, China.

[0064] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A frog iris virus attenuated vaccine strain, characterized in that: Its deposit number is CCTCC NO: V202434.

2. A frog iris virus vaccine, characterized in that: It includes the attenuated vaccine strain of frog iris virus as described in claim 1.

3. The frog iridescent virus vaccine according to claim 2, characterized in that: The vaccine is a live vaccine.

4. The frog iridescent virus vaccine according to claim 2, characterized in that: The vaccine is used for intramuscular injection immunization or immersion immunization.

5. The frog iridescent virus vaccine according to claim 2, characterized in that: The immune concentration of the vaccine is 10 2 TCID 50 / mL~10 4 TCID 50 / mL.

6. A preparation for preventing and treating frog iris virus disease, characterized in that: The invention comprises the attenuated vaccine strain of frog iris virus as claimed in claim 1.

7. Use of the attenuated vaccine strain of frog iris virus according to claim 1 in the preparation of a preparation for preventing and / or treating frog iris virus disease.

8. The use according to claim 7, characterized in that: The preparation is suitable for fish.

9. The use according to claim 8, characterized in that: The fish include largemouth bass.

Images