Natural killer (NK) cell conjugates with Fc engineering binding to NKp46 and BCMA variants

Abstract

The present disclosure relates to multifunctional binding proteins comprising a first antigen binding domain and a second antigen binding domain (ABD) and all or part of an immunoglobulin Fc region or variant thereof wherein the first ABD specifically binds to human BCMA and the second ABD specifically binds to human NKp46, and wherein all or part of the immunoglobulin Fc region or variant thereof binds to the human Fc-gamma receptor. The disclosure also relates to methods for preparing the binding proteins, compositions of the binding proteins and uses thereof, including the treatment or prevention of proliferative disorders, including multiple myeloma (MM).

Description

Background Art

[0001] B cell maturation antigen (BCMA), expressed on mature B cells and B cell-derived tumor cells, has been implicated in the progression of several B cell cancers (e.g., multiple myeloma) and B cell diseases or disorders (e.g., light chain amyloidosis or LCA). Therefore, BCMA is an attractive target for anti-B cell cancer therapies as well as therapies for B cell-related diseases or disorders. Nevertheless, many existing BCMA-targeted therapies (such as anti-CD3xBCMA T cell engagers) cause strong toxicity issues, such as excessive pro-inflammatory cytokine release.

[0002] Natural killer (NK) cells are a subset of lymphocytes involved in innate immunity. NK cells provide an effective immune surveillance mechanism by which unwanted cells, such as tumors or virus-infected cells, are eliminated. Characteristics and biological properties of NK cells include the expression of surface antigens (including CD16, CD56, and / or CD57); the absence of α / β or γ / δ TCR complexes on the cell surface; the ability to bind and kill cells (particularly those that do not express "self" MHC / HLA antigens) in an MHC-unrestricted manner by activating specific lytic enzymes; the ability to kill tumor cells or other diseased cells that express ligands for NK activating receptors; and the ability to release protein molecules (called cytokines) that stimulate immune responses. Interest in natural killer (NK) cells continues to grow due to their potential anti-tumor properties.

[0003] There is a need in the art for effective anti-BCMA therapies with a manageable safety profile. The anti-BCMA x NKp46 binding proteins claimed in the present invention provide this need. Summary of the invention

[0004] The present disclosure relates to a multifunctional binding protein comprising a first antigen binding domain and a second antigen binding domain (ABD) and all or part of an immunoglobulin Fc region or a variant thereof, wherein the first ABD specifically binds to human BCMA and the second ABD specifically binds to human NKp46, and wherein all or part of the immunoglobulin Fc region or a variant thereof binds to a human Fc-γ receptor. In particular, the disclosed NKp46-BCMA conjugate has extensive Fc engineering that enhances ADCC activity (via CD16 (FcγRIIIa) bound to the constant region (Fc) of the antibody) and / or serum half-life.

[0005] The disclosed NKp46-BCMA engagers show strong potency through dual NK engagement with NKp46 and CD16, with a good safety profile (minimal pro-inflammatory cytokine release compared to T cell engager (TCE) approaches) and a long serum half-life.

[0006] The present disclosure also relates to methods for preparing the binding proteins, compositions of the binding proteins, and uses thereof.

[0007] In one aspect, the disclosure provides a binding protein comprising a first antigen binding domain (ABD) having binding specificity for BCMA and a second ABD having binding specificity for NKp46, wherein:

[0008] (a) the first ABD comprises: (a1) a first immunoglobulin heavy chain variable domain (VH1), the first immunoglobulin heavy chain variable domain comprising a HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), a HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and a HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); and (a2) a first immunoglobulin light chain variable domain (VL1), the first immunoglobulin light chain variable domain comprising a CX 1 SSTGX 2 VTPX 3 X 4 The LCDR1 sequence of the amino acid sequence of YAN (SEQ ID NO: 4), wherein X 1 is R or A, X 2 It is T or A, X 3 is S or G, and X 4 Is N or Y; contains DNNX 5 X 6 The LCDR2 sequence of the amino acid sequence of PP (SEQ ID NO: 5), wherein X 5 is S, I or N and X 6 is R or K; and contains ALX 7 X 8 GX 9 The LCDR3 sequence of the amino acid sequence of QWV (SEQ ID NO: 6), wherein X 7 W or Y, X 8 is F or Y, and X 9 is N or G; and

[0009] (b) The second ABD has binding specificity for NKp46.

[0010] In certain embodiments, (b) the second ABD comprises:

[0011] (b1) a second immunoglobulin heavy chain variable domain (VH2), the second immunoglobulin heavy chain variable domain comprising:

[0012] - a HCDR1 sequence containing DYVIN, a HCDR2 sequence containing EIYPGSGTNYYNEKFKA, and a HCDR3 sequence containing RGRYGLYAMDY; - a HCDR1 sequence containing GYTFSDYVIN (SEQ ID NO: 19), a HCDR2 sequence containing EIYPGSGTN (SEQ ID NO: 20), and a HCDR3 sequence containing RGRYGLYAMDY (SEQ ID NO: 21); - a HCDR1 sequence containing SDYAWN (SEQ ID NO: 22), a HCDR2 sequence containing YITYSGSTSYNPSLES (SEQ ID NO: 23), and a HCDR3 sequence containing GGYYGSSWGVFAY (SEQ ID NO: 24); - a HCDR1 sequence containing EYTMH (SEQ ID NO: 25), a HCDR2 sequence containing GISPNIGGTSYNQKFKG (SEQ ID NO: 26), and a HCDR3 sequence containing RGGSFDY (SEQ ID NO: 27). NO:27); - a HCDR1 sequence containing SFTMH (SEQ ID NO:28), a HCDR2 sequence containing YINPSSGYTEYNQKFKD (SEQ ID NO:29), and a HCDR3 sequence containing GSSRGFDY (SEQ ID NO:30); or - a HCDR1 sequence containing SDYAWN (SEQ ID NO:31), a HCDR2 sequence containing YITYSGSTNYNPSLKS (SEQ ID NO:32), and a HCDR3 sequence containing CWDYALYAMDC (SEQ ID NO:33); and

[0013] (b2) a second immunoglobulin light chain variable domain (VL2), the second immunoglobulin light chain variable domain comprising:

[0014] - a LCDR1 sequence containing RASQDISNYLN (SEQ ID NO: 34), a LCDR2 sequence containing YTSRLHS (SEQ ID NO: 35), and a LCDR3 sequence containing QQGNTRPWT (SEQ ID NO: 36); - a LCDR1 sequence containing RVSENIYSYLA (SEQ ID NO: 37), a LCDR2 sequence containing NAKTLAE (SEQ ID NO: 38), and a LCDR3 sequence containing QHHYGTPWT (SEQ ID NO: 39); - a LCDR1 sequence containing RASQSISDYLH (SEQ ID NO: 40), a LCDR2 sequence containing YASQSIS (SEQ ID NO: 41), and a LCDR3 sequence containing QNGHSFPLT (SEQ ID NO: 42); - a LCDR1 sequence containing RASENIYSNLA (SEQ ID NO: 43), a LCDR2 sequence containing AATNLAD (SEQ ID NO: 44), and a LCDR3 sequence containing QHFWGTPRT (SEQ ID NO: 45); or a LCDR1 sequence comprising RTSENIYSYLA (SEQ ID NO:46), a LCDR2 sequence comprising NAKTLAE (SEQ ID NO:47), and a LCDR3 sequence comprising QHHYDTPLT (SEQ ID NO:48).

[0015] In certain embodiments, the VL1 comprises: - a LCDR1 sequence comprising the amino acid sequence of CASSTGTVTPSNYAN (SEQ ID NO: 7), a LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 8), and a LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 9); - a LCDR1 sequence comprising the amino acid sequence of CRSSTGTVTPSNYAN (SEQ ID NO: 10), a LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 11), and a LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 12); - a LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPSNYAN (SEQ ID NO: 13), a LCDR2 sequence comprising the amino acid sequence of DNNIKPP (SEQ ID NO: 14), and a LCDR3 sequence comprising the amino acid sequence of ALWYGGQWV (SEQ ID NO: 15); or - a LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPSNYAN (SEQ ID NO: 16), a LCDR2 sequence comprising the amino acid sequence of DNNIKPP (SEQ ID NO: 17), and a LCDR3 sequence comprising the amino acid sequence of ALWYGGQWV (SEQ ID NO: 18). The LCDR1 sequence comprises the amino acid sequence of DNNNKPP (SEQ ID NO: 16), the LCDR2 sequence comprises the amino acid sequence of DNNNKPP (SEQ ID NO: 17), and the LCDR3 sequence comprises the amino acid sequence of ALYYGGQWV (SEQ ID NO: 18).

[0016] In certain embodiments, - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 55; - ​​the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 50; - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 51; - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 52; - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: NO:53; or - the VH1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO:54.

[0017] In certain embodiments, - the VH1 comprises the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO:55; - ​​the VH1 comprises the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO:50; - the VH1 comprises the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO:51; - the VH1 comprises the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO:52; - the VH1 comprises the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO:53; or - the VH1 comprises the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO:54.

[0018] In certain embodiments, - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 56, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 64; - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 57, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 65; - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 58, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 66; - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 59, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 67; - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 60, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: NO:68; - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:61, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:69; - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:62, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:70; or - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:63, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:71.

[0019] In certain embodiments, - the VH2 comprises the amino acid sequence of SEQ ID NO: 56, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 64; - the VH2 comprises the amino acid sequence of SEQ ID NO: 57, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 65; - the VH2 comprises the amino acid sequence of SEQ ID NO: 58, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 66; - the VH2 comprises the amino acid sequence of SEQ ID NO: 59, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 67; - the VH2 comprises the amino acid sequence of SEQ ID NO: 60, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 68; - the VH2 comprises the amino acid sequence of SEQ ID NO: 61, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 69; - the VH2 comprises the amino acid sequence of SEQ ID NO: 62, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 70; or - the VH2 comprises the amino acid sequence of SEQ ID NO: NO:63, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO:71.

[0020] In certain embodiments, the binding protein further comprises all or part of an immunoglobulin Fc domain or a variant thereof. In certain embodiments, the Fc domain is an IgG1 Fc domain. In certain embodiments, the IgG1 Fc domain is a human IgG1 Fc domain. In certain embodiments, all or part of the immunoglobulin Fc domain or a variant thereof binds to a human Fc-γ receptor. In certain embodiments, all or part of the immunoglobulin Fc domain or a variant thereof binds to a human CD16A (FcγRIII) polypeptide.

[0021] In certain embodiments, the Fc domain comprises a native glycan at amino acid position 297 according to EU numbering.

[0022] In certain embodiments, the binding protein is N-glycosylated.

[0023] In certain embodiments, the Fc domain or variant thereof comprises a first Fc heavy chain and a second Fc heavy chain.

[0024] In certain embodiments, at least one Fc heavy chain comprises an engineered intrachain disulfide bond mediated by a pair of cysteines (C) that replace: (i) a leucine (L) at amino acid position 242 and a lysine (K) at amino acid position 334; or (ii) an arginine (R) at amino acid position 292 and a valine (V) at amino acid position 302; wherein the amino acid positions are numbered according to EU.

[0025] In certain embodiments, the first Fc heavy chain or the second Fc heavy chain comprises a cysteine ​​pair. In certain embodiments, the first Fc heavy chain and the second Fc heavy chain each comprise a cysteine ​​pair. In certain embodiments, the first Fc heavy chain and the second Fc heavy chain each comprise a L242C / K334C substitution. In certain embodiments, the first Fc heavy chain and the second Fc heavy chain each comprise a R292C / V302C substitution.

[0026] In certain embodiments, at least one Fc heavy chain comprises a substitution at amino acid position 332 according to EU numbering. In certain embodiments, the substitution at amino acid position 332 is glutamic acid (E).

[0027] In certain embodiments, at least one Fc heavy chain further comprises one or more substitutions at amino acid positions 236, 239, or 330 according to EU numbering. In certain embodiments, the substitution at amino acid position 236 is alanine (A). In certain embodiments, the substitution at amino acid position 239 is aspartic acid (D). In certain embodiments, the substitution at amino acid position 330 is leucine (L).

[0028] In certain embodiments, at least one Fc heavy chain further comprises an aspartic acid (D) at amino acid position 239 and a glutamic acid (E) at amino acid position 332 according to EU numbering. In certain embodiments, at least one Fc heavy chain further comprises an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid position 239, and a glutamic acid (E) at amino acid position 332 according to EU numbering. In certain embodiments, at least one Fc heavy chain further comprises an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid position 239, a leucine (L) at amino acid position 330, and a glutamic acid (E) at amino acid position 332 according to EU numbering.

[0029] In certain embodiments, the binding protein comprises at least two polypeptide chains that form at least two antigen binding sites, wherein at least one polypeptide chain comprises a structure represented by the following formula:

[0030] VL1-L1-VL2-L2-CL[I];

[0031] And at least one polypeptide chain comprises a structure represented by the following formula:

[0032] VH2-L3-VH1-L4-CH1[II];

[0033] in:

[0034] CL is the immunoglobulin light chain constant domain;

[0035] CH1 is an immunoglobulin CH1 heavy chain constant domain; and

[0036] L1, L2, L3 and L4 are amino acid linkers, wherein any one or more of L1, L2, L3 and L4 are optionally absent, and

[0037] wherein the polypeptide of Formula I and the polypeptide of Formula II form a crossover light chain-heavy chain pair.

[0038] In certain embodiments, the binding protein comprises three polypeptide chains forming two antigen binding sites, wherein one polypeptide chain comprises a structure represented by the following formula:

[0039] VL1-L1-VL2-L2-CL[I];

[0040] A polypeptide chain consists of the structure represented by the following formula:

[0041] VH2-L3-VH1-L4-CH1-hinge-CH2-CH3[III]; and

[0042] A polypeptide chain consists of the structure represented by the following formula:

[0043] Hinge-CH2-CH3[IV]

[0044] in:

[0045] CL is the immunoglobulin light chain constant domain;

[0046] CH1 is the immunoglobulin CH1 heavy chain constant domain;

[0047] CH2 is the immunoglobulin CH2 heavy chain constant domain;

[0048] CH3 is the immunoglobulin CH3 heavy chain constant domain;

[0049] The hinge is an immunoglobulin hinge region connecting the CH1 domain and the CH2 domain;

[0050] and

[0051] L1, L2, L3 and L4 are amino acid linkers, wherein any one or more of L1, L2, L3 and L4 are optionally absent, and

[0052] wherein the polypeptide of Formula I and the polypeptide of Formula II form a crossover light chain-heavy chain pair.

[0053] In certain embodiments, (a) L1, L2, L3 and L4 are each independently zero amino acids in length or comprise a sequence selected from the group consisting of GGGGSGGGGS, GGGGSGGGGSGGGGS (SEQ ID NO:82), S, RT, TKGPS (SEQID NO:83), GQPKAAP (SEQ ID NO:84) and GGSGSSGSGG (SEQ ID NO:85); or (b) L1, L2, L3 and L4 each independently comprise a sequence selected from the group consisting of GGGGSGGGGS, GGGGSGGGGSGGGGS, S, RT, TKGPS, GQPKAAP and GGSGSSGSGG.

[0054] In certain embodiments, L1 and L2 each comprise the amino acid sequence GGGGSGGGGS. In certain embodiments, L3 and L4 each are absent.

[0055] In certain embodiments, the binding protein comprises: (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO:72; (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO:73; and (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO:74.

[0056] In another aspect, the present disclosure provides a binding protein comprising a first antigen binding domain (ABD) having binding specificity to BCMA and a second ABD having binding specificity to NKp46, wherein: (a) the first ABD comprises a first immunoglobulin heavy chain variable domain (VH1) comprising an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO:49 and a first immunoglobulin light chain variable domain (VL1), the first immunoglobulin heavy chain variable domain comprising an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO:55; and (b) the second ABD comprises a second immunoglobulin heavy chain variable domain (VH2) and a second immunoglobulin light chain variable domain (VL2), the second immunoglobulin heavy chain variable domain comprising an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO:56, and the second immunoglobulin light chain variable domain comprising an amino acid sequence at least about 90% identical to the amino acid sequence of SEQ ID NO:64.

[0057] In certain embodiments, the VH1 comprises the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO:55; and the VH2 comprises the amino acid sequence of SEQ ID NO:56, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO:64.

[0058] In certain embodiments, the binding protein comprises: (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO:72; (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO:73; and (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO:74.

[0059] In another aspect, the present disclosure provides a binding protein comprising a first antigen binding domain (ABD) having binding specificity for BCMA and a second ABD having binding specificity for NKp46, wherein the binding protein comprises: (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72; (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73; and (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO: 74.

[0060] In certain embodiments, the binding proteins described above are used as medicaments.

[0061] In certain embodiments, the binding proteins described above are for use in a method of treating a disease or disorder.

[0062] In certain embodiments, the binding proteins described above are used in methods for treating or preventing cancer.

[0063] In certain embodiments, the binding proteins described above are used in methods for treating or preventing multiple myeloma.

[0064] In certain embodiments, the binding proteins described above are used in a method of treating or preventing light chain amyloidosis (LCA).

[0065] In another aspect, the present disclosure provides a pharmaceutical composition comprising the above-mentioned binding protein and a pharmaceutically acceptable carrier.

[0066] In another aspect, the present disclosure provides a method for treating or preventing cancer, comprising administering the above-mentioned pharmaceutical composition to a subject in need of such treatment or prevention.

[0067] In another aspect, the present disclosure provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding the above-mentioned binding protein.

[0068] In another aspect, the present disclosure provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a first polypeptide chain comprising the amino acid sequence of SEQ ID NO:72.

[0069] In another aspect, the disclosure provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a second polypeptide chain comprising the amino acid sequence of SEQ ID NO:73.

[0070] In another aspect, the disclosure provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a third polypeptide chain comprising the amino acid sequence of SEQ ID NO:74.

[0071] In another aspect, the present disclosure provides an expression vector comprising the above-mentioned nucleic acid molecule.

[0072] In another aspect, the disclosure provides an isolated cell comprising the above-mentioned nucleic acid molecule.

[0073] In another aspect, the disclosure provides an isolated cell comprising the above-described expression vector. In certain embodiments, the cell is a mammalian cell.

[0074] In another aspect, the disclosure provides a method for preparing the binding protein, the method comprising culturing the isolated cell under suitable conditions and recovering the binding protein.

[0075] On the other hand, the present disclosure provides a method for preparing the above-mentioned binding protein, which comprises the following steps: (a) culturing one or more host cells under conditions suitable for expressing multiple recombinant polypeptides, wherein the multiple recombinant polypeptides include (i) a polypeptide containing the amino acid sequence of SEQ ID NO: 72, and (ii) a polypeptide containing the amino acid sequence of SEQ ID NO: 73, and (iii) a polypeptide containing the amino acid sequence of SEQ ID NO: 74; (b) optionally recovering the expressed recombinant polypeptides.

[0076] In another aspect, the present disclosure provides a binding protein produced by the above preparation method. In another aspect, the present disclosure provides a method for treating or preventing a disease or disorder, the method comprising administering the above pharmaceutical composition to a subject in need thereof.

[0077] In another aspect, the present disclosure provides a method for treating or preventing cancer, comprising administering the above-mentioned pharmaceutical composition to a subject in need thereof.

[0078] In another aspect, the present disclosure provides a method for treating or preventing multiple myeloma, comprising administering the above-mentioned pharmaceutical composition to a subject in need thereof. In certain embodiments, the multiple myeloma is relapsed multiple myeloma. In certain embodiments, the multiple myeloma is refractory multiple myeloma. In certain embodiments, the multiple myeloma is smoldering multiple myeloma.

[0079] In another aspect, the present disclosure provides a method for treating or preventing light chain amyloidosis (LCA), the method comprising administering the above-mentioned pharmaceutical composition to a subject in need thereof. In certain embodiments, the LCA is recurrent LCA. In certain embodiments, the LCA is refractory LCA.

[0080] In another aspect, the present disclosure provides a method of restoring or enhancing the activity of cells expressing NKp46 in a patient in need thereof, the method comprising administering to the patient the above-described pharmaceutical composition.

[0081] In another aspect, the present disclosure provides a method of eliminating cancer cells in a patient in need thereof, the method comprising administering to the patient the above-described pharmaceutical composition.

[0082] In another aspect, the present disclosure provides a method of triggering or increasing NK cell-mediated lysis of cancer cells in a patient in need thereof, the method comprising administering to the patient the pharmaceutical composition described above. In certain embodiments, the cancer cells express BCMA.

[0083] In another aspect, the present disclosure provides a method of inducing NK cells to eliminate cancer cells in a patient in need thereof, the method comprising administering the above-mentioned pharmaceutical composition to the patient.

[0084] In another aspect, the disclosure provides a binding protein comprising a first antigen binding domain (ABD) having binding specificity for BCMA and a second ABD having binding specificity for NKp46.

[0085] In certain embodiments, the binding protein further comprises all or part of an immunoglobulin Fc domain or a variant thereof, optionally wherein: all or part of the immunoglobulin Fc domain or a variant thereof binds to a human Fc-γ receptor; all or part of the immunoglobulin Fc domain or a variant thereof binds to a human CD16a (FcγRIIIa) polypeptide; the Fc domain comprises a native glycan at amino acid position 297 according to EU numbering; and / or the binding protein is N-glycosylated.

[0086] In certain embodiments, the Fc domain or variant thereof comprises a first Fc heavy chain and a second Fc heavy chain. In certain embodiments, at least one Fc heavy chain comprises an engineered intrachain disulfide bond mediated by a pair of cysteines (C) that replace: (i) a leucine (L) at amino acid position 242 and a lysine (K) at amino acid position 334; or (ii) an arginine (R) at amino acid position 292 and a valine (V) at amino acid position 302; wherein the amino acid positions are numbered according to EU.

[0087] In certain embodiments, the first Fc heavy chain and the second Fc heavy chain each comprise L242C / K334C substitutions. In certain embodiments, the first Fc heavy chain and the second Fc heavy chain each comprise R292C / V302C substitutions.

[0088] In certain embodiments, at least one Fc heavy chain comprises a substitution at amino acid position 332 according to EU numbering, optionally wherein the substitution at amino acid position 332 is glutamic acid (E); optionally further comprising at least one Fc heavy chain further comprising one or more substitutions at amino acid positions 236, 239 or 330 according to EU numbering, optionally wherein the substitution at amino acid position 236 is alanine (A), the substitution at amino acid position 239 is aspartic acid (D), and the substitution at amino acid position 330 is leucine (L).

[0089] In certain embodiments, at least one Fc heavy chain further comprises an aspartic acid (D) at amino acid position 239 and a glutamic acid (E) at amino acid position 332 according to EU numbering; at least one Fc heavy chain further comprises an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid position 239, and a glutamic acid (E) at amino acid position 332 according to EU numbering; or at least one Fc heavy chain further comprises an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid position 239, a leucine (L) at amino acid position 330, and a glutamic acid (E) at amino acid position 332 according to EU numbering. BRIEF DESCRIPTION OF THE DRAWINGS

[0090] The foregoing and other features and advantages of the present disclosure will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings.

[0091] Figure 1A-1B is a schematic diagram of the NKp46 multispecific NK cell engager (NKCE). Figure 1Ais a diagram of NKp46 NKCE, one arm of which binds to an antigen (e.g., BCMA) on the surface of a tumor cell and the other arm binds to the NKp46 receptor on a NK cell. The Fc domain of NKCE also binds to CD16 on NK cells. Figure 1B A distinct NKp46-BCMA NKCE format is described that engages BCMA on the surface of tumor cells while also recruiting NK cells through dual engagement of both NKp46 and the Fcγ receptor CD16a, inducing ADCC activity in an enhanced Fc-competent format. The enhanced Fc-active form (hereinafter referred to as "CODV-OL1-ADE-DSB") includes: (1) ADE mutations in CH2 (G236A / S239D / I332E) to enhance ADCC activity; (2) DSB in CH2 (R292C / V302C) for thermal stability and productivity (e.g., expression capacity and total yield in cells); (3) knob-hole structural mutations (KIH) in CH3 to facilitate heterodimer formation in Fc - (3a) knob (in the heavy chain containing VH / VL domains): S354C / T366W and (3b) hole (in the heavy chain lacking VH / VL domains): Y349C / T366S / L368A / Y407V; and (4) an RF mutation in CH3 (H435R / Y436F) to facilitate the purification of heterodimers in Fc. All Fc domain amino acid numbering is according to EU. The NKp46-BCMA NKCE_Fc CODV-OL1-ADE-DSB contains two additional linkers GGGGSGGGGS in the light chain: one between VL anti-BCMA and VL anti-NKp46, and one between VL NKp46 and CL. NKp46 binding site: 3D9; BCMA binding site: CA10v7; CD16 binds through the Fc domain with ADCC activity.

[0092] Figure 2A is a bar graph representing BCMA density on a panel of multiple myeloma cell lines based on cell surface FITC fluorescence emission. Figure 2B is a corresponding table recording the BCMA density on each cell line in descending order.

[0093] Figure 3A is a representative titration of NKp46-BCMA_Fc-ADE-DSB on RPMI 8226 cells. The titration data shown are the median fluorescence intensity at a dose range of antibody concentrations. The EC values ​​of 5 independent titrations are indicated. 50 value. Figure 3BFigure 1 is a representative titration of NKp46-BCMA_Fc-ADE-DSB on human NK cells purified from PBMC of healthy volunteers. The titration data shown are median fluorescence intensity at a dose range of antibody concentrations. EC values ​​of 3 NK donors are indicated. 50 value.

[0094] Figure 4 is a table showing the binding affinity (measured as KD) of 12 different Fc formats of NKp46-BCMA-NKCE to two different variants of human CD16a with either valine (V) or phenylalanine (F) at amino acid position 176, as quantified by using surface plasmon resonance (SPR).

[0095] Figure 5 is a table showing the binding affinity (measured as KD) of 12 different Fc formats of NKp46-BCMA-NKCE to the human neonatal Fc receptor (FcRn), as quantified by using SPR.

[0096] Figure 6 In vitro cellular cytotoxicity assay comparing the cytotoxicity of increasing concentrations (nM) of NKp46-BCMA-NKCE with enhanced ADCC (Fc-DE, Fc-DE-DSB, Fc-ADE, and Fc-ADE-DSB) and non-enhanced ADCC (NKp46-BCMA_Fc) incubated with RPMI 8226 cells in the presence of purified resting NK cells from six different donors (D410, D700, D114, D974, D245, and D409). RPMI 8226 cells were used as targets and purified resting NK cells were used as effectors.

[0097] Figure 7 In vitro cellular cytotoxicity assay comparing the cytotoxicity of increasing concentrations (nM) of NKp46-BCMA_Fc-ADE, NKp46-BCMA_Fc, Reference-1, BCMA_IgG1, IC_IgG1-DE and NKp46-IC_Fc control incubated with RPMI 8226 or MM.1s cells in the presence of purified resting NK cells from two different donors (D611 and D222). RPMI 8226 and MM.1s cells were used as targets and purified resting NK cells were used as effectors.

[0098] Figure 8In vitro cellular cytotoxicity assay comparing the cytotoxicity of increasing concentrations (nM) of NKp46-BCMA_Fc-ADE, Reference-1, BCMA_IgG1, and NKp46-IC_Fc-ADE control incubated with RPMI 8226 cells in the presence of purified resting NK cells from three different donors (D786, D371, or D695). RPMI 8226 cells were used as targets and purified resting NK cells were used as effectors.

[0099] Fig. 9 In vitro cellular cytotoxicity assay comparing the cytotoxicity of purified resting NK cells with RPMI 8226 cells, NKp46-BCMA_Fc-ADE and NKp46-IC_Fc-ADE. RPMI 8226 cells were used as targets and either purified resting NK cells (left panel) or RPMI 8226 cells (right panel) were loaded with 51 Cr, to determine both target cell killing and NK vs. NK fratricidal toxicity in the same assay. (2 NK cell donors are shown).

[0100] Fig.10 In vitro cell cytotoxicity assay, comparing the cytotoxicity of NKp46-BCMA-NKCE in the presence of various soluble BCMA concentrations. In the presence of increasing concentrations of soluble BCMA recombinant protein (0, 2, 20 and 200 ng / mL), NKp46-BCMA_Fc-ADE-DSB is cytotoxic to RPMI 8226 cells. RPMI 8226 is used as a target, and purified resting NK cells are used as effectors (2 NK cell donors D504 and D930 are shown).

[0101] Fig.11 This suggests that optimal NK cell activation involves dual targeting of NKp46 and CD16a by NKp46-BCMA_Fc-ADE-DSB.

[0102] Fig.12 The high potency of NKp46-BCMA_Fc-ADE-DSB was demonstrated to allow efficient tumor cell killing even in MM cell models expressing low BCMA.

[0103] Fig.13 It was demonstrated that NKp46-BCMA_Fc-ADE-DSB had enhanced potency compared to antibodies with enhanced ADCC characteristics.

[0104] Fig.14ASchematic diagram of the experimental mouse model used to determine the anti-tumor activity of NKp46-BCMA_Fc in vivo. A 1:1 mixture of green (eGFP) and red (dsRed) fluorescent mouse lymphoma RMA cells that do not express and express human BCMA, respectively, was injected intravenously (iv) into human NKp46 transgenic Rag1-deficient mice (Tg huNKp46 Rag1- / -). Tumor-bearing mice (n=7 per group) were treated once with a total dose of 12.2 pmoles of NKp46-BCMA_Fc or vehicle as a control. The mouse livers were biopsied 48 h after treatment, and the absolute counts of infiltrating RMA cells were monitored by flow cytometry, as shown in Figure 2. Figure 14B-14E As described in. Fig. 14B Shown is a mixed population of green (eGFP-huBCMA negative) and red (dsRed-huBCMA positive) fluorescent mouse lymphoma RMA cells analyzed by flow cytometry before transplantation. Fig. 14C Shown is the expression of human BCMA by flow cytometry of green (eGFP) and red (dsRed) fluorescent mouse lymphoma RMA cells. Fig.14D Shown is the expression of human BCMA on dsRed RMA cells in pre-transplantation (in vitro) and post-transplantation (ex vivo) liver biopsies analyzed by flow cytometry. Fig.14E Shown are the absolute counts (left) and dsRed / eGFP cell ratios (right) of liver-infiltrating RMA cells analyzed by flow cytometry 48 h after treatment. The statistical test used to analyze the data was the Mann and Whitney Test: when p>0.05, not significant (ns); when p<0.01, significant (**).

[0105] Fig.15AShow in autologous environment after overnight treatment with 10 μ g / mL NKp46-BCMA_Fc-ADE-DSB or 20 μ g / mL reference-4 antibody (anti-CD38 IgG1 antibody) or isotype control (NKp46-IC_Fc-ADE-DSB) from the whole blood-derived PBMC of a MM patient, the percentage of multiple myeloma (MM) cells (defined as CD138+CD38+ cells) obtained by flow cytometry and the measured values ​​of CD107a and CD69 expression of NK cells (defined as CD3-CD56+CD16+ cells). The left small figure is a dot plot, which shows the CD138 and CD38 staining of the PBMC from a MM patient and the gating of CD138+CD38+(MM) cells. The central small figure contour map shows the CD107a and CD16 staining of CD3-CD56+ cells. The right panel contour plot shows CD69 and CD16 staining of CD3-CD56+ cells. After overnight treatment of whole blood-derived PBMCs from a MM patient with 10 μg / mL NKp46-BCMA_Fc-ADE-DSB (black), or 20 μg / mL reference-4 antibody (grey - anti-CD38 IgG1 antibody), or isotype control (white), Fig. 15B The left bar graph represents the percentage of CD38+CD138+(MM) cells in PBMCs, the central bar graph represents the percentage of CD3-CD56+CD16+NK cells expressing CD107a, and the right bar graph represents the percentage of CD3-CD56+CD16+NK cells expressing CD69.

[0106] Figure 16A-16C Depicts MM cell death % of patient samples treated ex vivo with NKp46-BCMA_Fc-ADE-DSB, these patients are untreated patients or patients who relapsed after standard of care therapy. TC = therapeutic agent category; ≤4TC: Imid, Dex, PI and anti-CD38 mAb; >4TC: previous agent and / or alkylating agent, BH3 mimetic, and / or BCMA or CD38TCE, and / or anti-CD47 mAb, and / or histone deacetylase inhibitor (HDACi).

[0107] Fig.17 The positions of the VYACEVTHQGLSSPVTK (SEQ ID NO: 86), GPSVFPLAPSSK (SEQ ID NO: 87) and TTPPVLDSDGSFFLYSK (SEQ ID NO: 88) peptides on the NKp46-BCMA NKCE_Fc CODV-OL1-ADE-DSB molecule are depicted.

[0108] Fig.18Shown are mean (N=3) plasma concentration versus time curves of NKp46-BCMA_Fc-ADE-DSB NKCE following a single intravenous administration (2.5 mg / kg) to female huFcRn tg32 transgenic mice.

[0109] Fig.19 Shown are individual plasma concentration versus time curves of NKp46-BCMA_Fc-ADE-DSB NKCE following a single intravenous administration (2.5 mg / kg) to female huFcRn tg32 transgenic mice.

[0110] Fig. 20 The activity of NKp46-BCMA Fc WT CODV-OL1 bispecific antibody against disseminated EL4-huBCMA tumor cells in huNKp46-Tg x Rag mice is shown. The graph represents the Kaplan-Meier curve of animals treated with 5, 0.5 and 0.05 mg / kg of NKp46-BCMA Fc WT CODV-OL1 bispecific antibody compared to Reference-2 compound, control NKCE ineffective for CD16 binding (blue), control NKCE ineffective for NKp46 binding (green) or control NKCE ineffective for BCMA binding (black) or untreated group.

[0111] Fig.21 Shown are the activities of surrogate muNKp46-huBCMACODV-OL1 Fc WT and FC-ADE bispecific antibodies against disseminated EL4-huBCMA tumor cells in huFcgR-Tg mice. The graphs represent Kaplan-Meier curves of animals treated with 5, 0.5 and 0.05 mg / kg of Fc WT and Fc-ADE muNKp46-huBCMA surrogate bispecific antibodies.

[0112] Fig. 22 Depicted are the dose response percentage curves of DTT reduction of the main peak of the non-reduced sample measured by capillary electrophoresis (cGE). mAb ctrl (yellow), CODV-OL1 wt (blue), CODV-OL1 ADE (magenta), CODV-OL1 ADE-DSB (black).

[0113] Figure 23 depicts dose response curves of NEM incorporation / %DSB reduction for CODV-OL1 wt (Panel A), CODV-OL1 ADE (Panel B), CODV-OL1 ADE-DSB (Panel C). The cysteine ​​residues analyzed are indicated in the figure legends, where they are numbered according to the protein analyzed.

[0114] Figure 24A-24B Depicted is the cytotoxicity of NKp46-BCMA_Fc-ADE-DSB in NK cell co-culture with RPMI 8226 cells ( Fig.24A ) and the release of pro-inflammatory cytokines (IL-1-β, IL-6, TNF-α and IFN-γ) in the co-culture with PMBCs ( Fig. 24B ).

[0115] Figure 25A-25B Depicted is the proliferation of MM1R tumor cell lines in the presence of NKp46-BCMA_Fc-ADE-DSB in NK cell co-culture ( Fig.25A ) and the release of pro-inflammatory cytokines (IL-1-β, IL-6, TNF-α and IFN-γ) in the co-culture with PMBCs ( Fig.25B ).

[0116] Figure 26A-26D The efficacy of NKp46-BCMA_Fc-ADE-DSB on NK cell activation in the presence or absence of RPMI 8226 MM cells is depicted, as measured by the activation marker CD69 ( Fig.26A and Fig.26C ) and CD107a / b( Fig.26B and Fig.26D ) indicated.

[0117] Figure 27A-27F Figure 3 shows the effect of NKp46-BCMA_Fc-ADE-DSB on the intracellular production of TFNα in NK cells in the presence or absence of RPMI 8826 MM cells. Fig.27A and Fig.27D )、IFNγ( Fig.27B and Fig.27E ) and MIP1β( Fig.27C and Fig.27F )’s efficacy.

[0118] Figure 28A-28B Figure 3 shows the expression of IFN-γ in human whole blood co-cultured with RPMI 8226-FRP cells after treatment with 1, 10, 100 and 300 ug / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or with negative or positive controls. Fig.28A ) and MIP-1α( Fig.28B ) plasma levels.

[0119] Figure 29A-29BFigure 3 shows the expression of TNF-α ( ) in an in vitro assay in human whole blood co-cultured with RPMI 8226-RFP cells after treatment with 1, 10, 100 and 300 ug / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or with negative or positive controls. Fig.29A ) and IL-1β( Fig.29B ) plasma levels.

[0120] Figure 30A-Figure 30B Figure 3 shows the expression of IL-6 (K-100) in an in vitro assay in human whole blood co-cultured with RPMI 8226-RFP cells after treatment with 1, 10, 100 and 300 ug / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or with negative or positive controls. Fig. 30A ) and IL-8( Fig. 30B ) plasma levels.

[0121] Figure 31A-Figure 31B Figure 3 shows the expression of IL-2 (K-100) in an in vitro assay in human whole blood co-cultured with RPMI 8226-RFP cells after treatment with 1, 10, 100 and 300 ug / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or with negative or positive controls. Fig.31A ) and GM-CSF( Fig.31B ) plasma levels.

[0122] Figure 32A-32B Figure 3 shows the expression of IL-4 (K-100) in an in vitro assay with human whole blood co-cultured with RPMI 8226-RFP cells after treatment with 1, 10, 100 and 300 ug / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or with negative or positive controls. Fig.32A ) and IL-10( Fig.32B ) plasma levels.

[0123] Figure 33A- Fig.33C Depicted are in vitro and ex vivo induction of NK cell activation and tumor cell depletion with NKp46-BCMA_Fc-ADE-DSB using primary patient samples at diagnosis and relapse. FIG33A is MM cell death %, FIG33B is CD107+ cell %, and Fig.33C is the % of INFγ+ cells.

[0124] Figure 34A-Figure 34Bis a graph illustrating plasma NKp46-BCMA_Fc-ADE-DSB concentrations following repeated (once per week for 3 weeks) subcutaneous injections of NKp46-BCMA_Fc-ADE-DSB in cynomolgus monkeys (2 / dose). Fig.34A Plasma concentrations in two males receiving 25000 ug / kg / administration are depicted. Fig.34B Plasma concentrations in two females receiving 50000 ug / kg / administration are depicted.

[0125] Fig.35 Depicted are plasma IL-6 levels following repeated (once per week for 3 weeks) subcutaneous injections of 25 mg / kg / administration or 50 mg / kg / administration of NKp46-BCMA_Fc-ADE-DSB in cynomolgus monkeys (2 / dose). DETAILED DESCRIPTION

[0126] The present disclosure provides multifunctional binding proteins that bind to a surface biomarker (i.e., NKp46) on immune NK cells and a target antigen (i.e., BCMA) on the cell membrane of normal and malignant plasma cells, and are capable of redirecting NK cells to lyse target cells expressing BCMA surface biomarkers. The multifunctional binding proteins of the present disclosure further comprise all or part of an Fc region or a variant thereof, which all or part of a Fc region or a variant thereof binds to an Fc-gamma receptor (FcγR), particularly an activating Fc-gamma receptor (FcγR), such as FcγRIIIa (also known as CD16a).

[0127] The present disclosure provides novel Fc domain variants (e.g., novel binding polypeptides comprising Fc domain variants) with improved thermal stability. The present disclosure also provides novel Fc domain variants (e.g., novel binding polypeptides comprising Fc domain variants) with improved binding to Fc receptors. The present disclosure further provides novel Fc domain variants (e.g., binding polypeptides comprising Fc domain variants) comprising glycosylated Fc domains, which enhance the interaction with antibody effector molecules compared to wild-type (e.g., unmodified) Fc domains. The present disclosure also provides nucleic acids encoding Fc domain variants (e.g., novel binding polypeptides comprising Fc domain variants), recombinant expression vectors and host cells for preparing Fc domain variants (e.g., novel binding polypeptides comprising Fc domain variants), and pharmaceutical compositions comprising separated Fc domain variants (e.g., novel binding polypeptides comprising Fc domain variants). A method for treating one or more diseases or disorders using Fc domain variants (e.g., novel binding polypeptides comprising Fc domain variants) of the present disclosure is also provided.

[0128] It should be understood that the methods described in this disclosure are not limited to the specific methods and experimental conditions disclosed herein, such that the methods and conditions may vary. It should also be understood that the terminology used herein is only for the purpose of describing specific embodiments and is not intended to be limiting.

[0129] In addition, unless otherwise stated, the experiments described herein use conventional molecular and cell biology and immunological techniques within the technical scope of the art. Such techniques are well known to skilled workers and are fully explained in the literature. See, for example, Ausubel et al., ed., Current Protocols in Molecular Biology [Contemporary Molecular Biology Experiment Guide], John Wiley & Sons, Inc. [John Wiley and Sons Publishing Company], New York, New York (1987-2008), including all supplements; Molecular Cloning: A Laboratory Manual [Molecular Cloning: Laboratory Manual] (4th edition), edited by MR Green and J. Sambrook; and Harlow et al., Antibodies: A Laboratory Manual [Antibodies: Laboratory Manual], Chapter 14, Cold Spring Harbor Laboratory [Cold Spring Harbor Laboratory], Cold Spring Harbor [Cold Spring Harbor] (2013, 2nd edition).

[0130] Unless otherwise defined, the scientific and technical terms used herein have the meanings commonly understood by those of ordinary skill in the art. In the case of any potential ambiguity, the definitions provided herein take precedence over any dictionary or non-intrinsic definitions. In addition, unless the context otherwise requires, singular terms will include plural terms and plural terms will include singular terms. Unless otherwise stated, the use of "or" means "and / or". The use of the term "including" and other forms (such as "includes" and "included") is not restrictive.

[0131] Typically, the nomenclature used in conjunction with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization as described herein is well known in the art and commonly used. Unless otherwise indicated, the methods and techniques provided herein are generally performed according to conventional methods well known in the art, and as described in various general and more specific references cited and discussed throughout this specification. Enzymatic reactions and purification techniques are performed as generally achieved in the art or as described herein, according to the manufacturer's instructions. The nomenclature used in conjunction with analytical chemistry, synthetic organic chemistry, and medicine and pharmaceutical chemistry as described herein, as well as laboratory methods and techniques thereof, are well known in the art and commonly used. Chemical synthesis, chemical analysis, drug preparation, formulation and delivery, and treatment of patients are performed using standard techniques.

[0132] In order that the present disclosure may be more readily understood, selected terms are defined below.

[0133] The term "polypeptide" refers to any polymeric amino acid chain, and encompasses polypeptide analogs or variants of natural or artificial proteins, protein sequences, or fragments thereof, unless otherwise contradictory to the context. Polypeptides can be monomeric or polymeric. Polypeptide fragments contain, for example, at least about 5 consecutive amino acids, at least about 10 consecutive amino acids, at least about 15 consecutive amino acids, or at least about 20 consecutive amino acids.

[0134] The term "isolated protein" or "isolated polypeptide" refers to a protein or polypeptide that, by virtue of its origin or source of derivation, is not associated with naturally associated components that accompany it in its native state; is substantially free of other proteins from the same species; is expressed by cells from a different species; or does not exist in nature. Thus, a protein or polypeptide that is chemically synthesized or synthesized in a cellular system different from the cell from which it originates in nature will be "isolated" from its naturally associated components. A protein or polypeptide may also be rendered substantially free of naturally associated components by isolation using protein purification techniques well known in the art.

[0135] As used herein, the term "binding protein" or "binding polypeptide" shall refer to a protein or polypeptide (e.g., an antibody or immunoadhesin) containing at least one binding site that is responsible for selectively binding to a target antigen of interest (e.g., a human target antigen). Exemplary binding sites include antibody variable domains, ligand binding sites of receptors, or receptor binding sites of ligands. In some aspects, the binding protein or binding polypeptide comprises a plurality of (e.g., two, three, four or more) binding sites. In some aspects, the binding protein or binding polypeptide is a therapeutic enzyme.

[0136] The term "ligand" refers to any substance that can be combined with another substance or combined with another substance. Similarly, the term "antigen" refers to any substance that can produce antibodies against it. Although "antigen" is usually used when referring to antibody binding substrates and "ligand" is often used when referring to receptor binding substrates, these terms are not different from each other and cover a wide range of overlapping chemical entities. In order to avoid doubt, antigen and ligand are used interchangeably throughout this article. Antigen / ligand can be a peptide, polypeptide, protein, aptamer, polysaccharide, sugar molecule, carbohydrate, lipid, oligonucleotide, polynucleotide, synthetic molecule, inorganic molecule, organic molecule and any combination thereof.

[0137] The dissociation constant (K) of the binding protein D ) can be determined, for example, by surface plasmon resonance. Typically, surface plasmon resonance analysis measures the real-time binding interaction between a ligand (target antigen on a biosensor matrix) and an analyte (binding protein in solution) by surface plasmon resonance (SPR) using a BIAcore system (Pharmacia Biosensor; Piscataway, NJ). Surface plasmon analysis can also be performed by immobilizing the analyte (binding protein on a biosensor matrix) and presenting the ligand (target antigen). As used herein, the term " D ” refers to the dissociation constant of the interaction between a specific binding protein and the target antigen.

[0138] As used herein, the term "specific binding" refers to an antibody or immunoadhesin that specifically binds to at most about 1×10 -6 M, about 1×10 -7 M, about 1×10 -8 M, about 1×10 -9 M, about 1×10 -10 M, about 1×10 -11 M, about 1×10 -12 M or lower dissociation constant (K D ) ability to bind to a target (e.g., an antigen), and / or bind to an antigen with an affinity at least about two times higher than its affinity for a nonspecific antigen. The specific binding of an antibody can be through the specific binding of a CDR sequence to a target antigen. An antibody can also specifically bind to an FcR (e.g., FcRn or FcγRIIIa) through the Fc region.

[0139] As used herein, the term "antibody" refers to assemblies (e.g., complete antibody molecules, immunoadhesins, or variants) that have significant known specific immunoreactivity to an antigen of interest (e.g., a tumor-associated antigen). Antibodies and immunoglobulins comprise light and heavy chains, with or without interchain covalent linkages between the light and heavy chains. The basic immunoglobulin structure of vertebrate systems is relatively well understood.

[0140] As will be discussed in more detail below, the general term "antibody" includes five different classes of antibodies that can be distinguished biochemically. Although all five classes of antibodies are clearly within the scope of the present disclosure, the following discussion will generally be directed to the IgG class of immunoglobulin molecules. With respect to IgG, immunoglobulins comprise two identical light chains of approximately 23,000 daltons and two identical heavy chains of 53,000-70,000 daltons. The four chains are joined by disulfide bonds in a "Y" configuration, wherein the light chains begin at the mouth of the "Y" and continue to surround the heavy chains throughout the variable region.

[0141] The light chain of immunoglobulin is classified as kappa (κ) or lambda (λ). Each heavy chain category can be combined with a κ or λ light chain. Generally, the light chain and the heavy chain are covalently bonded to each other, and when the immunoglobulin is produced by a hybridoma, a B cell or a genetically engineered host cell, the "tail" portion of the two heavy chains is bonded to each other by covalent disulfide linkage or non-covalent linkage. In the heavy chain, the amino acid sequence extends from the N-terminal end of the forked end of the Y configuration to the C-terminal end at the bottom of each chain. It will be appreciated by those skilled in the art that the heavy chain is classified as gamma (γ), mu (μ), alpha (α), delta (δ) or epsilon (ε), among which there are some subclasses (e.g., γl-γ4). The nature of the chain determines that the "class" of the antibody is IgG, IgM, IgA or IgE, respectively. The immunoglobulin isotype subclasses (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, etc.) are well characterized, and it is known that they confer functional specialization. Modified forms of each of these classes and isotypes are readily discernible to the skilled artisan in view of the instant disclosure and are therefore within the scope of the instant disclosure.

[0142] Both light and heavy chains are divided into regions of structural and functional homology. The term "region" refers to a part or portion of an immunoglobulin or antibody chain and includes a constant region or a variable region, as well as more discrete parts or portions of the region. For example, a light chain variable region includes "complementarity determining regions" or "CDRs" interspersed among "framework regions" or "FRs" as defined herein.

[0143] Regions of an immunoglobulin heavy or light chain can be defined as either a "constant" (C) region or a "variable" (V) region, based on the relative lack of sequence variation within the region among members of each class in the case of a "constant region," or based on the significant variation within the region among members of each class in the case of a "variable region." The terms "constant region" and "variable region" can also be used functionally. In this regard, it will be understood that the variable region of an immunoglobulin or antibody determines antigen recognition and specificity. Conversely, the constant region of an immunoglobulin or antibody confers important effector functions, such as secretion, transplacental movement, Fc receptor binding, complement binding, and the like. The subunit structure and three-dimensional configuration of the constant regions of the different immunoglobulin classes are well known.

[0144] The constant region and variable region of immunoglobulin heavy chain and light chain are folded into domains. The term "domain" refers to a globular region of a heavy chain or light chain containing a peptide loop (e.g., 3 to 4 peptide loops), which is stabilized, for example, by a β-pleated sheet and / or an intrachain disulfide bond. The constant region domain on the light chain of an immunoglobulin is interchangeably referred to as a "light chain constant region domain," "CL region," "CL domain," or "CK domain." The constant domain on the heavy chain (e.g., hinge, CH1, CH2, or CH3 domain) is interchangeably referred to as a "heavy chain constant region domain," "CH" region domain, or "CH domain." The variable domain on the light chain is interchangeably referred to as a "light chain variable region domain," "VL region domain," or "VL domain." The "variable domain" on the heavy chain is interchangeably referred to as a "heavy chain variable region domain," "VH region domain," or "VH domain."

[0145] By convention, the numbering of the amino acids of the variable constant region domains increases as they become more distant from the antigen binding site or amino terminus of the immunoglobulin or antibody. The N-terminus of each immunoglobulin heavy and light chain is the variable region, and the C-terminus is the constant region. The CH3 and CL domains comprise the carboxyl termini of the heavy and light chains, respectively. Thus, the domains of the immunoglobulin light chain are arranged in a VL-CL orientation, while the domains of the heavy chain are arranged in a VH-CH1-hinge-CH2-CH3 orientation.

[0146] The amino acid assignments for each variable region domain are according to the definition of Kabat, Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, MD, 1987 and 1991). Kabat also provided a widely used numbering convention (Kabat numbering) in which corresponding residues between different heavy chain variable regions or between different light chain variable regions are assigned the same number. CDRs 1, 2, and 3 of the VL domain are also referred to herein as CDR-L1, CDR-L2, and CDR-L3, respectively. CDRs 1, 2, and 3 of the VH domain are also referred to herein as CDR-H1, CDR-H2, and CDR-H3, respectively. If so specified, the assignments of the CDRs may be based on (Lefranc et al., Developmental & Comparative Immunology 27:55-77; 2003) rather than Kabat. The numbering of the heavy chain constant regions is via the EU index as set forth in Kabat (Kabat, Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, Maryland, 1987 and 1991).The precise amino acid sequence boundaries of a given CDR or FR can be readily determined using any of a number of well-known schemes, including those described in Kabat et al. (1991), "Sequences of Proteins of Immunological Interest", 5th ed. Public Health Service, National Institutes of Health, Bethesda, Maryland ("Kabat" numbering scheme); Al-Lazikani et al., (1997) JMB 273, 927-948 ("Chothia" numbering scheme); MacCallum et al., J. Mol. Biol. 262:732-745 (1996), "Antibody-antigen interactions: Contact analysis and binding sitetopography[Antibody-antigen interactions: contact analysis and binding site topography],” J. Mol. Biol. [Journal of Molecular Biology] 262, 732-745. (“Contact” numbering scheme); Lefranc MP et al., “IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains,” Dev Comp Immunol [Development and Comparative Immunology], 2003 Jan; 27(1): 55-77 (“IMGT” numbering scheme); and Honegger A and Pluckthun A, “Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool,” J Mol Biol, 2001 Jun 8;309(3):657-70 (AHo numbering scheme).

[0147] The boundaries of a given CDR or FR can vary depending on the scheme used for identification. For example, the Kabat scheme is based on structural alignment, while the Chothia scheme is based on structural information. The numbering of the Kabat and Chothia schemes is based on the most common antibody region sequence length, wherein insertion is provided by inserting letters (e.g., "30a"), and deletions occur in some antibodies. These two schemes place certain insertions and deletions ("indels") in different positions, resulting in numbering differences. The Contact scheme is based on the analysis of complex crystal structures, and is similar to the Chothia numbering scheme in many respects.

[0148] As used herein, the CDRs of an antibody can be identified according to the numbering system called "IMGT" described in Lefranc (1999), The Immunologist, Vol. 7: 132-136 and Lefranc et al. (1999), Nucleic Acids Res., Vol. 27: 209-212.

[0149] As used herein, the CDRs of an antibody may be identified according to the Chothia numbering scheme, which refers to the positions of immunoglobulin structural loops. Chothia and Lesk (1987), J. Mol. Biol., Vol. 196: 901-917; Al-Lazikani et al. (1997), J. Mol. Biol., Vol. 273: 927-948; Chothia et al. (1992), J. Mol. Biol., Vol. 227: 799-817; Tramontano A et al. (1990), J. Mol. Biol., Vol. 215(1): 175-82.

[0150] As used herein, the CDRs of an antibody can be identified according to the Honegger-Pluckthun numbering scheme described in Honnegger and Pluckthun (2001), J. Mol. Biol., Vol. 309(3): 657-670.

[0151] As used herein, the term "VH domain" includes the amino terminal variable domain of an immunoglobulin heavy chain, and the term "VL domain" includes the amino terminal variable domain of an immunoglobulin light chain.

[0152] As used herein, the term "CH1 domain" includes the first (most amino-terminal) constant region domain of an immunoglobulin heavy chain, which extends, for example, from about positions 114-223 in the Kabat numbering system (EU positions 118-215). The CH1 domain is adjacent to the amino terminus of the VH domain and hinge region of an immunoglobulin heavy chain molecule and does not form part of the Fc region of an immunoglobulin heavy chain.

[0153] As used herein, the term "hinge region" includes the portion of the heavy chain molecule that connects the CH1 domain to the CH2 domain. The hinge region contains approximately 25 residues and is flexible, allowing the two N-terminal antigen binding regions to move independently. The hinge region can be subdivided into three different domains: the upper, middle and lower hinge domains (Roux et al. J. Immunol. [Journal of Immunology] 1998, 161: 4083).

[0154] As used herein, the term "CH2 domain" includes a portion of a heavy chain immunoglobulin molecule extending, for example, from about position 244-360 in the Kabat numbering system (EU position 231-340). The CH2 domain is unique because it is not tightly paired with another domain. Instead, two N-connected branched carbohydrate chains are inserted between the two CH2 domains of a complete native IgG molecule. In one embodiment, the binding polypeptide of the present disclosure comprises a CH2 domain derived from an IgG1 molecule (e.g., a human IgG1 molecule).

[0155] As used herein, the term "CH3 domain" includes a portion of a heavy chain immunoglobulin molecule extending from the N-terminus of the CH2 domain by about 110 residues (e.g., about positions 361-476 of the Kabat numbering system (EU positions 341-445)). The CH3 domain typically forms the C-terminal portion of an antibody. However, in some immunoglobulins, additional domains may extend from the CH3 domain to form the C-terminal portion of the molecule (e.g., the CH4 domain in the μ chain of IgM and the e chain of IgE). In one embodiment, the binding polypeptide of the present disclosure comprises a CH3 domain derived from an IgG1 molecule (e.g., a human IgG1 molecule).

[0156] As used herein, the term "CL domain" includes a constant region domain of an immunoglobulin light chain, which extends, for example, from about Kabat position 107A to about Kabat position 216. The CL domain is adjacent to the VL domain. In one embodiment, the binding polypeptide of the present disclosure comprises a CL domain derived from a kappa light chain (e.g., a human kappa light chain).

[0157] The variable region of an antibody allows it to selectively recognize and specifically bind to an epitope on an antigen. That is, the VL domain and VH domain of an antibody combine to form a variable region (Fv) that defines a three-dimensional antigen binding site. More specifically, the antigen binding site is defined by three complementary determining regions (CDRs) on each heavy chain and light chain variable region. As used herein, the term "antigen binding site" includes a site that specifically binds to an antigen (e.g., a cell surface or soluble antigen). The antigen binding site includes immunoglobulin heavy and light chain variable regions, and the binding site formed by these variable regions determines the specificity of the antibody. The antigen binding site is formed by variable regions, which vary between antibodies. The modified antibody of the present disclosure comprises at least one antigen binding site.

[0158] In certain embodiments, the binding polypeptide of the present disclosure comprises at least two antigen binding domains, which provide the association of the binding polypeptide with the selected antigen. Antigen binding domains do not have to be derived from the same immunoglobulin molecule. In this regard, the variable region can be derived from or derived from any type of animal, which can be induced to produce a humoral response and produce an immunoglobulin for the desired antigen. Therefore, the variable region of the binding polypeptide can be, for example, mammalian in origin, such as humans, mice, rats, goats, sheep, non-human primates (such as cynomolgus monkeys, macaques, etc.), wolves or camelids (e.g., from camels, llamas and related species) sources.

[0159] In naturally occurring antibodies, the six CDRs present on each monomer antibody are short non-continuous amino acid sequences that are specifically positioned to form an antigen binding site when the antibody assumes its three-dimensional configuration in an aqueous environment. The rest of the heavy and light chain variable domains show less intermolecular variability in the amino acid sequence and are referred to as framework regions. The framework region primarily adopts a β-sheet conformation, and the CDRs form loops that connect the β-sheet structure and form a portion of the β-sheet structure in some cases. Therefore, these framework regions serve to form a scaffold that positions the six CDRs in the correct direction through interchain non-covalent interactions. The antigen-binding domain formed by the positioned CDRs defines a surface complementary to an epitope on an immunoreactive antigen. The complementary surface promotes the non-covalent binding of antibodies to immunoreactive antigen epitopes.

[0160] Exemplary binding polypeptides include antibody variants. As used herein, the term "antibody variant" includes synthetic and engineered forms of antibodies that are altered so that they are not naturally occurring, for example, antibodies that include at least two heavy chain portions instead of two complete heavy chains (such as domain-deleted antibodies or minibodies); antibodies in multispecific forms (e.g., bispecific, trispecific, etc.), which are altered to bind to two or more different antigens or to bind to different epitopes on a single antigen); heavy chain molecules connected to scFv molecules, etc. In addition, the term "antibody variant" includes antibodies in multivalent forms (e.g., trivalent, tetravalent, etc. antibodies that bind to three, four or more copies of the same antigen).

[0161] As used herein, the term "valence" refers to the number of potential target binding sites in a polypeptide. Each target binding site specifically binds to a target molecule or a specific site on a target molecule. When a polypeptide comprises more than one target binding site, each target binding site can specifically bind to the same or different molecules (e.g., different ligands or different antigens or different epitopes on the same antigen can be bound). The subject binding polypeptide typically has at least one binding site that is specific to a human antigen molecule. For example, a typical IgG1 monoclonal antibody is specific to a target antigen. A bivalent antibody is an antibody comprising an antigen binding domain targeting two different antigens or two antigen binding domains targeting one antigen. Similarly, a trivalent antibody can be a monospecific antibody with three targeting domains for a single antigen. If a trivalent antibody binds to a first antigen with two binding domains and a second antigen with another binding domain, the trivalent antibody can be bispecific. A trivalent antibody can be trispecific and binds to three different targets.

[0162] The term "specificity" refers to the ability to specifically bind to a given target antigen (e.g., a human target antigen) (e.g., to immunoreact with it). A binding polypeptide can be monospecific and contain one or more binding sites that specifically bind to a target, or a polypeptide can be multispecific and contain two or more binding sites that specifically bind to the same or different targets. In certain embodiments, a binding polypeptide has specificity for two different (e.g., non-overlapping) portions of the same target. In certain embodiments, a binding polypeptide has specificity for more than one target. Exemplary binding polypeptides (e.g., antibodies) comprising an antigen binding site that binds to an antigen expressed on a tumor cell are known in the art, and one or more CDRs from such antibodies can be included in antibodies as described herein.

[0163] As used herein, the term "antigen" or "target antigen" refers to a molecule or a portion of a molecule that can be bound by a binding site of a binding polypeptide. A target antigen may have one or more epitopes.

[0164] The term "about" or "approximately" means within about 20% (eg, about 10%, about 5%, or about 1% or less) of a given value or range.

[0165] As used herein, "administer" or "administration" refers to the act of injecting or otherwise physically delivering a substance (e.g., an isolated binding polypeptide provided herein) present outside the body to a patient, such as, but not limited to, pulmonary (e.g., inhalation), mucosal (e.g., intranasal), intradermal, intravenous, intramuscular, subcutaneous delivery, and / or any other physical delivery method described herein or known in the art. When managing or treating a disease or its symptoms, the substance is typically administered after the onset of the disease or its symptoms. When preventing a disease or its symptoms, the substance is typically administered before the onset of the disease or its symptoms, and may be continued over a long period of time to delay or reduce the appearance or extent of disease-related symptoms.

[0166] As used herein, the term "composition" is intended to encompass a product containing the specified ingredients (e.g., an isolated binding polypeptide provided herein), optionally in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients, optionally in the specified amounts.

[0167] "Effective amount" means an amount of an active agent (e.g., an isolated binding polypeptide of the present disclosure) sufficient to achieve a desired physiological outcome in an individual in need of the agent. The effective amount can vary between individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individual to be treated, the formulation of the composition, the assessment of the individual's medical symptoms, and other relevant factors.

[0168] As used herein, the terms "subject" and "patient" are used interchangeably. As used herein, a subject can be a mammal, such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkeys and humans). In certain embodiments, as used herein, the term "subject" refers to a vertebrate, such as a mammal. Mammals include, but are not limited to, humans, non-human primates, wild animals, untamed animals, farm animals, competition animals, and pets.

[0169] As used herein, the term "therapy" refers to any regimen, method and / or agent that can be used to prevent, manage, treat and / or improve a disease or symptoms associated therewith. In some embodiments, the term "therapy" refers to any regimen, method and / or agent that can be used to regulate the immune response to infection or symptoms associated therewith in a subject. In some embodiments, the terms "therapies" and "therapy" refer to biological therapies known to those skilled in the art (such as medical personnel), supportive therapies and / or other therapies that can be used to prevent, manage, treat and / or improve a disease or symptoms associated therewith. In other embodiments, the terms "therapies" and "therapy" refer to biological therapies known to those skilled in the art (such as medical personnel), supportive therapies and / or other therapies that can be used to regulate the immune response to infection or symptoms associated therewith in a subject.

[0170] As used herein, the terms "treat," "treatment," and "treating" refer to the reduction or improvement of the progression, severity, and / or duration of a disease or symptoms associated therewith caused by the administration of one or more therapies (including but not limited to the administration of one or more prophylactic or therapeutic agents, such as the isolated binding polypeptides provided herein). As used herein, the term "treatment" may also refer to altering the course of the subject being treated. The therapeutic effects of treatment include, but are not limited to, preventing the occurrence or recurrence of a disease, alleviation of one or more symptoms, attenuation of the direct or indirect pathological consequences of a disease, a reduction in the rate of disease progression, improvement or alleviation of the disease state, and alleviation or improvement of prognosis.

[0171] BCMA

[0172] As used herein, the term "BCMA" refers to B cell maturation antigen. BCMA (also referred to as TNFRSF17, BCM or CD269) is a member of the tumor necrosis receptor (TNFR) family, and is mainly expressed on terminally differentiated B cells (e.g., memory B cells and plasma cells). Its ligand is referred to as the B cell activator (BAFF) and proliferation-inducing ligand (APRIL) of the TNF family. BCMA participates in mediating the survival of plasma cells for maintaining long-term humoral immunity. The gene of BCMA is encoded on chromosome 16, producing a primary 35mRNA transcript (NCBI accession number NM_001192.2) of 994 nucleotides in length, which encodes a protein (NP_001183.2) of 184 amino acids. A second antisense transcript derived from the BCMA locus has been described, which can play a role in regulating BCMA expression. (Laabi Y. et al., Nucleic Acids Res., 1994, 22: 1147-1154.) Additional transcript variants of unknown significance have been described (Smirnova AS et al. Mol Immunol., 2008, 45(4): 1179-1183). A second isoform, also referred to as TV4 (Uniprot identifier Q02223-2), has been identified. "BCMA" includes proteins comprising mutations such as point mutations, fragments, insertions, deletions, and splice variants of full-length wild-type BCMA.

[0173] Natural Killer Cells

[0174] As used herein, "natural killer cells" or "NK cells" refer to a subset of lymphocytes involved in innate immunity. NK cells can be identified by virtue of certain characteristics and biological properties, such as the expression of specific surface antigens (including CD16, CD56 and / or CD57, NKp46 for human NK cells); the absence of α / β or γ / δ TCR complexes on the cell surface; the ability to bind and kill cells that cannot express "self" MHC / HLA antigens by activating specific cytolytic mechanisms; the ability to kill tumor cells or other diseased cells that express ligands of NK activating receptors; and the ability to release protein molecules (called cytokines) that stimulate or inhibit immune responses. Using methods well known in the art, any of these characteristics and activities can be used to identify NK cells. The term NK cell will also cover any subpopulation of NK cells. In the context of this article, "active" NK cells refer to biologically active NK cells, including NK cells that have the ability to lyse target cells or enhance the immune function of other cells. NK cells can be obtained by various techniques known in the art (such as separation from blood samples, cell separation, tissue or cell collection, etc.). Useful protocols for assays involving NK cells can be found in Natural Killer Cells Protocols (Edited by Campbell KS and Colonna M) Human Press pp. 219-238 (2000).

[0175] NKp46

[0176] As used herein, the "NKp46" marker or "natural cytotoxicity triggering receptor 1" (also known as "CD335" or "NKP46" or "NK-p46" or "LY94") refers to a protein or polypeptide encoded by the Ncr1 gene. The reference sequence of the full-length human NKp46 protein is available from the NCBI database under accession number NP_004820. The human NKp46 mRNA sequence is described under NCBI accession number NM_004829.

[0177] NK cell conjugate

[0178] As used herein, the separated effector-competent polypeptide comprises a multispecific antibody in the form of an NK cell engager. "NK cell engager" refers to a binding protein comprising a monoclonal antibody domain targeting an activating NK cell receptor, an antigen-specific targeting region, and optionally an Fc region (Gauthier et al. (2019) Cell [Cell], 177: 1701-13). NK cells express CD16a (also known as FcγRIIIa), which binds to the Fc portion of the antibody with low affinity (Cerwenka and Lanier (2018) Science [Science] 359: 6383). Due to lower steric hindrance, the engagement of CD16a is less demanding than that of CD3, and due to the lack of auxiliary molecules, the engagement of CD16a is additionally promoted. After recognizing target cells decorated with antibodies, NK cells mediate antibody-dependent cellular cytotoxicity (ADCC), resulting in killing of target cells (Lo Nigro (2019) Ann Transl Med [Annals of Translational Medicine] 7: 105). When combined with NKp46 (another activating NK cell receptor), this naturally occurring mechanism can be used to engage CD16 to produce a trifunctional natural killer cell engager (i.e., NKCE), resulting in impressive therapeutic outcomes. For a review of NK cell engagers, see Demaria et al. (2021) Eur. J. Immunology [European Journal of Immunology] 51 (8): 1934, which is incorporated herein by reference in its entirety.

[0179] Trifunctional NKCEs are more potent in vitro than clinical therapeutic antibodies targeting the same antigen, and they also have similar in vivo pharmacokinetics to full IgG antibodies and no off-target effects. See International Application No. PCT / IB21 / 62494, which is incorporated herein by reference in its entirety.

[0180] Fc domain

[0181] In certain aspects of the present disclosure, an Fc domain, such as an Fc domain variant, is provided. As used herein, the term "Fc region" or "Fc domain" refers to a portion of the heavy chain constant region that begins at the hinge region just upstream of the papain cleavage site (i.e., residue 216 in IgG, taking the first residue of the heavy chain constant region as 114) and ends at the C-terminus of the antibody. Therefore, a complete Fc region comprises at least a hinge domain, a CH2 domain, and a CH3 domain.

[0182] The Fc region of an antibody is involved in non-antigen binding and can mediate effector functions by binding to Fc receptors. There are several different types of Fc receptors, which are classified based on the types of antibodies they recognize. For example, Fc-γ receptors (FcγRs) bind to IgG class antibodies, Fc-α receptors (FcαRs) bind to IgA class antibodies, and Fc-ε receptors (FcεRs) bind to IgE class antibodies. Neonatal Fc receptors (FcRn) interact with the Fc region of antibodies to promote antibody recycling by rescuing normal lysosomal degradation. FcγRs belong to the following family, which includes several members, for example, FcγRI, FcγRIIa, FcγRIIb, FcγRIIIa and FcγRIIIb.

[0183] As used herein, the term "native Fc" or "wild-type Fc" refers to a molecule (whether in monomeric or multimeric form) corresponding to the sequence of a non-antigen binding fragment produced by antibody digestion or produced by other means, and may contain a hinge region. The original immunoglobulin source of natural Fc is usually of human origin, and may be any immunoglobulin, such as IgG1 and IgG2. Natural Fc molecules are composed of monomeric polypeptides, which can be connected to dimers or multimers by covalent (i.e., disulfide bonds) and non-covalent associations. Depending on the class (e.g., IgG, IgA and IgE) or subclass (e.g., IgG1, IgG2, IgG3, IgA1 and IgGA2), the number of intermolecular disulfide bonds between monomer subunits of natural Fc molecules ranges from 1 to 4. An example of natural Fc is a disulfide-bonded dimer produced by papain digestion of IgG. As used herein, the term "native Fc" is universal for monomers, dimers and multimers.

[0184] As used herein, the terms "Fc domain variant," "Fc variant," or "modified Fc" refer to molecules or sequences that are modified from native / wild-type Fc but still contain a binding site for an FcR. Thus, the term "Fc variant" may include molecules or sequences that are humanized from a non-human native Fc. In addition, native Fc contains regions that can be removed because they provide structural features or biological activities that are not required for the antibody-like binding polypeptides described herein. Thus, the term "Fc variant" includes molecules or sequences that lack one or more native Fc sites or residues or in which one or more Fc sites or residues have been modified to affect or participate in: (1) disulfide bond formation, (2) incompatibility with a selected host cell, (3) N-terminal heterogeneity when expressed in a selected host cell, (4) glycosylation, (5) interaction with complement, (6) binding to Fc receptors other than salvage receptors, or (7) antibody-dependent cellular cytotoxicity (ADCC).

[0185] As used herein, an "Fc variant with effector activity" or "polypeptide with effector activity" refers to an Fc domain having one or more Fc effector functions as further described herein.

[0186] In certain exemplary embodiments, the Fc variants featured herein have one or more of the following compared to wild-type Fc: increased serum half-life, enhanced FcRn binding affinity, enhanced FcRn binding affinity at acidic pH, enhanced FcγRIIIa binding affinity, and / or similar thermal stability.

[0187] FcγRIIIa V176 or FcγRIIIa V158 or human CD16a-V receptor or CD16a V Refers to a polypeptide construct comprising a fragment of the CD16 human receptor that binds to the Fc region of a native antibody, mediates antibody-dependent cellular cytotoxicity and has a valine (V) at position 176 or position 158, also reported in the literature as allotype CD16a V176 or allotype CD16a V158.

[0188] FcγRIIIa F176 or FcγRIIIa F158 or human CD16a-F receptor or CD16a F Refers to a polypeptide construct comprising a fragment of the CD16 human receptor that binds to the Fc region of a native antibody, mediates antibody-dependent cellular cytotoxicity and has a phenylalanine (F) at position 176 or position 158, also reported in the literature as allotype CD16a F176 or allotype CD16a F158.

[0189] As used herein, the term "Fc domain" encompasses native / wild-type Fc as defined herein as well as Fc variants and sequences. Like Fc variants and native Fc molecules, the term "Fc domain" includes molecules in monomeric or multimeric form, whether digested from whole antibodies or produced by other means.

[0190] In certain exemplary embodiments, an Fc domain as described herein is thermostable.

[0191] In certain exemplary embodiments, an Fc domain as described herein is glycosylated (e.g., via N-linked glycosylation). In certain exemplary embodiments, the Fc domain comprises N-linked glycosylation, e.g., at an N-linked glycosylation motif comprising the amino acid sequence NXT or NXS (X is any amino acid residue except proline). In certain exemplary embodiments, the Fc domain is glycosylated at amino acid position 297 according to EU numbering.

[0192] In certain exemplary embodiments, an Fc domain as described herein is effector active.

[0193] In certain exemplary embodiments, an Fc domain as described herein is thermostable, glycosylated, and has any combination of effector activity.

[0194] Thermostable Fc domain variants

[0195] The structure of the constant antibody domain is similar to that of the variable domain consisting of β chains connected to loops and short helices. In contrast to the extensive interchain interactions exhibited in other domains, the CH2 domain of the heavy chain constant region exhibits weak carbohydrate-mediated interchain protein-protein interactions. The isolated mouse CH2 domain is relatively unstable at physiological temperature (Feige et al., 2004, J. Mol. Biol. [Journal of Molecular Biology] 344: 107-118), but previous efforts have demonstrated that the thermal stability of the CH2 domain can be enhanced by adding intrachain disulfide bonds, and these intrachain disulfide bonds can be used as a scaffold for the conjugate (Gong et al., 2009, J. Biol. Chem. [Journal of Biological Chemistry] 284: 14203-210).

[0196] Effector-enhanced Fc domain variants that exhibit increased thermal instability (i.e., reduced thermal stability) relative to the wild-type Fc domain are known. For example, the S239D / I332E and S239D / I332E / A330L variants result in reduced stability of the CH2 domain, as indicated by a reduced melting temperature (Tm) in differential scanning calorimetry (DSC) analysis. G236A / S239D / A330L / I332E has reduced protein thermal shift measurements compared to wild-type and has a significantly shortened half-life in hFcγR transgenic mice. (For review, see Liu et al. (2014) J.Biol.Chem. [Journal of Biological Chemistry] 289 (6): 3571, and Liu et al. (2020) Antibodies [Antibodies] 9 (4): 64.)

[0197] Effector-enhanced Fc domain variants with improved FcγR binding are known, wherein stability is not significantly reduced compared to wild-type. (See, e.g., Igawa et al., EP 2 940 135)

[0198] It has further been found that thermostable Fc domain variants can be generated by introducing one or more disulfide bonds in the Fc domain. Thus, in one aspect, the disclosure provides Fc domain variants comprising one or more engineered (e.g., non-natural) disulfide bonds (e.g., intrachain disulfide bonds mediated by, for example, one or more pairs of cysteines).

[0199] In certain exemplary embodiments, the disulfide bond is an intrachain disulfide bond between two CH2 regions of an Fc domain. In certain exemplary embodiments, the disulfide bond is an intrachain disulfide bond between two CH3 regions of an Fc domain. In certain exemplary embodiments, two or more intrachain disulfide bonds exist between two CH2 regions of an Fc domain and / or between two CH3 regions of an Fc domain.

[0200] The thermal stability or unfolding tendency of an Fc domain (e.g., an Fc domain with or without a binding polypeptide) can be determined using a variety of methods known in the art. For example, the unfolding or denaturation temperature can be measured by nanoform differential scanning calorimetry (nanoDSC) or nanoform differential scanning fluorescence (nanoDSF) (Wen et al., 2020 Anal. Biochem. [Analytical Biochemistry] 593: 113581). The detectable temperature at which a protein begins to unfold is Tstart.

[0201] In certain exemplary embodiments, the Tstart of a thermostable Fc domain variant (e.g., having one or more engineered disulfide bonds) is increased relative to an Fc domain variant that is not thermostabilized. In certain exemplary embodiments, the Tstart of a thermostable Fc domain variant is increased by about 1.0°C, about 1.5°C, about 2.0°C, about 2.5°C, about 3.0°C, about 3.5°C, about 4.0°C, about 4.5°C, about 5.0°C, about 5.5°C, about 6.0°C, about 6.5°C, about 7.0°C, about 7.5°C, about 8.0°C, about 8.5°C, about 9.0°C, about 9.5°C, about 10.0°C, about 10.5°C, about 11.0°C, about 11.5°C, about 12. ℃, about 0 ℃, about 12.5 ℃, about 13.0 ℃, about 13.5 ℃, about 14.0 ℃, about 14.5 ℃, about 15.0 ℃, about 15.5 ℃, about 16.0 ℃, about 16.5 ℃, about 17.0 ℃, about 17.5 ℃, about 18.0 ℃, about 18.5 ℃, about 19.0 ℃, about 19.5 ℃, about 20.0 ℃, about 20.5 ℃, about 21.0 ℃, about 21.5 ℃, about 22.0 ℃, about 22.5 ℃, about 23.0 ℃, about 23.5 ℃, about 24.0 ℃, about 24.5 ℃ or about 25.0 ℃.

[0202] In certain exemplary embodiments, the thermostable Fc domain variant has one or more amino acid substitution pairs selected from the group consisting of cysteine ​​substitutions at amino acid positions 242 and 334; amino acid positions 240 and 334; amino acid positions 287 and 306; amino acid positions 292 and 302; amino acid positions 323 and 332; amino acid positions 259 and 306; amino acid positions 350 and 441; amino acid positions 343 and 431; amino acid positions 375 and 404; amino acid positions 375 and 396; and amino acid positions 348 and 439, according to EU numbering. (For review, see Wozniak-Knopp et al., 2012, PLoS One [Public Library of Science·Comprehensive] 7:e30083; Jacobsen et al., 2017 J.Biol.Chem. [Journal of Biological Chemistry] 202:1865-75; WO 2014153063.)

[0203] In certain exemplary embodiments, the thermostable Fc domain variant comprises an engineered (e.g., non-native) intrachain disulfide bond mediated by a pair of cysteines that replace (i) a leucine (L) at amino acid position 242 and a lysine (K) at amino acid position 334; (ii) an alanine (A) at amino acid position 287 and a leucine (L) at amino acid position 306; or (iii) an arginine (R) at amino acid position 292 and a valine (V) at amino acid position 302, according to EU numbering.

[0204] In certain exemplary embodiments, the thermostable Fc domain variant comprises an engineered (e.g., non-native) intrachain disulfide bond mediated by a pair of cysteines that replace (i) leucine (L) at amino acid position 242 and lysine (K) at amino acid position 334; and (ii) arginine (R) at amino acid position 292 and valine (V) at amino acid position 302, according to EU numbering.

[0205] In certain exemplary embodiments, the thermostable Fc domain variant comprises an engineered (e.g., non-natural) intrachain disulfide bond mediated by a pair of cysteines that replaces leucine (L) at amino acid position 242 and lysine (K) at amino acid position 334. In certain exemplary embodiments, the thermostable Fc domain variant comprises an engineered (e.g., non-natural) intrachain disulfide bond mediated by a pair of cysteines that replaces alanine (A) at amino acid position 287 and leucine (L) at amino acid position 306. In certain exemplary embodiments, the thermostable Fc domain variant comprises an engineered (e.g., non-natural) intrachain disulfide bond mediated by a pair of cysteines that replaces arginine (R) at amino acid position 292 and valine (V) at amino acid position 302. In certain exemplary embodiments, the thermostable Fc domain variant may comprise at least one engineered intrachain disulfide bond. In certain exemplary embodiments, the thermostable Fc domain variant may comprise more than one engineered intrachain disulfide bond.

[0206] Effector-enhanced Fc domain variants

[0207] In one aspect, the disclosure provides Fc domain variants comprising effector-enhancing amino acid substitutions.

[0208] In one embodiment, the Fc domain variant with altered FcγRIIIa binding comprises one or more amino acid substitutions as disclosed herein. In one embodiment, the Fc domain variant with enhanced FcγRIIIa binding affinity has one or more amino acid substitutions as disclosed herein. In one embodiment, the Fc domain variant with enhanced FcγRIIIa binding affinity comprises two or more amino acid substitutions as disclosed herein. In one embodiment, the Fc domain variant with enhanced FcγRIIIa binding affinity comprises three or more amino acid substitutions as disclosed herein. In one embodiment, the Fc domain variant with enhanced FcγRIIIa binding affinity has four or more amino acid substitutions as disclosed herein.

[0209] In one embodiment, an Fc domain variant with altered FcRn binding comprises an Fc domain with one or more amino acid substitutions as disclosed herein. In one embodiment, an Fc domain variant with enhanced FcRn binding affinity comprises an Fc domain with one or more amino acid substitutions as disclosed herein. In one embodiment, an Fc domain variant with enhanced FcRn binding affinity comprises an Fc domain with two or more amino acid substitutions as disclosed herein. In one embodiment, an Fc domain variant with enhanced FcRn binding affinity comprises an Fc domain with three or more amino acid substitutions as disclosed herein.

[0210] In some embodiments, the Fc domain variants may exhibit species-specific FcRn binding affinity. In one embodiment, the Fc domain variants may exhibit human FcRn binding affinity. In one embodiment, the Fc domain variants may exhibit cynomolgus monkey FcRn binding affinity. In some embodiments, the Fc domain variants may exhibit cross-species FcRn binding affinity. Such Fc domain variants are said to have cross-reactivity between one or more different species. In one embodiment, the Fc domain variants may exhibit both human and cynomolgus monkey FcRn binding affinity.

[0211] Neonatal Fc receptor (FcRn) interacts with the Fc region of the antibody to promote recycling by rescuing normal lysosomal degradation. This process is a pH-dependent process that occurs in endosomes at acidic pH (e.g., less than pH 6.5), but does not occur under physiological pH conditions (e.g., non-acidic pH) of the bloodstream. In some embodiments, compared to the wild-type Fc domain, the Fc domain variant has an enhanced FcRn binding affinity at acidic pH. In some embodiments, compared to the wild-type Fc domain, the Fc domain variant has an enhanced FcRn binding affinity at a pH less than 7.0 (e.g., at about pH 6.5, about pH 6.0, about pH 5.5, about pH 5.0). In some embodiments, the Fc domain variant has an enhanced FcRn binding affinity at a pH less than 7.0 (e.g., at about pH 6.5, about pH 6.0, about pH 5.5, about pH 5.0) compared to the FcRn binding affinity of the wild-type Fc domain at an elevated non-acidic pH. The elevated non-acidic pH can be, for example, a pH greater than 7.0, about pH 7.0, about pH 7.4, about pH 7.6, about pH 7.8, about pH 8.0, about pH 8.5, about pH 9.0.

[0212] In certain embodiments, it may be desirable for the Fc domain variant to exhibit substantially the same FcRn binding affinity as the wild-type Fc domain at non-acidic pH. In some embodiments, it may be desirable for the Fc domain variant to exhibit a lower FcRn binding affinity at non-acidic pH than a binding polypeptide comprising a modified Fc domain having the double amino acid substitution M428L / N434S according to EU numbering (see USPN 8,088,376). Thus, it may be desirable for the Fc domain variant to exhibit minimal perturbation of pH-dependent FcRn binding.

[0213] In some embodiments, the Fc domain variants with enhanced FcRn binding affinity at acidic pH have a reduced (i.e., slower) FcRn dissociation rate compared to the wild-type Fc domain. In some embodiments, the Fc domain variants with enhanced FcRn binding affinity at acidic pH compared to the FcRn binding affinity of the binding polypeptide at elevated non-acidic pH have a slower FcRn dissociation rate at acidic pH compared to the FcRn dissociation rate of the wild-type Fc domain at elevated non-acidic pH.

[0214] Certain embodiments include Fc domain variants in which at least one amino acid in one or more constant region domains has been deleted or otherwise altered so as to provide desired biochemical characteristics, such as reduced or enhanced effector function, the ability to non-covalently dimerize, increased ability to localize at tumor sites, reduced serum half-life, or increased serum half-life when compared to an intact, unaltered antibody having substantially the same immunogenicity.

[0215] In certain other embodiments, the Fc domain variant comprises a constant region derived from a different antibody isotype (e.g., a constant region from two or more of human IgG1, IgG2, IgG3, or IgG4). In other embodiments, the Fc domain variant comprises a chimeric hinge (i.e., a hinge comprising a hinge portion of a hinge domain derived from a different antibody isotype (e.g., an upper hinge domain from an IgG4 molecule and a middle hinge domain from IgG1)). In certain embodiments, the Fc domain can be mutated to increase or decrease effector function using techniques known in the art.

[0216] In some embodiments, the Fc domain variant has a changed binding affinity to the Fc receptor. There are several different types of Fc receptors, which are classified based on the antibody types they recognize. For example, Fc-γ receptors (FcγR) bind IgG class antibodies, Fc-α receptors (FcαR) bind IgA class antibodies, and Fc-ε receptors (FcεR) bind IgE class antibodies. FcγR belongs to the following family, which includes several members, for example, FcγRI, FcγRIIa, FcγRIIb, FcγRIIIa and FcγRIIIb. In some embodiments, compared with the wild-type Fc domain, the Fc domain variant has a changed FcγRIIIa binding affinity. In some embodiments, compared with the wild-type Fc domain, the Fc domain variant has a reduced FcγRIIIa binding affinity. In some embodiments, compared with the wild-type Fc domain, the Fc domain variant has an enhanced FcγRIIIa binding affinity. In some embodiments, the Fc domain variant modified Fc domain has approximately the same binding affinity to FcγRIIIa as compared to the wild-type Fc domain.

[0217] In certain embodiments, the Fc domain variant comprises an antibody constant region (e.g., an IgG constant region, e.g., a human IgG constant region, e.g., a human IgG1 constant region) that mediates one or more effector functions. For example, the combination of the C1 complex with the antibody constant region can activate the complement system. The activation of the complement system is important in the opsonization and lysis of cell pathogens. The activation of the complement system also stimulates inflammatory reactions and may also participate in autoimmune hypersensitivity reactions. In addition, antibodies bind to receptors on different cells via the Fc domain (the Fc receptor binding site on the antibody Fc region binds to the Fc receptors (FcR) on the cell). There are many Fc receptors, which are specific to different classes of antibodies (including IgG (gamma receptors), IgE (epsilon receptors), IgA (alpha receptors) and IgM (mu receptors)). The binding of antibodies to Fc receptors on the cell surface triggers many important and diverse biological responses, including phagocytosis and destruction of antibody-coated particles, clearance of immune complexes, killer cell lysis of antibody-coated target cells (known as antibody-dependent cell-mediated cytotoxicity or ADCC), release of inflammatory mediators, placental transfer, and control of immunoglobulin production. In some embodiments, Fc domain variants (e.g., binding polypeptides (e.g., antibodies, immunoadhesins, or antibody variants)) bind to Fc-γ receptors. In alternative embodiments, Fc domain variants comprise a constant region that lacks one or more effector functions (e.g., ADCC activity) and / or cannot bind to Fcγ receptors.

[0218] In certain exemplary embodiments, the effector-enhanced Fc domain variant has one or more amino acid substitutions selected from the group consisting of: aspartic acid (D) at amino acid position 221; cysteine ​​(C) at amino acid position 222; tyrosine (Y) at amino acid position 234; alanine (A) at amino acid position 236; tryptophan (W) at amino acid position 236; aspartic acid (D) at amino acid position 239; leucine (L) at amino acid position 243; glutamic acid (E) at amino acid position 267; phenylalanine (F) at amino acid position 268; proline (P) at amino acid position 292; alanine (P) at amino acid position 298 333; serine (S) at amino acid position 333; alanine (A) at amino acid position 334; alanine (A) at amino acid position 336; arginine (R) at amino acid position 345; and leucine (L) at amino acid position 396, according to EU numbering. (For review, see Saunders, 2009, Front. Immunol. [Immunology] doi:10.3389 / fimmu.2019.01296.)

[0219] In some embodiments, the Fc domain variant may comprise an amino acid substitution at an amino acid position selected from the group consisting of 236, 239, 330, and 332 according to EU numbering. In some embodiments, the substitution may comprise an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid 239, a leucine (L) at amino acid position 330, and a glutamic acid (E) at amino acid position 332 according to EU numbering. In some embodiments, the Fc domain variant may comprise a double amino acid substitution at any two amino acid positions selected from the group consisting of an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid 239, a leucine (L) at amino acid position 330, and a glutamic acid (E) at amino acid position 332. In some embodiments, the Fc domain variant may comprise a triple amino acid substitution at any three amino acid positions selected from the group consisting of an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid 239, a leucine (L) at amino acid position 330, and a glutamic acid (E) at amino acid position 332. In some embodiments, the Fc domain variant may comprise a quadruple amino acid substitution at any four amino acid positions selected from: alanine (A) at amino acid position 236, aspartic acid (D) at amino acid 239, leucine (L) at amino acid position 330, and glutamic acid (E) at amino acid position 332. In some embodiments, the Fc domain variant may comprise a combination of amino acid substitutions comprising aspartic acid (D) at amino acid 239 and glutamic acid (E) at amino acid position 332. In some embodiments, the Fc domain variant may comprise a combination of amino acid substitutions comprising alanine (A) at amino acid position 236, aspartic acid (D) at amino acid position, and glutamic acid at position 332.

[0220] In some embodiments, the Fc domain variant may further comprise an amino acid substitution at amino acid position 256 and / or 307 according to EU numbering. In some embodiments, the Fc domain variant may comprise a combination of amino acid substitutions comprising aspartic acid (D) at amino acid position 256 and glutamine (Q) at amino acid position 307 (see Mackness et al., 2019 MAbs 11: 1276-88; WO 2019147973A1, which are incorporated herein by reference in their entireties).

[0221] Glycosylated Fc domain variants

[0222] In certain exemplary embodiments, the associated protein is glycosylated. The glycosylation at the conserved position in the constant region of known antibodies has a profound effect on the antibody function, particularly the effector function of those described above, see, for example, Boyd et al. (Mol.Immunol [Molecular Biology], 32: 1311-1318, 1996). The glycosylation of the associated protein of the present disclosure is considered, wherein one or more carbohydrate moieties are added, replaced, deleted or modified. In certain embodiments, the glycosylation of the Fc domain of the associated protein is an N-connected glycosylation. The introduction of asparagine-X-serine or asparagine-X-threonine motifs produces a potential site for enzymatic attachment of the carbohydrate moiety, and therefore can be used to manipulate the glycosylation of the Fc domain variant. In Raju et al. (Biochemistry 40:8868-8876, 2001), the terminal sialylation of TNFR-IgG immunoadhesin was increased by regalactosylation and / or resialylation using β-1,4-galactosyltransferase and / or α,2,3 sialyltransferase. Increasing the terminal sialylation is thought to increase the half-life of the immunoglobulin.

[0223] Like most glycoproteins, antibodies are typically produced as a mixture of glycoforms. This mixture is particularly evident when antibodies are produced in eukaryotic cells, particularly mammalian cells. A variety of methods have been developed to make defined glycoforms (see Zhang et al. 2004, Science 303:371; Sears et al., 2001, Science 291:2344; Wacker et al., 2002, Science 298:1790; Davis et al. 2002, Chem. Rev. 102:579; Hang et al., 2001, Acc. Chem. Res. 34:727). In some embodiments, the glycosylated Fc domain comprises a native glycan at amino acid position 297 according to EU numbering. It is known that glycosylation of asparagine at amino acid position 297 in the CH2 domain of IgG1 promotes the interaction between the Fc domain and FcγR. Elimination of this glycosylation site eliminates effector function (Leabman et al., 2013, MAbs 5:896-903).In particular exemplary embodiments, the Fc domain comprises wild-type or near wild-type levels of glycosylation at amino acid position 297 according to EU numbering.

[0224] In some embodiments, the glycosylated Fc domain variant comprises an engineered or non-natural glycan. In some embodiments, the engineered or non-natural glycan is a modified glycan that can be conjugated to a therapeutic molecule (eg, an antibody-drug conjugate).

[0225] Fc-containing binding peptides

[0226] In one aspect, the disclosure provides an isolated Fc domain variant comprising or compounded with (e.g., fused to) at least one binding domain (e.g., at least one binding polypeptide). In certain embodiments, the binding domain comprises one or more antigen binding domains. The antigen binding domain need not be derived from the same molecule as the parent Fc domain. In certain embodiments, the Fc domain variant is present in an antibody.

[0227] In one embodiment, the Fc domain variant is present in an antibody or is compounded with an antibody. Any antibody from any source or species can be used together with the Fc domain variant disclosed herein. Suitable antibodies include but are not limited to chimeric antibodies, humanized antibodies or human antibodies. Suitable antibodies include but are not limited to full-length antibodies, monoclonal antibodies, polyclonal antibodies or single domain antibodies (such as VHH antibodies).

[0228] In certain exemplary embodiments, the Fc domain variant can be combined with or complexed with an antigen binding fragment of an antibody. The term "antigen binding fragment" refers to a polypeptide fragment of an immunoglobulin or antibody that binds to an antigen or competes with an intact antibody (i.e., the intact antibody from which they are derived) for antigen binding (i.e., specific binding). Antigen binding fragments can be produced by recombinant or biochemical methods well known in the art. Exemplary antigen binding fragments include Fv, Fab, Fab' and (Fab')2. In certain exemplary embodiments, the binding polypeptide of the present disclosure comprises at least one antigen binding fragment and an Fc domain variant.

[0229] In some embodiments, the binding polypeptide comprises a single chain variable region sequence (ScFv). The single chain variable region sequence comprises a single polypeptide having one or more antigen binding sites, for example, a VL domain connected to a VH domain by a flexible linker. The ScFv molecule can be constructed in a VH-linker-VL orientation or a VL-linker-VH orientation. The flexible hinge connecting the VL and VH domains constituting the antigen binding site includes about 10 to about 50 amino acid residues. The connecting peptide is known in the art. The binding polypeptide may include at least one scFv and / or at least one constant region. In one embodiment, the binding polypeptide of the present disclosure may include at least one scFv connected or fused to an Fc domain variant.

[0230] In some embodiments, the binding polypeptide of the present disclosure is a multivalent (e.g., tetravalent) antibody produced by fusing a DNA sequence encoding an antibody with a ScFv molecule (e.g., a modified ScFv molecule). For example, in one embodiment, these sequences are combined so that the ScFv molecule (e.g., a modified ScFv molecule) is connected to an Fc domain variant via a flexible linker (e.g., a gly / ser linker) at its N-terminus or C-terminus. In another embodiment, the tetravalent antibody of the present disclosure can be prepared by fusing the ScFv molecule with a connecting peptide, which is fused to an Fc domain variant to construct a ScFv-Fab tetravalent molecule.

[0231] In another embodiment, the binding polypeptide of the present disclosure is a modified mini antibody. The modified mini antibody of the present disclosure is a dimer molecule composed of two polypeptide chains, each of which comprises a ScFv molecule fused via a connecting peptide and an Fc domain variant. Mini antibodies can be prepared by constructing ScFv components and connecting peptide components using the method described in the art (see, for example, U.S. Patent No. 5,837,821 or WO94 / 09817A1). In another embodiment, a tetravalent mini antibody can be constructed. A tetravalent mini antibody can be constructed in the same manner as a mini antibody, except that two ScFv molecules are connected using a flexible joint. The scFv-scFv construct connected is then connected to an Fc domain variant.

[0232] In another embodiment, the binding polypeptides disclosed herein include diabodies. Diabodies are tetravalent dimer molecules, each of which has a polypeptide similar to a scFv molecule, but generally have a short (less than 10, e.g., about 1 to about 5) amino acid residue linker connecting two variable domains, so that the VL and VH domains on the same polypeptide chain cannot interact with each other. In contrast, the VL and VH domains of one polypeptide chain (respectively) interact with the VH and VL domains on the second polypeptide chain (see, e.g., WO02 / 02781). The diabodies disclosed herein include scFv-like molecules fused to Fc domain variants.

[0233] In another embodiment, the binding polypeptides of the present disclosure comprise single domain antibodies (sdAbs), also known as VHHs or nanobodies. is a registered trademark of Ablynx. VHH comprises a variable heavy chain domain lacking a light chain. Similar to conventional VH domains, VHH contains four FRs and three CDRs. VHH have advantages over conventional antibodies. Because they are about ten times smaller than IgG molecules, correctly folded functional VHH can be produced by in vitro expression with high yields. In addition, VHH are very stable and resistant to the action of proteases. The properties and production of VHH have been reviewed by Harmsen and De Haard HJ (Appl. Microbiol. Biotechnol. 2007 November; 77(1): 13-22).

[0234] In certain exemplary embodiments, an Fc domain is fused to one or more VHHs.

[0235] In other embodiments, the binding polypeptide comprises a multispecific or multivalent antibody comprising one or more variable domains in series on the same polypeptide chain, e.g., a tandem variable domain (TVD) polypeptide. Exemplary TVD polypeptides include the "double-headed" or "double Fv" configuration described in U.S. Pat. No. 5,989,830. In the double Fv configuration, the variable domains of two different antibodies are represented in a tandem orientation on two separate chains (one heavy chain and one light chain), wherein one polypeptide chain has two VH domains in series (VH1-linker-VH2) optionally separated by a peptide linker, and the other polypeptide chain consists of complementary VL domains (VL1-linker-VL2) optionally connected in series by a peptide linker. In the cross double-head configuration, the variable domains of two different antibodies are represented in a tandem direction on two separate polypeptide chains (one heavy chain and one light chain), wherein one polypeptide chain has two VH domains (VH1-linker-VH2) in series, optionally separated by a peptide linker, and the other polypeptide chain consists of complementary VL domains (VL2-linker-VL1) optionally connected in series in the opposite direction by a peptide linker. Other antibody variants based on the "double Fv" format include dual variable domain IgG (DVD-IgG) bispecific antibodies (see U.S. Patent No. 7,612,181) and TBTI formats (see US2010 / 0226923 A1). In some embodiments, the binding polypeptide comprises a multispecific or multivalent antibody comprising one or more variable domains in series on the same polypeptide chain fused to an Fc domain variant.

[0236] In another embodiment, the binding polypeptide comprises a crossover dual variable domain IgG (CODV-IgG) bispecific antibody based on a “two-head” configuration (see US20120251541 A1, which is incorporated herein by reference in its entirety).

[0237] In other embodiments, the binding polypeptide comprises a CrossMab or CrossMab-Fab multispecific format (see WO2009080253 and Schaefer et al., PNAS [Proceedings of the National Academy of Sciences of the United States of America] (2011), 108: 11187-1191). Antibody variants based on the CrossMab format have a crossover of antibody domains within one arm of the bispecific IgG antibody, enabling correct chain association.

[0238] In other embodiments, the glycosylated effector-active polypeptide comprises a multispecific antibody in the form of a T cell engager. "T cell engager" refers to a binding protein for the host immune system (more specifically, the cytotoxic activity of T cells) and for a tumor target protein. In some embodiments, the separated effective effector-active polypeptide comprises a multispecific antibody in the form of a NK cell engager. "NK cell engager" refers to a binding protein comprising a monoclonal antibody fragment targeting an activating NK cell receptor, an antigen-specific targeting region, and an Fc region (Gauthier et al. Cell [Cell] (2019), 177: 1701-13).

[0239] The binding polypeptides of the present disclosure comprising the Fc domain variants described herein may include CDR sequences or variable domain sequences of a known "parent" antibody. In some embodiments, in addition to the modification of the Fc domain as disclosed herein, the parent antibody and the antibody of the present disclosure may share similar or identical sequences.

[0240] Crossover dual variable domains

[0241] In certain embodiments, a "crossover dual variable domain" or "CODV" refers to an antigen binding domain that specifically binds to at least one target antigen or at least one target epitope and comprises at least two polypeptide chains that form at least two antigen binding sites, wherein at least one polypeptide chain comprises a structure represented by the following formula:

[0242] VL1-L1-VL2-L2-CL[I]

[0243] And at least one polypeptide chain comprises a structure represented by the following formula:

[0244] VH2-L3-VH1-L4-CH1[II]

[0245] in:

[0246] VL1 is the first immunoglobulin light chain variable domain;

[0247] VL2 is the second immunoglobulin light chain variable domain;

[0248] VH1 is the first immunoglobulin heavy chain variable domain;

[0249] VH2 is the second immunoglobulin heavy chain variable domain;

[0250] CL is the immunoglobulin light chain constant domain;

[0251] CH1 is an immunoglobulin CH1 heavy chain constant domain; and

[0252] L1, L2, L3 and L4 are amino acid linkers, wherein any one or more of L1, L2, L3 and L4 are optionally absent, and

[0253] wherein the polypeptide of Formula I and the polypeptide of Formula II form a crossover light chain-heavy chain pair.

[0254] In certain exemplary embodiments, the binding protein of the present disclosure comprises a "CODV-OL1" form, which comprises three polypeptide chains forming two antigen binding sites, wherein one polypeptide chain comprises a structure represented by the following formula:

[0255] VL1-L1-VL2-L2-CL[I];

[0256] A polypeptide chain consists of the structure represented by the following formula:

[0257] VH2-L3-VH1-L4-CH1-hinge-CH2-CH3[III]; and

[0258] A polypeptide chain consists of the structure represented by the following formula:

[0259] Hinge-CH2-CH3[IV]

[0260] in:

[0261] CL is the immunoglobulin light chain constant domain;

[0262] CH1 is the immunoglobulin CH1 heavy chain constant domain;

[0263] CH2 is the immunoglobulin CH2 heavy chain constant domain;

[0264] CH3 is the immunoglobulin CH3 heavy chain constant domain;

[0265] The hinge is an immunoglobulin hinge region connecting the CH1 domain and the CH2 domain;

[0266] and

[0267] L1, L2, L3 and L4 are amino acid linkers, wherein any one or more of L1, L2, L3 and L4 are optionally absent, and

[0268] wherein the polypeptide of Formula I and the polypeptide of Formula II form a crossover light chain-heavy chain pair.

[0269] In certain embodiments, the CODV antigen binding domain specifically binds to at least one target antigen or at least one target epitope and comprises four polypeptide chains forming four antigen binding sites, wherein each of the two polypeptide chains comprises a structure represented by the following formula:

[0270] VL1-L1-VL2-L2-CL[I]

[0271] And the two polypeptide chains each comprise a structure represented by the following formula:

[0272] VH2-L3-VH1-L4-CH1-Fc[II]

[0273] in:

[0274] VL1 is the first immunoglobulin light chain variable domain;

[0275] VL2 is the second immunoglobulin light chain variable domain;

[0276] VH1 is the first immunoglobulin heavy chain variable domain;

[0277] VH2 is the second immunoglobulin heavy chain variable domain;

[0278] CL is the immunoglobulin light chain constant domain;

[0279] CH1 is the immunoglobulin CH1 heavy chain constant domain;

[0280] Fc is the immunoglobulin hinge region and the CH2 and CH3 immunoglobulin heavy chain constant domains; and

[0281] L1, L2, L3 and L4 are amino acid linkers, wherein any one or more of L1, L2, L3 and L4 are optionally absent, and

[0282] wherein the polypeptide of formula I and the polypeptide of formula II form a crossover light chain-heavy chain pair,

[0283] wherein the VH1 / VL1 pair has a first antigen binding specificity and the VH2 / VL2 pair has a second antigen binding specificity.

[0284] In certain embodiments, the antigen binding proteins described herein are trispecific and / or trivalent antigen binding proteins comprising four polypeptide chains that form three antigen binding sites that specifically bind to one or more different antigen targets, wherein the first polypeptide chain comprises a structure represented by the following formula:

[0285] VL2-L1-VL1-L2-CL[I]

[0286] The second polypeptide chain comprises a structure represented by the following formula:

[0287] VH1-L3-VH2-L4-CH1-hinge-CH2-CH3[II]

[0288] The third polypeptide chain comprises a structure represented by the following formula:

[0289] VH3-CH1-hinge-CH2-CH3[III]

[0290] And the fourth polypeptide chain comprises a structure represented by the following formula:

[0291] VL3-CL[IV],

[0292] in:

[0293] VL1 is the first immunoglobulin light chain variable domain;

[0294] VL2 is the second immunoglobulin light chain variable domain;

[0295] VL3 is the third immunoglobulin light chain variable domain;

[0296] VH1 is the first immunoglobulin heavy chain variable domain;

[0297] VH2 is the second immunoglobulin heavy chain variable domain;

[0298] VH3 is the third immunoglobulin heavy chain variable domain;

[0299] CL is the immunoglobulin light chain constant domain;

[0300] CH1 is the immunoglobulin CH1 heavy chain constant domain;

[0301] CH2 is the immunoglobulin CH2 heavy chain constant domain;

[0302] CH3 is the immunoglobulin CH3 heavy chain constant domain;

[0303] The hinge is an immunoglobulin hinge region connecting the CH1 domain and the CH2 domain; and

[0304] L1, L2, L3 and L4 are amino acid linkers, wherein any one or more of L1, L2, L3 and L4 are optionally absent, and

[0305] wherein the polypeptide of Formula I and the polypeptide of Formula II form a crossover light chain-heavy chain pair.

[0306] In certain embodiments, the first polypeptide chain and the second polypeptide chain have a cross orientation that forms two different antigen binding sites. In some embodiments, VH1 and VL1 form a binding pair and form a first antigen binding site. In some embodiments, VH2 and VL2 form a binding pair and form a second antigen binding site. In some embodiments, the third polypeptide and the fourth polypeptide form a third antigen binding site. In some embodiments, VH3 and VL3 form a binding pair and form a third antigen binding site.

[0307] This antigen binding protein comprises at least three antigen binding sites. It is at least a trivalent antigen binding molecule. In a particular embodiment, it specifically binds to one antigen target, i.e., it is a monospecific antigen binding molecule. In another embodiment, it specifically binds to two different antigen targets, i.e., it is a bispecific antigen binding molecule. In another embodiment, it specifically binds to three different antigen targets, i.e., it is a trispecific antigen binding molecule.

[0308] The examples listed above are not intended to limit the scope of the present disclosure in any way, and linkers comprising randomly selected amino acids selected from the group consisting of valine, leucine, isoleucine, serine, threonine, lysine, arginine, histidine, aspartic acid, glutamic acid, asparagine, glutamine, glycine and proline have been shown to be suitable in the antibody-like binding proteins described herein.

[0309] In certain embodiments of the binding protein, (a) L1, L2, L3 and L4 are each independently zero amino acids in length or comprise a sequence selected from the group consisting of GGGGSGGGGS, GGGGSGGGGSGGGGS, S, RT, TKGPS, GQPKAAP and GGSGSSGSGG; or (b) L1, L2, L3 and L4 each independently comprise a sequence selected from the group consisting of GGGGSGGGGS, GGGGSGGGGSGGGGS, S, RT, TKGPS, GQPKAAP and GGSGSSGSGG.

[0310] In certain embodiments, L1 and L2 each comprise the amino acid sequence GGGGSGGGGS.

[0311] In certain embodiments, L3 and L4 are each absent.

[0312] CODV antibody formats, various arrangements of CODV antibody formats, and additional details regarding linkers are further described in WO 2012 / 135345A1 and WO 2017 / 180913A2, which are incorporated herein by reference in their entirety.

[0313] Nucleic acids and vectors

[0314] In one aspect, polynucleotides encoding the binding proteins disclosed herein are provided. Also provided are methods of making the binding proteins, the methods comprising expressing the polynucleotides.

[0315] Typically, polynucleotides encoding the binding proteins disclosed herein are inserted into expression vectors for introduction into host cells, and these host cells can be used to produce the desired amount of the binding proteins claimed. Therefore, in certain aspects, the disclosure provides expression vectors comprising the polynucleotides disclosed herein and host cells comprising these vectors and polynucleotides.

[0316] For the purpose of this specification and claims, the term "vector" or "expression vector" is used herein to refer to a vector for introduction into a cell and expression of a desired gene in the cell. As known to those skilled in the art, such vectors can be easily selected from the group consisting of plasmids, bacteriophages, viruses and retroviruses. Typically, the vector will contain a selection marker, appropriate restriction sites to facilitate cloning of the desired gene, and the ability to enter and / or replicate in eukaryotic or prokaryotic cells.

[0317] Many expression vector systems can be used. For example, a class of vectors utilizes DNA elements derived from animal viruses, such as bovine papilloma virus, polyoma virus, adenovirus, vaccinia virus, baculovirus, retrovirus (RSV, MMTV or MOMLV) or SV40 virus. Others relate to the use of polycistronic systems with internal ribosome binding sites. In addition, cells that have been integrated into their chromosomes by DNA can be selected by introducing one or more markers, which allow the selection of transfected host cells. Markers can provide original nutrition, biocide resistance (such as antibiotics) or resistance to heavy metals (such as copper) for auxotrophic hosts. Selectable marker genes can be directly connected to the DNA sequence to be expressed or introduced into the same cell by co-transformation. The optimal synthesis of mRNA may also require other elements. These elements may include signal sequences, splicing signals and transcriptional promoters, enhancers and termination signals. In certain embodiments, cloned variable region genes are inserted into expression vectors together with synthetic heavy and light chain constant region genes (such as human genes) as discussed above.

[0318] In other embodiments, polycistronic constructs can be used to express glycosylated effector active polypeptides as described herein. In such expression systems, a variety of target gene products, such as heavy and light chains of antibodies, can be produced by a single polycistronic construct. These systems advantageously use internal ribosome entry sites (IRES) to provide relatively high levels of polypeptides in eukaryotic host cells. Compatibility IRES sequences are disclosed in U.S. Patent No. 6,193,980, which is incorporated herein by reference. Those skilled in the art will appreciate that such expression systems can be used to effectively produce the full range of polypeptides disclosed herein.

[0319] More generally, once a vector or DNA sequence encoding the binding protein disclosed herein is prepared, the expression vector can be introduced into a suitable host cell. That is, the host cell can be transformed. The introduction of a plasmid into a host cell can be accomplished by various techniques well known to those skilled in the art. These techniques include, but are not limited to, transfection (including electrophoresis and electroporation), protoplast fusion, calcium phosphate precipitation, cell fusion with envelope DNA, microinjection, and infection with a complete virus. See, for example, Ridgway, AAG "Mammalian Expression Vectors" Chapter 24.2, Pages 470-472 Vectors, Rodriguez and Denhardt, ed. (Butterworths, Boston, Massachusetts, 1988). The transformed cells are grown under conditions suitable for producing light and heavy chains, and heavy and / or light chain protein synthesis is determined. Exemplary assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) or fluorescence activated cell sorter analysis (FACS), immunohistochemistry, etc.

[0320] As used herein, the term "transformation" should be used in a broad sense to refer to the introduction of DNA into a recipient host cell, thereby changing the genotype and thereby causing a change in the recipient cell.

[0321] Along the same lines, "host cells" refers to cells that have been transformed with a vector constructed using recombinant DNA technology and encoding at least one heterologous gene. In the description of methods for isolating polypeptides from recombinant hosts, unless otherwise specifically stated, the terms "cells" and "cell culture" are used interchangeably to indicate the source of the antibody. In other words, recovering a polypeptide from a "cell" can mean recovering from whole cells that are spun down, or recovering from a cell culture containing culture medium and suspended cells.

[0322] In one embodiment, the host cell line used to express the binding protein is of eukaryotic or prokaryotic origin. In one embodiment, the host cell line used to express the binding protein is of bacterial origin. In one embodiment, the host cell line used to express the binding protein is of mammalian origin. Those skilled in the art can determine the specific host cell line that is most suitable for the desired gene product to be expressed therein. Exemplary host cell lines include, but are not limited to, DG44 and DUXB11 (Chinese hamster ovary line, DHFR-), HELA (human cervical cancer), CVI (monkey kidney line), COS (derivative of CVI with SV40 T antigen), R1610 (Chinese hamster fibroblasts), BALBC / 3T3 (mouse fibroblasts), HAK (hamster kidney line), SP2 / O (mouse myeloma), BFA-1c1BPT (bovine endothelial cells), RAJI (human lymphocytes), 293 (human kidney). In one embodiment, the cell line provides altered glycosylation of the antibody expressed therefrom, such as defucosylation (e.g., (Crucell) or FUT8 knockout CHO cell line (POTELLIGENT TM Cells) (Biowa, Princeton, New Jersey). In one embodiment, NS0 cells can be used. Host cell lines are typically available from commercial services, the American Tissue Culture Collection, or from published literature.

[0323] In vitro production allows for scale-up to produce large quantities of the desired binding proteins. Techniques for culturing mammalian cells under tissue culture conditions are known in the art and include homogenous suspension cultures (e.g., in airlift reactors or continuous stirred reactors), or immobilized or embedded cell cultures (e.g., in hollow fibers, microcapsules, on agarose microbeads or ceramic cartridges). If necessary and / or desired, solutions of polypeptides can be purified by conventional chromatography (e.g., gel filtration, ion exchange chromatography, DEAE-cellulose chromatography and / or (immuno) affinity chromatography).

[0324] One or more genes encoding glycosylated binding proteins can also be expressed in non-mammalian cells (such as bacteria or yeast or plant cells). In this regard, it should be understood that various unicellular non-mammalian microorganisms (such as bacteria) can also be transformed, that is, those that can grow in culture or fermentation. Easily transformed bacteria include members of the family Enterobacteriaceae, such as strains of Escherichia coli or Salmonella; Bacillaceae, such as Bacillus subtilis; Pneumococcus; Streptococcus and Haemophilus influenzae. It should also be understood that when expressed in bacteria, Fc domain variants and / or binding polypeptides can become part of inclusion bodies. The binding protein can be isolated, purified, and then assembled into a functional molecule.

[0325] In addition to prokaryotes, eukaryotic microorganisms can also be used. Saccharomyces cerevisiae or common baker's yeast is the most commonly used of eukaryotic microorganisms, although many other strains are generally available. For expression in Saccharomyces, for example, plasmid YRp7 (Stinchcomb et al., Nature [Natural], 282: 39 (1979); Kingsman et al., Gene [Gene], 7: 141 (1979); Tschemper et al., Gene [Gene], 10: 157 (1980)) is generally used. This plasmid already contains the TRP1 gene, which provides a selection marker (Jones, Genetics [Genetics], 85: 12 (1977)) for yeast mutant strains lacking the ability to grow in tryptophan (e.g., ATCC No. 44076 or PEP4-1). Then, the presence of trpl damage as a feature of the yeast host cell genome provides an effective environment for detecting transformation by growth in the absence of tryptophan.

[0326] Use / treatment methods

[0327] In one aspect, the disclosure provides methods for treating a disease or disorder in a subject in need thereof, comprising administering to the subject an effective amount of a binding protein disclosed herein. In certain embodiments, the disclosure provides kits and methods for treating diseases and disorders (e.g., cancer) in mammalian subjects in need of such treatment. In certain embodiments, the disclosure provides kits and methods for treating diseases and disorders (e.g., amyloidosis or multiple myeloma) in mammalian subjects in need of such treatment.

[0328] In certain embodiments, the disease is cancer. In certain embodiments, cancer is a blood cancer. In certain embodiments, the blood cancer is a plasma cell malignancy. In certain embodiments, the plasma cell malignancy is multiple myeloma. In certain embodiments, multiple myeloma is relapsed / refractory multiple myeloma, newly diagnosed multiple myeloma, or smoldering multiple myeloma. In certain other embodiments, the disease is light chain amyloidosis (LCA). In certain embodiments, LCA is relapsed / refractory LCA, newly diagnosed LCA, or smoldering LCA. The binding proteins disclosed herein can be used in many different applications. For example, in one embodiment, the subject binding protein can be used to reduce or eliminate cells with epitopes recognized by the binding protein. In another embodiment, the subject binding protein is effective in reducing the concentration of soluble antigens in the circulation or eliminating soluble antigens in the circulation. In another embodiment, the subject binding protein is effective as an NK cell conjugate. In one embodiment, Fc domain variants can reduce tumor size, inhibit tumor growth, and / or prolong the survival time of tumor-bearing animals. Therefore, the present disclosure also relates to methods of treating tumors in humans or other animals by administering to the humans or other animals a non-toxic, effective amount of a binding protein of the present disclosure.

[0329] In another embodiment, the subject binding protein can be used to treat other disorders, including but not limited to infectious diseases, autoimmune disorders, inflammatory disorders or cancer. The disease can optionally be specified as being characterized by cells (e.g., pathogenic cells, pathogenic B lymphocytes or other immune cells) expressing BCMA. For example, cancer cells, particularly hematological cancers or plasma cell malignancies can be characterized as expressing BCMA on the surface of cancer cells. Therefore, the present disclosure relates to methods for treating the following various conditions that would benefit from the use of a subject polypeptide having, for example, an enhanced half-life with an effective agonist activity.

[0330] Those skilled in the art will be able to determine by routine experimentation a non-toxic and effective amount of a binding protein for the purpose of treating a malignant tumor. For example, the therapeutically active amount of a binding protein disclosed herein may vary according to factors such as the disease stage (e.g., stage I vs. stage IV), age, sex, medical complications (e.g., immunosuppressive conditions or diseases), and body weight of the subject, as well as the ability of the modified antibody to elicit a desired response in the subject.

[0331] In general, the compositions provided in the present disclosure can be used to prophylactically or therapeutically treat any neoplasm that contains an antigenic marker that allows for targeting of cancer cells by binding proteins.

[0332] Treatment / use methods for multiple myeloma

[0333] In one aspect, the disclosure relates to the treatment and prevention of multiple myeloma.

[0334] The term "multiple myeloma (MM)" (also known as plasma cell myeloma, myeloma, or Kahler's disease) is a progressive blood cancer of plasma cells, which are a type of white blood cell that is usually responsible for producing antibodies. The disease is characterized by an excessive number of plasma cells in the bone marrow and an overproduction of intact monoclonal immunoglobulins or free monoclonal light chains. Clinically, the disease is diagnosed, staged, and treated based on multiple parameters, including myeloma tumor cell mass based on the amount of monoclonal (or myeloma) protein (M protein) in serum and / or urine, as well as hemoglobin and serum calcium concentrations, the number of osteolytic lesions based on bone examination, and the presence or absence of renal failure. Additional methods of characterizing the disease include the detection of greater than ten percent (10%) plasma cells in a bone marrow examination, the presence of soft tissue plasmacytomas, and the detection of free kappa and lambda serum immunoglobulin light chains. Bone marrow examinations are performed using standard histological and immunohistochemical techniques. Additional cytogenetics of bone marrow samples may be performed to determine prognosis. If clinically indicated due to its invasive nature, follow-up monitoring consists of chemical and bone marrow evaluations.

[0335] In certain embodiments, the methods of the present invention include treating patients with relapsed and / or refractory MM or patients with MM who have received one or more previous therapies for MM. In certain embodiments, multiple myeloma is relapsed / refractory multiple myeloma (RR / MM). In certain embodiments, the patient has received at least one or two previous therapies for multiple myeloma (e.g., thalidomide analogs (such as lenalidomide), proteasome inhibitors, or autologous stem cell transplantation (ASCT)), and has demonstrated disease progression in the last therapy or after completing the last therapy.

[0336] "Relapsed MM" refers to multiple myeloma that has been previously treated and progresses and requires initiation of additional therapy but does not meet the criteria for primary 'refractory' or relapsed and refractory MM. The clinical criteria used to determine relapse are well known to those skilled in the art. For example, the clinical criteria developed by the International Myeloma Working Group (IMWG) include an increase in serum M component >1 gm / dL, development of new soft tissue plasmacytomas or bone lesions, and an increase in the size of existing plasmacytomas or bone lesions.

[0337] "Refractory MM" refers to multiple myeloma that is unresponsive (e.g., fails to achieve a minimal response or has disease progression on therapy). In certain embodiments, the multiple myeloma is unresponsive to primary or salvage therapy, or has progressed within 60 days of the last therapy.

[0338] In certain embodiments, MM is "relapsed and refractory MM." "Relapsed and refractory MM" is disease that is unresponsive to salvage therapy (e.g., therapy administered after failure of treatment with first-line therapy), or that progresses within 60 days of the last therapy in patients who had achieved a minimal response or better at some point before their current course of disease progression.

[0339] In certain embodiments, the MM is primary refractory MM. Primary refractory MM is MM disease that is non-responsive in patients who have never achieved a minimal response or better with any therapy.

[0340] In certain embodiments, MM is precancerous or "smoldering" MM. Smoldering multiple myeloma is a precancerous condition that changes certain proteins in the blood and / or increases plasma cells in the bone marrow, but it does not cause disease symptoms. However, about half of patients diagnosed with the condition will develop multiple myeloma within 5 years. Patients are closely monitored for evidence of progression to active multiple myeloma. Patients are diagnosed with smoldering multiple myeloma if they meet certain of the following criteria: a blood test shows M protein > 3g / dl blood, or a 24-hour urine test shows 500mg or more of protein, or a bone marrow biopsy shows that plasma cells make up between 10% and 59% of the blood cells in the bone marrow; and there are no signs of abnormal bone lesions or kidney damage that may cause active myeloma. There are currently no approved treatments for smoldering multiple myeloma.

[0341] "Disease response" can be determined according to standard criteria for hematological malignancies and staging. Methods for evaluating disease response of hematological malignancies are known to those skilled in the art. For example, methods for evaluating disease response include performance status evaluation (such as Eastern Cooperative Oncology Group (ECOG) performance status) and International Myeloma Working Group response criteria (see Oken et al., Am. J. Clin. Oncol. [American Journal of Clinical Oncology] 1982; 5 (6): 649-655 and Kumar et al., Lancet Oncol. [Lancet Oncology] 2016; 17 (8): 328-346). Methods for evaluating disease response may also include quantification of disease markers, bone marrow biopsy and / or aspiration, radiological imaging of plasmacytomas, bone skeletal examination, M-protein quantification (serum and / or 24-hour urine) and serum free light chain levels or urine light chain levels, serum b2 microglobulin, lymph node biopsy, tumor radiological assessment (by X-ray, computed tomography (CT) scan, PET scan or magnetic resonance imaging (MRI)), and blood cell counts (including blast counts). This list of evaluation methods should be understood to be non-limiting.

[0342] Based on the results obtained from the evaluation of disease response, the disease response can then be stratified according to standard criteria for the underlying disease and classified as complete response or complete remission (CR), partial response (PR), stable disease (SD), or progressive disease (PD).

[0343] In another aspect, the present disclosure provides a method of treating or preventing multiple myeloma in a subject in need thereof, the method comprising administering to the subject a binding protein as disclosed herein, the binding protein comprising a first antigen binding domain having binding specificity for BCMA and a second antigen binding domain having binding specificity for a natural killer (NK) cell marker.

[0344] In one aspect, the disclosure provides a method of treating or preventing multiple myeloma in a subject in need thereof, the method comprising administering to the subject a binding protein comprising a first antigen binding domain having binding specificity for BCMA and a second antigen binding domain having binding specificity for a natural killer (NK) cell marker, wherein the first antigen binding domain comprises:

[0345] a. a first immunoglobulin heavy chain variable domain (VH1), comprising a HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), a HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and a HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); and

[0346] b. a first immunoglobulin light chain variable domain (VL1), which comprises a LCDR1 sequence comprising the amino acid sequence of CX1SSTGX2VTPX3X4YAN (SEQ ID NO:4), wherein X1 is R or A, X2 is T or A, X3 is S or G, and X4 is N or Y; a LCDR2 sequence comprising the amino acid sequence of DNNX5X6PP (SEQ ID NO:5), wherein X5 is S, I or N and X6 is R or K; and a LCDR3 sequence comprising the amino acid sequence of ALX7X8GX9QWV (SEQ ID NO:6), wherein X7 is W or Y, X8 is F or Y, and X9 is N or G.

[0347] In certain embodiments, the first antigen binding domain with binding specificity for BCMA comprises:

[0348] a. a first immunoglobulin heavy chain variable domain (VH1), comprising a HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), a HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and a HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); and

[0349] b. a first immunoglobulin light chain variable domain (VL1), which comprises a LCDR1 sequence comprising the amino acid sequence of CX1SSTGX2VTPX3X4YAN (SEQ ID NO:4), wherein X1 is R or A, X2 is T or A, X3 is S or G, and X4 is N or Y; a LCDR2 sequence comprising the amino acid sequence of DNNX5X6PP (SEQ ID NO:5), wherein X5 is S, I or N and X6 is R or K; and a LCDR3 sequence comprising the amino acid sequence of ALX7X8GX9QWV (SEQ ID NO:6), wherein X7 is W or Y, X8 is F or Y, and X9 is N or G.

[0350] In certain embodiments, the VL1 comprises:

[0351] a. LCDR1 sequence containing the amino acid sequence of CASSTGTVTPSNYAN (SEQ ID NO: 7), LCDR2 sequence containing the amino acid sequence of DNNSRPP (SEQ ID NO: 8), and LCDR3 sequence containing the amino acid sequence of ALWFGNQWV (SEQ ID NO: 9);

[0352] b. a LCDR1 sequence comprising the amino acid sequence of CRSSTGTVTPSNYAN (SEQ ID NO: 10), a LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 11), and a LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 12);

[0353] c. a LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPSNYAN (SEQ ID NO: 13), a LCDR2 sequence comprising the amino acid sequence of DNNIKPP (SEQ ID NO: 14), and a LCDR3 sequence comprising the amino acid sequence of ALWYGGQWV (SEQ ID NO: 15); or

[0354] d. a LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPGYYAN (SEQ ID NO: 16), a LCDR2 sequence comprising the amino acid sequence of DNNNKPP (SEQ ID NO: 17), and a LCDR3 sequence comprising the amino acid sequence of ALYYGGQWV (SEQ ID NO: 18).

[0355] In certain embodiments,

[0356] a. the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 55;

[0357] b. the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 50;

[0358] c. the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 51;

[0359] d. the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 52;

[0360] e. the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 53; or

[0361] f. The VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:54.

[0362] In certain embodiments,

[0363] a. the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO: 55;

[0364] b. the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO: 50;

[0365] c. the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO: 51;

[0366] d. the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO: 52;

[0367] e. the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO: 53; or

[0368] f. The VH1 comprises the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO:54.

[0369] In certain embodiments, the second antigen binding domain having binding specificity for a NK cell marker comprises:

[0370] a. a second immunoglobulin heavy chain variable domain (VH2), the second immunoglobulin heavy chain variable domain comprising:

[0371] i. a HCDR1 sequence comprising the amino acid sequence of DYVIN (SEQ ID NO: 80), a HCDR2 sequence comprising the amino acid sequence of EIYPGSGTNYYNEKFKA (SEQ ID NO: 81), and a HCDR3 sequence comprising the amino acid sequence of RGRYGLYAMDY (SEQ ID NO: 21);

[0372] ii. a HCDR1 sequence comprising SDYAWN (SEQ ID NO: 22), a HCDR2 sequence comprising YITYSGSTSYNPSLES (SEQ ID NO: 23), and a HCDR3 sequence comprising GGYYGSSWGVFAY (SEQ ID NO: 24);

[0373] iii. a HCDR1 sequence comprising EYTMH (SEQ ID NO: 25), a HCDR2 sequence comprising GISPNIGGTSYNQKFKG (SEQ ID NO: 26), and a HCDR3 sequence comprising RGGSFDY (SEQ ID NO: 27);

[0374] iv. a HCDR1 sequence comprising SFTMH (SEQ ID NO: 28), a HCDR2 sequence comprising YINPSSGYTEYNQKFKD (SEQ ID NO: 29), and a HCDR3 sequence comprising GSSRGFDY (SEQ ID NO: 30); or

[0375] v. a HCDR1 sequence comprising SDYAWN (SEQ ID NO: 31), a HCDR2 sequence comprising YITYSGSTNYNPSLKS (SEQ ID NO: 32), and a HCDR3 sequence comprising CWDYALYAMDC (SEQ ID NO: 33); and

[0376] b. a second immunoglobulin light chain variable domain (VL2), the second immunoglobulin light chain variable domain comprising:

[0377] i. a LCDR1 sequence comprising the amino acid sequence of RASQDISNYLN (SEQ ID NO: 34), a LCDR2 sequence comprising the amino acid sequence of YTSRLHS (SEQ ID NO: 35), and a LCDR3 sequence comprising the amino acid sequence of QQGNTRPWT (SEQ ID NO: 36);

[0378] ii. LCDR1 sequence containing RVSENIYSYLA (SEQ ID NO: 37), LCDR2 sequence containing NAKTLAE (SEQ ID NO: 38), and LCDR3 sequence containing QHHYGTPWT (SEQ ID NO: 39);

[0379] iii. LCDR1 sequence containing RASQSISDYLH (SEQ ID NO: 40), LCDR2 sequence containing YASQSIS (SEQ ID NO: 41), and LCDR3 sequence containing QNGHSFPLT (SEQ ID NO: 42);

[0380] iv. a LCDR1 sequence comprising RASENIYSNLA (SEQ ID NO: 43), a LCDR2 sequence comprising AATNLAD (SEQ ID NO: 44), and a LCDR3 sequence comprising QHFWGTPRT (SEQ ID NO: 45); or

[0381] v. LCDR1 sequence containing RTSENIYSYLA (SEQ ID NO: 46), LCDR2 sequence containing NAKTLAE (SEQ ID NO: 47), and LCDR3 sequence containing QHHYDTPLT (SEQ ID NO: 48).

[0382] In certain embodiments,

[0383] a. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 56, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 64;

[0384] b. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 57, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 65;

[0385] c. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 58, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 66;

[0386] d. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 59, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 67;

[0387] e. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 60, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 68;

[0388] f. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 61, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 69;

[0389] g. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 62, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 70; or

[0390] h. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:63, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:71.

[0391] In certain embodiments,

[0392] a. the VH2 comprises the amino acid sequence of SEQ ID NO: 56, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 64;

[0393] b. the VH2 comprises the amino acid sequence of SEQ ID NO: 57, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 65;

[0394] c. the VH2 comprises the amino acid sequence of SEQ ID NO: 58, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 66;

[0395] d. the VH2 comprises the amino acid sequence of SEQ ID NO: 59, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 67;

[0396] e. the VH2 comprises the amino acid sequence of SEQ ID NO: 60, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 68;

[0397] f. the VH2 comprises the amino acid sequence of SEQ ID NO: 61, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 69;

[0398] g. the VH2 comprises the amino acid sequence of SEQ ID NO: 62, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 70; or

[0399] h. The VH2 comprises the amino acid sequence of SEQ ID NO:63, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO:71.

[0400] In certain embodiments, the method further comprises all or part of an immunoglobulin Fc domain or a variant thereof.

[0401] In certain embodiments, the Fc domain is an IgG1 Fc domain. In certain embodiments, the Fc domain or variant thereof comprises a first Fc heavy chain and a second Fc heavy chain. In certain embodiments, the first Fc heavy chain or the second Fc heavy chain comprises a cysteine ​​pair.

[0402] In certain embodiments, the subject has received treatment or therapy prior to treatment with a NKCE as disclosed herein. In specific embodiments, the multiple myeloma is relapsed / refractory multiple myeloma.

[0403] Treatment / methods of use for light chain amyloidosis

[0404] In one aspect, the disclosure relates to the treatment and prevention of light chain amyloidosis (LCA).

[0405] In certain embodiments, the present disclosure provides kits and methods for treating diseases and disorders (e.g., amyloidosis) in mammalian subjects in need of such treatment. Current LCA standard of care is limited due to tolerability in such populations with frequent organ dysfunction. Therefore, there remains an unmet need for effective and safe additional therapeutic agents for LCA.

[0406] In another aspect, the present disclosure provides a method of treating or preventing light chain amyloidosis in a subject in need thereof, the method comprising administering to the subject a binding protein as disclosed herein, the binding protein comprising a first antigen binding domain having binding specificity for BCMA and a second antigen binding domain having binding specificity for a natural killer (NK) cell marker.

[0407] In one aspect, the disclosure provides a method of treating or preventing LCA in a subject in need thereof, the method comprising administering to the subject a binding protein comprising a first antigen binding domain having binding specificity for BCMA and a second antigen binding domain having binding specificity for a natural killer (NK) cell marker, wherein the first antigen binding domain comprises:

[0408] a. a first immunoglobulin heavy chain variable domain (VH1), comprising a HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), a HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and a HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); and

[0409] b. a first immunoglobulin light chain variable domain (VL1), which comprises a LCDR1 sequence comprising the amino acid sequence of CX1SSTGX2VTPX3X4YAN (SEQ ID NO:4), wherein X1 is R or A, X2 is T or A, X3 is S or G, and X4 is N or Y; a LCDR2 sequence comprising the amino acid sequence of DNNX5X6PP (SEQ ID NO:5), wherein X5 is S, I or N and X6 is R or K; and a LCDR3 sequence comprising the amino acid sequence of ALX7X8GX9QWV (SEQ ID NO:6), wherein X7 is W or Y, X8 is F or Y, and X9 is N or G.

[0410] In certain embodiments, the first antigen binding domain with binding specificity for BCMA comprises:

[0411] a. a first immunoglobulin heavy chain variable domain (VH1), comprising a HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), a HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and a HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); and

[0412] b. a first immunoglobulin light chain variable domain (VL1), which comprises a LCDR1 sequence comprising the amino acid sequence of CX1SSTGX2VTPX3X4YAN (SEQ ID NO:4), wherein X1 is R or A, X2 is T or A, X3 is S or G, and X4 is N or Y; a LCDR2 sequence comprising the amino acid sequence of DNNX5X6PP (SEQ ID NO:5), wherein X5 is S, I or N and X6 is R or K; and a LCDR3 sequence comprising the amino acid sequence of ALX7X8GX9QWV (SEQ ID NO:6), wherein X7 is W or Y, X8 is F or Y, and X9 is N or G.

[0413] In certain embodiments, the VL1 comprises:

[0414] a. LCDR1 sequence containing the amino acid sequence of CASSTGTVTPSNYAN (SEQ ID NO: 7), LCDR2 sequence containing the amino acid sequence of DNNSRPP (SEQ ID NO: 8), and LCDR3 sequence containing the amino acid sequence of ALWFGNQWV (SEQ ID NO: 9);

[0415] b. a LCDR1 sequence comprising the amino acid sequence of CRSSTGTVTPSNYAN (SEQ ID NO: 10), a LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 11), and a LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 12);

[0416] c. a LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPSNYAN (SEQ ID NO: 13), a LCDR2 sequence comprising the amino acid sequence of DNNIKPP (SEQ ID NO: 14), and a LCDR3 sequence comprising the amino acid sequence of ALWYGGQWV (SEQ ID NO: 15); or

[0417] d. a LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPGYYAN (SEQ ID NO: 16), a LCDR2 sequence comprising the amino acid sequence of DNNNKPP (SEQ ID NO: 17), and a LCDR3 sequence comprising the amino acid sequence of ALYYGGQWV (SEQ ID NO: 18).

[0418] In certain embodiments,

[0419] a. the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 55;

[0420] b. the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 50;

[0421] c. the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 51;

[0422] d. the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 52;

[0423] e. the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 53; or

[0424] f. The VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:54.

[0425] In certain embodiments,

[0426] a. the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO: 55;

[0427] b. the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO: 50;

[0428] c. the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO: 51;

[0429] d. the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO: 52;

[0430] e. the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO: 53; or

[0431] f. The VH1 comprises the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO:54.

[0432] In certain embodiments, the second antigen binding domain having binding specificity for a NK cell marker comprises:

[0433] a. a second immunoglobulin heavy chain variable domain (VH2), the second immunoglobulin heavy chain variable domain comprising:

[0434] i. a HCDR1 sequence comprising the amino acid sequence of DYVIN (SEQ ID NO: 80), a HCDR2 sequence comprising the amino acid sequence of EIYPGSGTNYYNEKFKA (SEQ ID NO: 81), and a HCDR3 sequence comprising the amino acid sequence of RGRYGLYAMDY (SEQ ID NO: 21);

[0435] ii. a HCDR1 sequence comprising SDYAWN (SEQ ID NO: 22), a HCDR2 sequence comprising YITYSGSTSYNPSLES (SEQ ID NO: 23), and a HCDR3 sequence comprising GGYYGSSWGVFAY (SEQ ID NO: 24);

[0436] iii. a HCDR1 sequence comprising EYTMH (SEQ ID NO: 25), a HCDR2 sequence comprising GISPNIGGTSYNQKFKG (SEQ ID NO: 26), and a HCDR3 sequence comprising RGGSFDY (SEQ ID NO: 27);

[0437] iv. a HCDR1 sequence comprising SFTMH (SEQ ID NO: 28), a HCDR2 sequence comprising YINPSSGYTEYNQKFKD (SEQ ID NO: 29), and a HCDR3 sequence comprising GSSRGFDY (SEQ ID NO: 30); or

[0438] v. a HCDR1 sequence comprising SDYAWN (SEQ ID NO: 31), a HCDR2 sequence comprising YITYSGSTNYNPSLKS (SEQ ID NO: 32), and a HCDR3 sequence comprising CWDYALYAMDC (SEQ ID NO: 33); and

[0439] b. a second immunoglobulin light chain variable domain (VL2), the second immunoglobulin light chain variable domain comprising:

[0440] i. a LCDR1 sequence comprising the amino acid sequence of RASQDISNYLN (SEQ ID NO: 34), a LCDR2 sequence comprising the amino acid sequence of YTSRLHS (SEQ ID NO: 35), and a LCDR3 sequence comprising the amino acid sequence of QQGNTRPWT (SEQ ID NO: 36);

[0441] ii. LCDR1 sequence containing RVSENIYSYLA (SEQ ID NO: 37), LCDR2 sequence containing NAKTLAE (SEQ ID NO: 38), and LCDR3 sequence containing QHHYGTPWT (SEQ ID NO: 39);

[0442] iii. LCDR1 sequence containing RASQSISDYLH (SEQ ID NO: 40), LCDR2 sequence containing YASQSIS (SEQ ID NO: 41), and LCDR3 sequence containing QNGHSFPLT (SEQ ID NO: 42);

[0443] iv. a LCDR1 sequence comprising RASENIYSNLA (SEQ ID NO: 43), a LCDR2 sequence comprising AATNLAD (SEQ ID NO: 44), and a LCDR3 sequence comprising QHFWGTPRT (SEQ ID NO: 45); or

[0444] v. LCDR1 sequence containing RTSENIYSYLA (SEQ ID NO: 46), LCDR2 sequence containing NAKTLAE (SEQ ID NO: 47), and LCDR3 sequence containing QHHYDTPLT (SEQ ID NO: 48).

[0445] In certain embodiments,

[0446] a. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 56, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 64;

[0447] b. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 57, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 65;

[0448] c. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 58, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 66;

[0449] d. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 59, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 67;

[0450] e. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 60, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 68;

[0451] f. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 61, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 69;

[0452] g. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 62, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 70; or

[0453] h. the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:63, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:71.

[0454] In certain embodiments,

[0455] a. the VH2 comprises the amino acid sequence of SEQ ID NO: 56, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 64;

[0456] b. the VH2 comprises the amino acid sequence of SEQ ID NO: 57, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 65;

[0457] c. the VH2 comprises the amino acid sequence of SEQ ID NO: 58, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 66;

[0458] d. the VH2 comprises the amino acid sequence of SEQ ID NO: 59, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 67;

[0459] e. the VH2 comprises the amino acid sequence of SEQ ID NO: 60, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 68;

[0460] f. the VH2 comprises the amino acid sequence of SEQ ID NO: 61, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 69;

[0461] g. the VH2 comprises the amino acid sequence of SEQ ID NO: 62, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 70; or

[0462] h. The VH2 comprises the amino acid sequence of SEQ ID NO:63, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO:71.

[0463] In certain embodiments, the method further comprises all or part of an immunoglobulin Fc domain or a variant thereof.

[0464] In certain embodiments, the Fc domain is an IgG1 Fc domain. In certain embodiments, the Fc domain or variant thereof comprises a first Fc heavy chain and a second Fc heavy chain. In certain embodiments, the first Fc heavy chain or the second Fc heavy chain comprises a cysteine ​​pair.

[0465] In certain embodiments, the NK cell marker is selected from NKp46, NKp30, NKp44, CD16, CD56, CD57, KIR receptors (e.g., KIR2DL1, KIR2DL2, KIR2DL3, KIR2DL5A, KIR2DL5B, KIR3DL1, KIR3DL2, and KIR3DL3), CD94, and NKG2. In certain embodiments, the NK cell marker is NKp46.

[0466] In certain embodiments, the method further comprises selecting a subject having light chain amyloidosis, wherein the selecting comprises:

[0467] a. Subjects diagnosed with light chain amyloidosis;

[0468] b. determining the stage of the disease based on a prognostic system as disclosed herein; and / or

[0469] c. Determining that the subject has not received a previous diagnosis of multiple myeloma.

[0470] In certain embodiments, the subject is treatment naive.

[0471] In certain embodiments, the subject has received or is receiving one or more treatments for light chain amyloidosis (e.g., chemotherapy, autologous stem cell transplantation, immunomodulatory drugs, immunotherapy, proteasome inhibitors, and any combination thereof). In certain embodiments, the subject has received at least one proteasome inhibitor.

[0472] In certain embodiments, the LCA is relapsed / refractory LCA.

[0473] In one aspect, the disclosure provides a method of treating or preventing LCA in a subject in need thereof, the method comprising administering to the subject a binding protein comprising a first antigen binding domain having binding specificity for BCMA and a second antigen binding domain having binding specificity for NKp46, wherein:

[0474] a. The first antigen binding domain comprises:

[0475] i. a first immunoglobulin heavy chain variable domain (VH1) comprising a HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), a HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and a HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); and

[0476] ii. a first immunoglobulin light chain variable domain (VL1) comprising a LCDR1 sequence comprising the amino acid sequence of CX1SSTGX2VTPX3X4YAN (SEQ ID NO: 4), wherein X1 is R or A, X2 is T or A, X3 is S or G, and X4 is N or Y; a LCDR2 sequence comprising the amino acid sequence of DNNX5X6PP (SEQ ID NO: 5), wherein X5 is S, I or N and X6 is R or K; and a LCDR3 sequence comprising the amino acid sequence of ALX7X8GX9QWV (SEQ ID NO: 6), wherein X7 is W or Y, X8 is F or Y, and X9 is N or G; and

[0477] b. The second antigen binding domain comprises:

[0478] i. a HCDR1 sequence comprising DYVIN (SEQ ID NO: 19), a HCDR2 sequence comprising EIYPGSGTNYYNEKFKA (SEQ ID NO: 20), and a HCDR3 sequence comprising RGRYGLYAMDY (SEQ ID NO: 21); and

[0479] ii. A LCDR1 sequence comprising RASQDISNYLN (SEQ ID NO: 34), a LCDR2 sequence comprising YTSRLHS (SEQ ID NO: 35), and a LCDR3 sequence comprising QQGNTRPWT (SEQ ID NO: 36).

[0480] In one aspect, the disclosure provides a method of treating or preventing LCA in a subject in need thereof, the method comprising administering to the subject a binding protein comprising a first antigen binding domain having binding specificity for BCMA and a second antigen binding domain having binding specificity for NKp46, wherein:

[0481] a. The first antigen binding domain comprises:

[0482] i. VH1, which VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:49; and

[0483] ii. VL1, which VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:55; and

[0484] b. The second antigen binding domain comprises:

[0485] i. VH2, which VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:56; and

[0486] ii. VL1, which contains

[0487] An amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:64.

[0488] In certain embodiments, the binding protein is administered intra-arterially, intraperitoneally, intramuscularly, subcutaneously, rectally, or vaginally. In certain embodiments, the binding protein is administered subcutaneously.

[0489] In certain embodiments, the Fc domain variant comprises ADE mutations (G236 / S239D / I332E) in CH2 to enhance ADCC activity.

[0490] In certain embodiments, the F domain variant comprises a disulfide substitution (R292C / V302C) in CH2 for stabilization.

[0491] In certain embodiments, the Fc domain variant comprises a knob-to-hole mutation (KIH) in CH3 to promote heterodimer formation in the Fc domain. In certain embodiments, the "knob" mutation is at position C482 / W494, and the "hole" mutation is at position C129 / S146 / A148 / V187. In some embodiments, the Fc domain variant comprises an RF mutation (H435R / Y436F) in one CH3 to facilitate purification of heterodimers in the Fc domain.

[0492] In certain embodiments, the disease is amyloidosis or amyloidosis. As used herein, the terms "amyloidosis" and "amyloidosis" refer to diseases or disorders belonging to plasma cell diseases. When amyloid accumulates in organs and interferes with normal physiological functions, amyloidosis or amyloidosis occurs. As used herein, the term "amyloid" refers to abnormal fibrous extracellular protein deposits found in organs and tissues. Amyloid is not usually found in vivo, but it can be formed by several different types of proteins. Amyloid is typically insoluble and structurally based on β sheet structure. Organs that may be affected include heart, kidney, liver, spleen, nervous system, skin and digestive tract. The term "amyloidosis" is used to refer to a group of diseases with a common feature (that is, extracellular deposition of pathological insoluble fibrin in organs and tissues).

[0493] A hallmark feature of amyloid disease is the production of amyloid, characterized by a fibrillar morphology of approximately 5-15 nm in diameter, which binds the dye Congo red and exhibits fluorescent birefringence when bound to the dye Thioflavin T. The fibers can form secondary structures called protofilaments, which are composed of pleated beta sheets that make them resistant to degradation. Toyama and Weissman (2011), Annu Rev Biochem, 80:557-585; Picken (2020), Acta Haematol, Vol. 143:322-334.

[0494] In certain embodiments, amyloidosis or amyloid disease is light chain amyloidosis or amyloid light chain amyloidosis. The current classification of amyloid is based on the type of amyloid. For example, amyloid is referred to as "A" (for amyloid), followed by the abbreviation of the protein type: AL (amyloid derived from immunoglobulin light chain). The term "amyloid light chain amyloidosis" or "light chain amyloidosis" or "LCA"; also known as AL amyloidosis, AL, ALA or AL primary amyloidosis, is the most common form of systemic amyloidosis in the United States and developed countries. Picken (2020), Acta Haematol [Hematology], Vol. 143: 322-334. Patients may show the first LCA (newly diagnosed LCA), or LCA may be recurrent and / or refractory (recurrent / refractory LCA). LCA is the most common form of systemic amyloidosis and is associated with underlying plasma cell disease. Abnormal plasma cells are derived from a single plasma cell source and secrete free light chains that form toxic fibrils. These plasma cells have been shown to be BCMA positive (Godara et al. 2019. Blood [blood] 134 (supplement 1): 4409). In certain embodiments, patients with LCA are untreated. In certain embodiments, patients with LCA have received or are receiving one or more treatments for light chain amyloidosis (e.g., chemotherapy, autologous stem cell transplantation, immunomodulatory drugs, immunotherapy, proteasome inhibitors, and any combination thereof).

[0495] In certain embodiments, binding proteins (including those comprising Fc domain variants) can be used in many different applications. For example, in one embodiment, the subject binding proteins can be used to reduce or eliminate cells with epitopes recognized by the binding domains of the Fc domain variants. In another embodiment, the subject Fc domain variants are effective in reducing the concentration of soluble antigens in the circulation or eliminating soluble antigens in the circulation. In another embodiment, the subject Fc domain variants are effective as T cell engagers.

[0496] In another embodiment, the subject binding proteins (including those comprising Fc domain variants) can be used to treat diseases or disorders associated with abnormal monoclonal B cells or plasma cells. In one embodiment, the abnormal monoclonal B cells or plasma cells express BCMA.

[0497] The binding protein can be particularly useful for treating diseases or disorders within the category of plasma cell disorders. In one embodiment, the plasma cell disorder is not multiple myeloma. In one embodiment, the plasma cell disorder is amyloidosis, e.g., LCA (also referred to as light chain amyloidosis, AL (primary) amyloidosis, systemic amyloidosis, AL or ALA).

[0498] LCA is a hematological disorder caused mainly by clonal plasma cells that produce misfolded immunoglobulin light chains. These abnormal light chains form toxic aggregates in plasma cells and deposit fibrils (amyloid) in organs and tissues, which leads to significant and sometimes permanent organ dysfunction. LCA can affect any organ except the brain. Li et al. (2019), J Int Med Res. [International Journal of Medical Research], 47 (4): 1778-1786. The mechanism by which amyloidogenic immunoglobulin light chains cause organ dysfunction has not been well characterized, but may be due to the cytotoxic effects of amyloid deposits and prefibrillar aggregates on one or more potential organs. Primary LCA is LCA that is neither associated with multiple myeloma nor considered a complication of multiple myeloma.

[0499] Symptoms depend on the underlying affected organs and are usually recognized late in the disease progression. Early signs and symptoms of LCA include, but are not limited to, swelling of the ankles and legs; severe fatigue and weakness (e.g., shortness of breath; numbness, tingling, or pain in the hands or feet), diarrhea or constipation, unintentional significant weight loss; enlarged tongue, skin changes (such as thickening or easy bruising, or purple patches around the eyes), irregular heartbeat, or difficulty swallowing. Clinical features of more severe LCA include cardiac, renal, hepatic, and gastrointestinal involvement and / or dysfunction, as well as neuropathy and macroglossia. Cardiac involvement (e.g., heart failure and arrhythmias) is the most common symptom of LCA and represents the single most adverse prognostic feature. Bianchi et al. (2021), Cardiooncology, Vol. 3:4.

[0500] Diagnostic criteria for LCA include (1) the presence of a systemic syndrome, (2) histological documentation of amyloid, (3) evidence of a monoclonal plasma cell disorder (e.g., based on bone marrow or lipoaspirate and / or targeted biopsy and serological parameters), and (4) amyloid typing to identify Ig light chains (via, e.g., LC-MS or immunoelectron microscopy). Koh (2020) Blood Res., 55(Suppl): S54-S57.

[0501] The disease outcome of LCA patients can be predicted based on a multi-stage prognostic system. There are currently four different prognostic models: (1) Mayo Model 2004 (Dispenzieri et al. (2004), J Clin Oncol., Vol. 22: 3751-7); (2) Mayo Model 2012 (Kumar et al. (2012), J Clin Oncol., Vol. 30: 989-95); (3) European Model 2015 (Muchtar et al. (2019), Leukemia, Vol. 33: 811-4); (4) Boston University Score 2019 (Lilleness et al. (2019), Blood, Vol. 133: 215-23). ​​The Mayo Model 2012 and the European Model 2015 showed the best predictive performance in a recent validation study. Vaxman et al. (2020) Blood Rev, 40:100636.

[0502] Autologous stem cell transplantation (ASCT) is the most effective treatment for patients with LCA. Sanchorawala (2020), Acta Haematol [Hematology], Vol. 143: 381-387. Cardiac biomarkers used to assess eligibility for ASCT are typically tested as troponin T levels > 0.06 ng / ml or NT-BNP precursor levels > 5000 ng / L, which are associated with high transplant-related mortality. Gavriatopoulou et al. (2018), Leukemia [Leukemia], Vol. 32: 1183-1898. Most LCA patients are not eligible for stem cell transplantation and can receive single or combination chemotherapy and / or immunotherapy regimens to eradicate underlying plasma cells. For intermediate-risk patients, standard treatment is oral melphalan / dexamethasone (Mdex), bortezomib-based regimens (BMDex or VCD). However, treatment-related mortality is high (24%). Same as above. Patients who fail to achieve a rapid response rate are considered for second-line treatment, namely immunomodulatory drugs (IMID). IIMIDs include thalidomide, lenalidomide and pomalidomide and their combinations with alkylating agents. However, immunotherapy is poorly tolerated in patients, especially those with cardiac LCA. Sidiqi and Gertz (2021), Blood Cancer Journal, Vol. 11: 90. Overall, the currently used LCA treatment regimens are often difficult for patients to tolerate, and patients often succumb to the persistent side effects of these treatments that frequently enhance disease symptoms. Hassan and Sanchorawala (2022), Hemato, Vol. 3: 38-46. Recently, based on the Phase 3 ANDROMEDA study (NCT03201965), daratumumab (anti-CD38)-VCD has been approved as a standard therapy for newly diagnosed LCA patients (Kastritis et al. 2021. NEJM, 385: 46-58).

[0503] A therapeutically effective amount of the NK cell engagers disclosed herein can be a dose or amount sufficient to induce a "therapeutic response" in a subject, such as an improvement in at least one measure of an amyloid disease, such as a decrease in the size of existing amyloid deposits or plaques, a decrease in the rate of amyloid deposition, or improved organ function as measured by standard techniques. Examples of common presenting signs that are characteristic of common target organs and examples of improved organ function are summarized below.

[0504] heart

[0505] Common presenting signs of amyloid deposits are dyspnea on exertion, orthopnea, paroxysmal nocturnal dyspnea, lower extremity edema, pleural effusion, jugular venous distension, arrhythmias, syncope, angina. A decrease in the patient's N-terminal b-type natriuretic peptide precursor (NT-BNP precursor) level or a decrease in the patient's New York Heart Association (NYHA) functional classification level can be an indication of cardiac improvement. Palladini et al. (2003), Circulation, Vol. 107: 2440-2445. Improved cardiac function can also be evaluated by measuring cardiac troponin levels, by analyzing cardiac MRI and echocardiography.

[0506] kidney

[0507] Common presenting signs of amyloid deposits in the kidneys are lower extremity edema, generalized edema, and uremia. Proteinuria, or the rate of protein excretion in the urine, and a decrease in the estimated glomerular filtration rate (eGFR) can be an indication of improved kidney function. Kidney Int. Suppl [International Kidney Supplement] (2011), Vol. 3(1): 19-62.

[0508] liver

[0509] The common presentation signs of amyloid deposits in the liver are right upper quadrant tenderness, hepatomegaly, ascites and / or oliguria. The alkaline phosphatase (ALP) level and serum γ-glutamyl transferase (GGT) level that are improved can be the indication of improved liver function. Due to other metrics such as hyperlipidemia, coagulation disorders, thrombocytopenia, prothrombin time (PT), erythrocyte sedimentation rate, alanine aminotransferase (ALT) and / or aspartate aminotransferase (AST), serum albumin and complement fragment levels, hepatic amyloidosis lacks specificity, so when these parameters are evaluated before any treatment, the improvement of these parameters can also indicate the improvement of liver function. Park et al. (2003), Medicine [medicine], 82 (5) volume: 291-298.

[0510] GI Road

[0511] Common presenting symptoms of amyloid deposits in the gastrointestinal (GI) tract are loss of gastrointestinal motility, gastrointestinal bleeding, malabsorption, weight loss, anorexia, vomiting, nausea, hematomas, erosions, and ulcers or nodular gastritis. Improved GI tract function can be assessed using conventional imaging (e.g., echography, computed tomography scanners, X-rays, endoscopy).

[0512] Nervous system

[0513] A common presenting symptom of amyloid deposits near or in nerves is sensorimotor polyneuropathy, which is characterized by symptoms of neuropathic pain, numbness, and weakness in advanced cases. Improvement in nervous system function can be evaluated by electrophysiological tests, such as nerve conduction studies (NCS), electromyography (EMG), autonomic function testing (AFT), and quantitative sudomotor axon reflex testing (QSART).

[0514] Those skilled in the art will be able to determine by routine experimentation the non-toxic and effective amount of the binding protein or Fc domain variant for the purpose of treating LCA. For example, the therapeutically active amount of the binding protein (including those comprising the Fc domain variants disclosed herein) may vary according to factors such as the prognostic staging system, age, sex, medical complications (e.g., immunosuppressive conditions or diseases) and body weight of the subject, as well as the ability of the modified antibody to elicit the desired response in the subject. The dosage regimen may be adjusted to provide the optimal therapeutic response. For example, several divided doses may be administered daily, or the dosage may be reduced proportionally as indicated by the urgency of the therapeutic situation.

[0515] In general, the compositions provided in the present disclosure can be used to prophylactically or therapeutically treat any neoplasm that contains an antigenic marker that allows for targeting of cancer cells by binding proteins, including those containing Fc domain variants.

[0516] The binding protein of the present disclosure can be administered multiple times. The interval between single doses can be weekly, monthly or annual. The interval can also be irregular, as indicated by measuring the blood level of the binding protein or antigen in the patient. In some methods, the dosage is adjusted to reach a plasma modified binding polypeptide concentration of about 1-1000 μg / ml, and in some methods it is about 25-300 μg / ml. Alternatively, the binding protein can be administered as a sustained release formulation, in which case a lower frequency of administration is required. For antibodies, dosage and frequency vary according to the half-life of the antibody in the patient. Typically, humanized antibodies show the longest half-life, followed by chimeric antibodies and non-human antibodies.

[0517] The dosage and frequency of administration can vary depending on whether the treatment is preventive or therapeutic. In preventive applications, a composition containing the polypeptide of the present invention or its mixture is applied to a patient who is not yet in a disease state to enhance the patient's resistance. Such an amount is defined as a "preventive effective dose". In this use, the exact amount depends again on the patient's health status and general immunity, but generally ranges from about 0.1 to about 25 mg / dose, especially from about 0.5 to about 2.5 mg / dose. A relatively low dose is administered at relatively infrequent intervals over a long period of time. Some patients continue to receive treatment for the rest of their lives. In therapeutic applications, it is sometimes necessary to administer a relatively high dose (e.g., about 1 to 400 mg / kg antibody / dose, about 5 to 25 mg doses are more commonly used for radioimmunoconjugates, and higher doses are more commonly used for cytotoxin-drug modified antibodies) at relatively short intervals until disease progression is reduced or terminated, or until the patient shows partial or complete improvement of disease symptoms. Thereafter, a preventive regimen can be administered to the patient.

[0518] The binding proteins disclosed herein (including those comprising Fc variants) can be optionally administered in combination with other agents for effectively treating the disorder or condition requiring treatment (e.g., preventive or therapeutic). The effective single therapeutic dose (i.e., therapeutically effective amount) of the modified antibody labeled with 90Y of the present disclosure ranges between about 5 and about 75mCi, such as between about 10 and about 40mCi. The effective single therapeutic non-bone marrow ablation dose of the antibody modified with 131I ranges between about 5 and about 70mCi or between about 5 and about 40mCi. The effective single therapeutic ablation dose (i.e., autologous bone marrow transplantation may be required) of the antibody labeled with 131I ranges between about 30 and about 600mCi, such as between about 50 and less than about 500mCi. In conjunction with chimeric antibodies, due to the longer circulating half-life relative to murine antibodies, the effective single therapeutic non-bone marrow ablative dose of chimeric antibodies labeled with iodine-131 ranges from about 5 to about 40 mCi, such as less than about 30 mCi. For example, imaging standards labeled with 111In are typically less than about 5 mCi.

[0519] Although the binding protein can be administered as just described above, it must be emphasized that in other embodiments, the polypeptide can be administered as a first-line therapy to otherwise healthy patients. In such embodiments, the binding protein can be administered to patients with normal or average red bone marrow reserves and / or patients who have not been and are not currently undergoing treatment. As used herein, the polypeptide is administered in conjunction with or in combination with adjuvant therapy, meaning sequential, simultaneous, coextensive, concurrent, concomitant or concurrent administration or application of therapy and the disclosed antibody. It will be appreciated by those skilled in the art that the various components of the combined treatment regimen can be administered or applied regularly to enhance the overall effectiveness of the treatment.

[0520] As previously discussed, the binding proteins of the present disclosure (including those comprising Fc variants) can be administered in a pharmaceutically effective amount for in vivo treatment of mammalian disorders. In this regard, it will be appreciated that the disclosed binding proteins are formulated to facilitate administration of the active agent and promote its stability.

[0521] Pharmaceutical compositions and their administration

[0522] The method of preparing the associated protein of the present disclosure and applying it to the subject is well known to those skilled in the art or is easily determined. The route of administration of the associated protein of the present disclosure can be oral, parenteral, by inhalation or local. The term parenteral as used herein includes intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal or vaginal administration. Although all these forms of administration are clearly contemplated within the scope of the present disclosure, the form of administration will be a solution for injection, particularly for intravenous or intraarterial injection or infusion or for subcutaneous administration. Generally, suitable pharmaceutical compositions for injection can include buffer (e.g., acetate, phosphate or citrate buffer), surfactant (e.g., polysorbate), optionally stabilizer (e.g., human albumin) etc. In certain embodiments, Fc domain variants can be directly delivered to the site of harmful cell populations, thereby increasing the exposure of diseased tissues to therapeutic agents.

[0523] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions and emulsions. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. In the compositions and methods of the present disclosure, pharmaceutically acceptable carriers include but are not limited to 0.01-0.1M (e.g., 0.05M) phosphate buffer or 0.8% saline. Other common parenteral vehicles include sodium phosphate solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's solution or fixed oil. Intravenous vehicles include fluid and nutrient supplements, electrolyte supplements, such as those based on Ringer's dextrose, etc. Preservatives and other additives may also be present, such as antimicrobial agents, antioxidants, chelating agents and inert gases, etc. More specifically, pharmaceutical compositions suitable for injection include sterile aqueous solutions (in the case of water-soluble) or dispersions and sterile powders for the temporary preparation of sterile injectable solutions or dispersions. In such cases, the composition must be sterile and should be a fluid with a degree of ease of injection. It should be stable under manufacturing and storage conditions, and will be typically preserved against the contamination of microorganisms (such as bacteria and fungi). The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (such as, glycerol, propylene glycol and liquid polyethylene glycol, etc.) and suitable mixtures thereof. Suitable fluidity can be maintained, for example, by using a coating (such as lecithin), by maintaining a desired particle size in the case of a dispersion, and by using a surfactant.

[0524] In many cases, isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride will be included in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0525] In any case, sterile injectable solutions can be prepared in the following manner: the active compound (e.g., the binding protein of the present disclosure) is mixed in a suitable solvent with a component or component combination (as required) listed herein in the required amount, followed by filtration sterilization. Typically, a dispersion is prepared by mixing the active compound into a sterile vehicle containing a basic dispersion medium and other required components from those listed above. In the case of sterile powders for preparing sterile injectable solutions, exemplary preparation methods include vacuum drying and freeze drying, which produce powders of active ingredients plus any additional required ingredients from previously sterile filtered solutions. According to methods known in the art, the preparations for injection are processed, filled into containers (such as ampoules, bags, bottles, syringes or vials), and sealed under aseptic conditions. In addition, the preparations can be packaged and sold in the form of a kit. Such products will typically have a label or package insert indicating that the relevant composition can be used to treat subjects suffering from or susceptible to autoimmune disorders or tumor disorders.

[0526] The effective dose of the disclosed compositions for treating the above-mentioned conditions varies according to many different factors, including the mode of administration, the target site, the physiological state of the patient, whether the patient is human or animal, other agents administered, and whether the treatment is preventive or therapeutic. Typically, the patient is human, but non-human mammals, including transgenic mammals, may also be treated. The therapeutic dose may be adjusted stepwise using conventional methods known to those skilled in the art to optimize safety and efficacy.

[0527] According to the pharmaceutical composition disclosed herein, a pharmaceutically acceptable non-toxic sterile carrier may be included, such as physiological saline, non-toxic buffer, preservative, etc. For the purpose of the present application, the pharmaceutically effective amount of the binding protein should be maintained to mean an amount sufficient to achieve effective binding with the antigen and achieve a benefit (e.g., improving the symptoms of a disease or disorder or detecting a substance or cell). In the case of tumor cells, the polypeptide can interact with the selected antigen on the neoplastic or immunoreactive cells and provide an increase in the death of these cells. Of course, the pharmaceutical composition disclosed herein can be administered in a single dose or multiple doses to provide a pharmaceutically effective amount of the modified binding polypeptide.

[0528] In keeping with the scope of this disclosure, the binding proteins of this disclosure can be applied to humans or other animals in an amount sufficient to produce a therapeutic or preventive effect according to the above-mentioned treatment methods. The binding proteins of this disclosure can be applied to such humans or other animals in conventional dosage forms (prepared by combining the antibodies of this disclosure with conventional pharmaceutically acceptable carriers or diluents according to known techniques). Those skilled in the art will recognize that the form and characteristics of the pharmaceutically acceptable carrier or diluent are determined by the amount of the active ingredient combined therewith, the route of administration, and other well-known variables. Those skilled in the art will further appreciate that a mixture comprising one or more of the binding polypeptides described in this disclosure can be proven to be particularly effective.

[0529] The contents of the articles, patents, and patent applications mentioned or cited herein, and all other literature and electronically available information are hereby incorporated by reference in their entirety, to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicants reserve the right to physically incorporate into this application any and all materials and information from any such articles, patents, patent applications, or other physical and electronic documents.

[0530] Although the disclosure has been described with reference to the specific embodiments of the disclosure, it will be appreciated by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the disclosure. It will be readily apparent to those skilled in the art that other suitable modifications and adaptations may be made to the methods described herein using suitable equivalents without departing from the scope of the embodiments disclosed herein. In addition, many modifications may be made to adapt specific circumstances, materials, compositions of matter, methods, one or more method steps to the purpose, spirit and scope of the disclosure. All such modifications are intended to fall within the scope of the appended claims. Having now described certain embodiments in detail, these embodiments will be more clearly understood by reference to the following examples, which are included for illustrative purposes only and are not intended to be restrictive.

[0531] Examples

[0532] The present disclosure is further illustrated by the following examples, which should not be construed as further limiting.

[0533] Example 1: Design of NKp46-BCMA NKCE binding protein

[0534] introduction

[0535] To date, anti-tumor therapy has focused on manipulating effector T cells. T cell engager formats are in clinical development, but their use is limited to hematological diseases due to potential toxicity. In contrast, manipulating NK cells in cancer via NKCE is a therapeutic alternative because NK cells have anti-tumor effector potential and a favorable toxicity profile when compared to effector T cells. Figure 1A The diagram shows NKp46 NKCE, one arm of which binds to an antigen on the surface of a tumor cell and the other arm binds to the NKp46 receptor on a NK cell.

[0536] NKp46 NKCE (e.g., engineered with a unique Fc format (i.e., NKp46-BCMA_CODV-OL1_Fc-ADE-DSB) Figure 1B ) binds to BCMA on the surface of tumor cells, and also binds to both NKp46 and the Fcγ receptor CD16a. Its novel enhanced Fc-active form induces ADCC activity. The novel enhanced Fc-active form (hereinafter referred to as "CODV-OL1-ADE-DSB") includes: (1) ADE mutations in CH2 (G236A / S239D / I332E) to enhance ADCC activity; (2) DSB in CH2 (R292C / V302C) for thermal stability; (3) knob-hole structure mutations (KIH) in CH3 to facilitate heterodimer formation in Fc - (3a) knob (in the heavy chain containing VH / VL domains): S354C / T366W and (3b) hole (in the heavy chain lacking VH / VL domains): Y349C / T366S / L368A / Y407V; and (4) an RF mutation in CH3 (H435R / Y436F) to facilitate the purification of heterodimers in Fc. The NKp46-BCMA NKCE_Fc CODV-OL1-ADE-DSB contained two additional linkers GGGGSGGGGS in the light chain: one between VL anti-BCMA and VL anti-NKp46, and one between VL NKp46 and CL.

[0537] Materials and methods – Human recombinant proteins, cloning, production, purification

[0538] Recombinant Human NKp46 – Cloning, Production and Purification

[0539] The sequence (Gln22-Asn255, NCBI reference: NM_004829.5) encoding the extracellular domain (ECD) of human NKp46 was inserted into an expression vector and a C-terminal 6xHis tag was added for purification. PCR of human PBMC was performed using the following primers: 5'TACGACTCACAAGCTTGCCGCCACCATGTCTTCCACACTCCCTGC 3' (SEQ ID NO: 107) and 5'CCGCCCCGACTCTAGATCAATGGTGATGGTGGTGATGATTCTGGGCAGTGTGATCCC 3' (SEQ ID NO: 108). The sequence of the amplicon was checked. The vector was then used to transfect the CHO cell line, and clones producing the protein were selected. The protein was purified from culture supernatants using Ni-NTA beads (Qiagen, #1018244) and subjected to S200 size exclusion chromatography to ensure elimination of aggregates prior to downstream interrogation to characterize binding kinetics using surface plasmon resonance (SPR).

[0540] The sequence encoding the ECD (Pro22-Asn254, NP_001271509.1) of cynomolgus monkey NKp46 was cloned into an expression vector, and a C-terminal Flag-M2 tag for purification was added. The primers used to amplify the expected sequence from cynomolgus monkey PBMC were: 5'TACGACTCACAAGCTTGCCGCCACCATGTCTTCCACACTCCGTGC 3' (SEQ ID NO: 109) and 5'CCGCCCCGACTCTAGATCACTTGTCATCGTCATCTTTGTAATCATTCTGGGCAGTGTGGTCC 3' (SEQ ID NO: 110). After sequence verification, the CHO-K1SV cell line was transfected with the vector, and the cell clones produced were selected. The first three batches were purified by M2 affinity chromatography. The beads were incubated overnight with the supernatant containing the recombinant protein. The beads were then washed with PBS1X and eluted with 150ng / μl of eluted peptide in PBS1X. The proteins were then dialyzed against PBS 1X. According to the manufacturer's instructions (GE Healthcare, #20381, batch QB213815), the next batch was purified by affinity chromatography by coupling anti-NKp46 antibody to AminoLink coupled resin. The beads were then incubated overnight with the supernatant containing the recombinant protein. The beads were then washed with PBS 1X and eluted using 0.1M pH 2.5 glycine. The proteins were then dialyzed against TBS buffer pH 7.5 and concentrated to prepare size exclusion chromatography on Superdex 200Increase 10 / 300GL posts.

[0541] Recombinant human BCMA – cloning, production and purification

[0542] To generate recombinant human BCMA (TNFRSF17), a HEK293 codon-optimized synthetic DNA fragment encoding the extracellular domain of human BCMA fused to diphtheria toxin fragment A (DTA) and a His6 purification tag was ordered from Atum (Newark, CA, USA). The synthesized DNA fragments were cloned into the pTT5 mammalian expression vector by cloning technology (Life Technologies - ThermoFisher Scientific, Carlsbad, CA, USA) to generate recombinant plasmids for heterologous expression in mammalian cells.

[0543] Using commercially available scheme, Expi293F cells (Thermo Fisher Scientific) were transfected with plasmid DNA. Cells were harvested after 6 days of growth, and conditioned medium (CM) was collected by centrifugation. Ni-NTA agarose (Qiagen) was used to purify proteins. By rotating 5min with 1000xg and decantation / adding fresh PBS each time, resin was balanced three times in the PBS of pH 7.2. Balanced resin was added to the roller bottle with CM, and rotated at room temperature for 1 hour. Every 200ml of conditioned medium used 1ml of resin. After incubation, CM / resin slurries were poured into a gravity drop column and washed with 10CV of PBS pH 7.2. 10CV 600mM imidazole eluted proteins were used in PBS. Eluate was buffer exchanged into PBS pH 7.2, and concentrated using AmiconUltra-15 centrifugal filter (Millipore). Preparative SEC was performed using a Superdex 200 (16 / 60) column (Cytiva Life Sciences) run in PBS. Final samples were pooled and concentrated in PBS to a final concentration of >5 mg / ml.

[0544] CODV-OL1 molecule – production and purification

[0545] Expression plasmids encoding the different chains of the corresponding constructs were propagated in E. coli DH5a. Plasmids for transfection were prepared from E. coli using the EndoFree Plasmid Mega Kit (Qiagen).

[0546] HEK 293-FS cells grown in F17 serum-free suspension culture (Invitrogen) were transfected with the indicated plasmids using polyethyleneimine transfection reagent. After 6 days of culture at 37°C under 8% CO2, cells were removed by centrifugation and the supernatant was passed through a 0.22 μm filter to remove particulates.

[0547] Proteins were captured on MabSelect SuRe (Sterofam) and eluted with 0.1 M citrate buffer pH 3.0 and neutralized with 1 M Tris pH 9. The proteins were used for further characterization after purification by size exclusion chromatography (SEC) using Superdex200 26 / 60 (Sterofam) and 0.22 μm filtration and UV280 concentration determination.

[0548] Recombinant control samples

[0549] The following human and cynomolgus monkey recombinant proteins were produced and purified at Innate Pharma as described previously (LG Cell 2019): human NKp46 (Gln22-Asn255, NCBI Ref: NM_004829.5), human neonatal Fc receptor (FcRn, NCBI Ref: P55899), human CD16a (human FcγRIIIA V and F isotypes, NCBI Ref: AAH36723), human CD32a (human FcγRIIA, NCBI Ref: AAH20823), human CD32b (human FcγRIIB, NCBI Ref: NP_003992), human CD16b (human FcgRIIIB, NCBI Ref: AAI28563), human CD64 (human FcγRI, NCBI Ref: P12314), cynomolgus monkey NKp46 (Gln17-Asn255, NCBI Ref: NM_004829.5), human neonatal Fc receptor (FcRn, NCBI Ref: P55899), human CD16a (human FcγRIIIA V and F isotypes, NCBI Ref: AAH36723), human CD32a (human FcγRIIA, NCBI Ref: AAH20823), human CD32b (human FcγRIIB, NCBI Ref: NP_003992), Asn254, NP_001271509.1), cynomolgus FcRn (NCBI reference: Q8SPV9), cynomolgus CD16 (NCBI reference: NP_001270121.1), cynomolgus CD32a (NCBI reference: NP_001270598.1), cynomolgus CD32b (NCBI reference: NP_001271060.1) and cynomolgus CD64 (NCBI reference: AAL92095.1). Recombinant human BCMA was purchased from ACRO Biosystems.

[0550] Table 1. Example anti-NKp46-1 CDRs

[0551]

[0552]

[0553] Example 2: Determination of BCMA receptor density on a panel of myeloid myeloma cell lines

[0554] introduction

[0555] The expression of B cell maturation antigen (BCMA) has been proposed as a marker for identifying malignant plasma cells in multiple myeloma (MM) patients. Almost all MM tumor cells express BCMA, while the expression of normal tissues is limited to plasma cells and mature B cell subsets. Friedman et al. (2018) Hum Gene Ther. [Human Gene Therapy] 29 (5): 585-601. In order to determine the number of BCMA molecules per cell, a flow cytometry-based BCMA receptor assay was used to quantify the surface expression of BCMA, and then MM cell lines were selected, which would be suitable choices for downstream analysis of BCMA antibodies.

[0556] A list of MM cell lines used in this study is shown in Table 2 below.

[0557] Table 2: Group of MM cell lines

[0558]

[0559]

[0560] Materials and Methods – For determination of antigen binding to BCMA expressed on the surface of MM cell lines by flow cytometry Capability analysis procedures.

[0561] Experimental setup

[0562] For BCMA density determination, a CELLQUANT calibrator (Biocytex, Ref: 7208) was used. First, 200,000 MM cells (see the following list for all tested cell lines) were seeded in 100 mL of 1X (diluted 1 / 10 in distilled water) reagent 1 + 10 mL human FcR blocking agent (Miltenyi Biotec, Bergisch Gladbach, Ref. 130-059-901) in a 96-well round bottom plate (TPP, Trasadingen, Ref. 92097) at 4°C for 15 min.

[0563] Then, the MM cells were spun down at 300 g for 5 min, and the supernatant was removed. 50 mL of 10 mg / mL mouse anti-human BCMA antibody (BD BioLegend, clone 19F2, reference 357502, stock concentration 0.5 mg / mL, diluted 1 / 50 by mixing 5 mL anti-BCMA with 245 mL 1X reagent 1) was added, followed by incubation at 4°C for 30 min.

[0564] For isotype control, 50 mL of 10 mg / mL purified mouse IgG2aκ isotype control (BD BioLegend, Ref. 400201, stock concentration 0.5 mg / mL, diluted 1 / 50 by mixing 5 mL IgG2a with 245 mL 1X Reagent 1) was added instead, followed by incubation at 4°C for 30 min.

[0565] Two consecutive washing steps were performed by adding 200 mL of 1X reagent 1 in the wells, followed by centrifugation at 2000 rpm for 1 min at 4 ° C. After removing the supernatant, the cells were resuspended in 50 mL of anti-mouse IgGFITC secondary antibody (reagent 3 in the Biocytex kit, reference 7208, for 15 mL, 1.5 mL reagent 3 + 13.5 mL reagent 1) previously diluted 1 / 10 in 1X reagent 1. 50 mL containing calibration beads was added to the wells dedicated to calibration (reagent 2 in the Biocytex kit), and finally 5 mL of reagent 3 was added to the calibration wells (undiluted) to make it under the same staining conditions as the cells. The 96-well plate was then incubated at 4 ° C in the dark for 20 min.

[0566] Three consecutive washing steps were performed by adding 200 mL of 1X reagent 1 to the wells, followed by centrifugation at 2000 rpm for 1 min at 4° C. After removal of the supernatant, the cells were resuspended in 100 mL of cold PBS before reading with a MACSQuant Analyzer 10 or MACSQuant VYB (Miltenyi Biotec, Bergisch Gladbach).

[0567] Acquisition was performed on the B1 channel for FITC staining and on the V1 channel for DAPI staining (cell viability marker).

[0568] Calculation of BCMA density

[0569] To determine BCMA density on MM cell lines based on FITC fluorescence, a linear calibration curve was generated using the calibration bead information as shown in Table 3 below.

[0570] Table 3: Antigen Binding Capacity Bead Staining to Create a Standard Curve

[0571]

[0572] For analysis, calculate the BCMA density of each cell type using the following formula:

[0573] BCMA density = 10 (log(FUTC BCMA)*a+b) -10 (log(FITC同种型)*a+b)

[0574] result

[0575] Calculation of the BCMA density of each cell in the group of MM cell lines reveals that the EJM cell line has the highest level of BCMA density on the cell surface relative to other MM cell lines used in the group, and the MM1S cell line has the lowest level of BCMA density on the cell surface. Figure 2 shows the MM cell lines in descending order of the BCMA density of each cell. Based on these results, cell lines were selected for downstream studies that interrogated the binding affinity of NKp46-BCMA_Fc to BCMA and the cell lysis activity to MM cells. In particular, RPMI 8226 has a BCMA density of about 2000 sites / cell, which is close to the average value in multiple myeloma cells. MM1S has a BCMA density of about 800 sites / cell, which almost corresponds to the level of BCMA expression in healthy plasma cells. MM1R has a BCMA density of about 5500 sites / cell, which can be used to determine the efficiency of the binding protein of the present disclosure at a high expression level.

[0576] Example 3: Binding Characterization of NKp46-BCMA Fc Format Variants

[0577] introduction

[0578] Titrate NKp46-BCMA_Fc-ADE-DSB NKCE on RPMI cells to determine the K of binding to MM tumor cells as well as donor NK cells. D Subsequently, different Fc format variants of NKp46-BCMA-NKCE were tested by SPR to confirm the affinity of both variants for FcRn as well as CD16a receptor.

[0579] Materials and Methods

[0580] cell

[0581] RPMI 8226 multiple myeloma cell line was purchased from ATCC. Cells were cultured in complete RPMI medium (RPMI-1640 containing 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate and 1 x non-essential amino acids).

[0582] Titration

[0583] Resting NK cells and RPMI 8226 cells (1.10 5Cells / well) were stained with 1 / 10 serial dilution range of unconjugated molecules (starting from 225 and 500 μg / mL, respectively) in a U-shaped bottom 96-well plate for 1 hour. Secondary antibody staining was performed with goat anti-human IgG (Fcγ fragment specific PE) (Jackson Immunoresearch, 109-116-170). After staining, cells were resuspended in BD Cellfix and analyzed by flow cytometry. Parameters were recorded and analyzed with FlowJo software. Using a 4-parameter logistic nonlinear regression model, staining EC50 values ​​were calculated with GraphPad prism.

[0584] SPR binding assay – CD16a

[0585] For binding affinity measurements with CD16a, HBS-EP+ buffer (Strovan, Uppsala, catalog number BR1006-69) was prepared by mixing 100 mL 10x HBS-EP+ buffer with 900 mL purified water.

[0586] Affinity capture of human CD16a protein was achieved using a His capture kit (Situofan, Uppsala, catalog number 28995056). Anti-His capture antibody was diluted 1:20 in running buffer and coupled to a CM5 chip (Situofan, Uppsala, catalog number 29149603) using standard amine coupling using an amine coupling kit (Situofan, Uppsala, catalog number BR-100-50) to generate approximately 8000 response units (RU).

[0587] Ten continuous 1:1 dilutions of bispecific antibodies in HBS-EP+ assay buffer were prepared to concentrations of 5.8nmol / L, 11.7nmol / L, 23.4nmol / L, 46.8nmol / L, 93.75nmol / L, 187.5nmol / L, 375nmol / L, 750nmol / L, 1500nmol / L and 3000nmol / L. CD16a (V / F) protein was diluted to a concentration of 0.1ng / mL with HBS-EP+ buffer and used at this concentration in the experiment. CD16a (V176) and CD16a (V176F) were captured at a flow rate of 10 μL / min on flow cells 2 and 4, respectively, for 30 seconds to produce a maximum response (Rmax) value of approximately 30RU.

[0588] Measured in multi-cycle kinetic experiments. In each multi-cycle experiment, CD16a is captured via anti-His antibodies fixed on a series S CM5 sensor chip (human antibody capture kit, Si Tuo Fan Company, Uppsala, catalog number BR1008-39). The bispecific antibody diluted into HBS-EP+ buffer was injected with a flow rate of 30 μL / min for 120 seconds with a 1:1 dilution series of 5.8nmol / L to 3000nmol / L, followed by a dissociation phase of 120 seconds. All analyte concentrations were run in duplicate with multiple buffer blanks for dual reference. Regeneration of the capture surface was carried out by injecting a regeneration solution (10mmol / L glycine pH 1.5) for 30 seconds with 30 μL / min for two consecutive times. The binding affinity (KD value) of bispecific antibodies to human CD16a was evaluated using Biacore T200 evaluation software version 3.0 (Si Tuo Fan Company, Uppsala) for the measured antibody concentration.

[0589] SPR binding assay – huNKp46 and BCMA

[0590] For binding affinity measurements with huNKp46 and BCMA, serial two-fold dilutions of human NKp46 (concentration range 50 nM to 0.1 nM), cynomolgus monkey NKp46 (concentration range 50 nM to 0.1 nM), human BCMA (concentration range 50 nM to 0.1 nM), and cynomolgus monkey BCMA (PPB-17990; concentration range 50 nM to 0.1 nM) were prepared in HBS-EP+ assay buffer.

[0591] Affinity capture of mAb samples (FF-20-1319-1, FF-20-1320-1, FF-20-1634-1, FF-20-1635-1, EFF-20-106-1, EFF-20-107-1) was achieved using a human antibody capture kit (Situofan, Uppsala, catalog number BR1008-39) according to the manufacturer's instructions. Anti-Fc capture antibodies were diluted 1:20 in running buffer and coupled to a CM5 chip (Situofan, Uppsala, catalog number 29149603) using standard amine coupling using an amine coupling kit (Situofan, Uppsala, catalog number BR-100-50) to generate approximately 8000 response units (RU).

[0592] The antibodies were diluted with HBS-EP+ buffer to a concentration of 0.1 to 0.4 μg / mL and used at this concentration in the experiments. The antibodies were captured at a flow rate of 10 μL / min for 120 seconds to produce a maximum response (Rmax) value of approximately 30 RU.

[0593] Each antibody was measured in a multi-cycle kinetic experiment using a Biacore 8K instrument. In each multi-cycle experiment, the antibody was captured via an anti-human Fc antibody immobilized on a Series S CM5 sensor chip (Human Antibody Capture Kit, Stovam, Uppsala, Cat. No. BR1008-39).

[0594] Antigen (concentration range is 0.1nM to 50nM) diluted as described above was injected at a flow rate of 60 μL / min for 240 seconds, followed by a dissociation phase of 400 seconds. All analyte concentrations were run in duplicate with multiple buffer blanks for dual reference. Regeneration of the capture surface was carried out by injecting a regeneration solution (3mol / L MgCl2) at 30 μL / min for 60 seconds. The binding kinetic data were evaluated using a 1:1 binding model with mass transport restrictions using Biacore 8K evaluation software version 1.1.1.7442.

[0595] result

[0596] Titration of NKp46-BCMA_Fc-ADE-DSB on RPMI cells and donor NK cells demonstrated that the ADCC-enhancing Fc form of NKp46-BCMA still retained affinity for both NKp46 and BCMA targets, as shown in Figure 3A and Figure 3B shown.

[0597] SPR binding analysis of a larger panel of 12 different Fc formats of NKp46-BCMA-NKCE confirmed the affinity for CD16a and FcRn, respectively. Figure 4 and Figure 5 Of note, all ADCC-enhancing molecules showed increased binding to the CD16 (V176) and (F176) variants, as shown in Figure 2. Figure 4 shown.

[0598] The binding kinetics of NKp46-BCMA_Fc-ADE-DSB NKCE to NKp46 (human and cynomolgus monkey), BCMA (human and cynomolgus monkey) and FcγR were also calculated and the results are shown in Tables 4, 5 and 6 below.

[0599] Table 4. Affinity of NKp46-BCMA_Fc-ADE-DSB and control NKCE for human and cynomolgus monkey FcγR: KD values ​​(nM)

[0600]

[0601]

[0602] Table 5. Affinity of NKp46-BCMA_Fc-ADE-DSB for human and cynomolgus monkey NKp46: Ka, Kd and KD values ​​(nM)

[0603]

[0604] Table 6. Affinity of NKp46-BCMA_Fc-ADE-DSB for human and cynomolgus monkey BCMA: Ka, Kd and KD values ​​(nM)

[0605]

[0606] Example 4: Fc-engineered NKp46-BCMANKCE exhibits enhanced in vitro cellular cytotoxic activity

[0607] introduction

[0608] The ability of NKp46-BCMA NKCE engineered with different Fc formats (with enhanced ADCC (Fc-DE, Fc-DE-DSB, Fc-ADE and Fc-ADE-DSB) or non-enhanced ADCC (NKp46-BCMA_Fc)) to promote MM tumor cell lysis in the presence of NK donor cells was evaluated, and potential off-target NK cytotoxicity was evaluated. In addition, NKp46-BCMA NKCE was compared with an anti-BCMA antibody control to assess its potential to kill MM tumors.

[0609] Materials and Methods

[0610] cell

[0611] Human NK cells. Healthy human buffy coat by Etablissement du Sang (EFS, French blood service, Marseille; AC-2019-3428). Peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats by Ficoll density gradient centrifugation. Human NK cells were purified from PBMCs using a bead-based negative selection kit from STEMCELL Technologies or Miltenyi Biotec.

[0612] MM cell lines. RPMI 8226 and MM1.S multiple myeloma cell lines were purchased from ATCC. Cells were cultured in complete RPMI medium (RPMI-1640 containing 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate and 1x non-essential amino acids).

[0613] NK cell-based cytotoxicity assay

[0614] For cytotoxicity assays performed on MM cell lines, target cells can be alternatively loaded with Cr-51. A 1 / 10 serial dilution range is performed for test and control items starting at 5, 10, or 15 μg / mL depending on the experiment. The tested molecules, labeled target cells (approximately 3,000 cells), and human NK cells (fresh or allowed to stand overnight) from healthy donors (approximately 30,000 cells) are added sequentially to each well of a round-bottom 96-well plate to obtain a 10:1 (E:T) ratio. After 4 h of co-incubation, the supernatant is transferred to a Lumaplate (for Cr-51). In Cr-51-based cytotoxicity assays, the TopCountNXT TM (Microplate scintillation and luminescence counter; Perkin Elmer) Cr-51 released from dead target cells was measured. Radioactivity was measured by counting the gamma emission for 60 seconds per well. Results are expressed as cpm = counts per minute. The percentage of specific lysis was calculated using the following formula:

[0615] Specific lysis (%) = (ER (cpm) - SR (cpm)) / (MR (cpm) - SR (cpm)) × 100

[0616] Where ER = experimental release, SR = spontaneous release and MR = maximal release.

[0617] The EC of each molecule was determined by plotting the appropriate nonlinear regression curve using Graphpad Prism software (selecting the “log(agonist) vs. response - variable slope (four parameters)” model). 50 .

[0618] result

[0619] NKp46-BCMA NKCE engineered with ADCC-enhanced Fc formats (Fc-DE, Fc-DE-DSB, Fc-ADE, and Fc-ADE-DSB) promoted NK cell-mediated cytotoxic activity against MM tumor cells more effectively than the non-ADCC format NKp46-BCMA_Fc, as Figure 6 As shown. The cytotoxic activity was not impaired by the introduction of DSBs (which stabilize the molecule). In the presence of NK cell effectors, both NKp46-IC_Fc-ADE and NKp46-BCMA_Fc mediated MM tumor cell death at levels similar to or superior to that of anti-BCMA antibody in IgG1 form (BCMA_IgG1) or anti-BCMA antibody in defucosylated IgG1 form (reference-1), as shown in Figure 1. Figure 7 and Figure 8 shown.

[0620] Although both NKp46-IC_Fc-ADE and NKp46-BCMA_Fc had superior cytotoxic activity against MM tumor cells in the presence of NK cells, no fratricidal NK cell killing was observed, suggesting that NKp46-BCMA NKCE does not induce potentially toxic off-target effects ( Fig. 9 ).

[0621] The presence of soluble BCMA in the serum of MM patients has been described. Hipp et al. (2017) Leukemia 31:1743-1751. Soluble BCMA titrated at increasing concentrations in cytotoxicity assays with MM cells and NK cell co-cultures demonstrated that soluble BCMA slightly affected the potency of NKp46-BCMA NKCE but did not affect the maximal level of MM cell lysis, as Fig.10 shown.

[0622] Example 5: In vitro cytotoxicity assay using calcein release as an indicator

[0623] Materials and Methods

[0624] Whole blood samples: Fresh human peripheral blood mononuclear cells (PBMCs) were isolated from healthy donor whole blood samples provided by EFS Ile de France, following the “Terms and Conditions” described in the agreement number 12 / EFS / 131 between EFS Ile de France and Sanofi-Aventis Recherche et Développement.

[0625] Isolation of Human PBMCs from Whole Blood: Human PBMCs were isolated from whole blood of healthy donors (HD) by density gradient centrifugation.

[0626] Whole blood is recovered from blood bag and diluted with 40mL sterile phosphate buffer solution (PBS).15mL Ficoll-Paque Plus Cytiva (Sigma Aldrich, reference number 17-1440-02) is distributed to the center of four sepMate-50 pipes (stem cell company, reference number 85450).Then, 80mL diluted blood is added gently to the edge of each sepMate-50 pipe containing Ficoll solution (20ml per pipe).Pipe is centrifuged 20 minutes with 1200g at room temperature (RT) without deceleration.Reclaim four layers of buffy coat and be collected in two 50mL pipes.White blood cell solution is supplemented to 50mL final volume with sterile PBS.Two pipes are centrifuged twice with 400g at room temperature under the situation of deceleration (between each centrifugation, discard supernatant, and add 50mL PBS), continue 10 minutes. After the last centrifugation, the pellets were mixed and the volume was made up to 10 mL with RPMI1640 medium (complete medium) supplemented with 10% fetal bovine serum (FBS) and 2 mM L-glutamine. The total number of viable PBMCs was determined by Vicell XR counting (Beckman Coulter cell counter).

[0627] NK cell collection: according to the supplier's recommendations, use Human NK cells were purified from PBMCs using the Whole Blood NK Cell Isolation Kit (Miltenyi Biotec). NK cells were then cultured overnight in complete medium at +37°C under 5% CO2 at 5×106 cells / mL (so-called “resting” NK cells) before being used in activation assays. 6 Cells were set aside to assess their NKp46 and CD16 expression by flow cytometry.

[0628] Cell lines: RPMI8226 (ATCC CCL-155), MM.1R (ATCC CRL-2975) and MM.1S (ATCC CRL-2974) cells are multiple myeloma cell lines (plasmacytoma). They grow mainly in suspension, while some cells can grow adherently (occasionally up to 50%). For maintenance, cells were cultured at 0.3×10 6 Resuspend at 10 cells / mL in fresh complete medium and maintain for 3 or 4 days.

[0629] Stock solutions: Stock solutions of each antibody were stored in PBS at 4°C. On the day of the assay, the product was vortexed to eliminate potential aggregates before cascade dilutions. Dilutions ranging from 200 nM (twice concentrated) to 0.02 pM (1 / 10 serial dilutions) were performed in complete medium.

[0630] Of these serial dilutions, 100 μL was added to each well containing the cell suspension (50 μL of BCMA+RPMI8226 target cells and 50 μL of NK) to obtain final concentrations of 100, 10, 1, 0.1, 0.01, 0.001, 0.0001, 0.00001 nM.

[0631] For the combination antibody conditions (not binding NKp46 or CD16), the first concentration was 4 times more concentrated and 50 μl of NKp46-BCMA-Fc ADE-DSB reached the same concentration as the other antibodies tested.

[0632] Cytotoxicity assay: On the day of the assay, the BCMA+RPMI8226 (or MM.1R, or MM.1S) target cells were counted and the amount of cells required for the experiment (5000 cells / well) was evaluated. 6 / ml of target cells were resuspended in 4 ml of complete medium containing 10 μl of Calcein-AM (50 μg) previously reconstituted in 25 μl of DMSO. The labeled cells were incubated at 37° C. in the presence of 5% CO 2 (carbon dioxide) for 30 minutes.

[0633] Serial dilutions of antibodies were prepared and added to a U-bottom 96-well plate (100 μl / well) ( Ultra low attachment 96-well plates; Thermo Scientific).

[0634] The target cells were washed 3 times with 5 ml of complete medium (centrifuged at 300 g for 5 minutes after each wash, and the supernatant was discarded). The final wash was performed in complete medium containing probenecid (4x concentrated) (Thermo Fisher Scientific). The target cells were counted and inoculated at 5000 cells / 50 μl / well. Finally, NK cells with an E / T ratio of 10:1 were added to the suspension of target cells and antibodies. As a control, target cells only and target cells with NK but without antibodies were added. In addition, 2% Triton X was considered to achieve maximum target cell death. Each condition was performed in duplicate. The culture plate was incubated at 37°C in the presence of 5% CO2 for 4 hours, and 100 μl of supernatant was collected at the end and transferred to a black 96-well flat-bottom medium-binding microplate to evaluate the calcein released by dead target cells on a TECAN 1000Pro machine.

[0635] Data analysis: To convert the concentration of the antibody from mg / ml to M, the following formula was used:

[0636] Concentration (mg / ml) / molecular weight (Da) = molar concentration (M)

[0637] For killing assays, calculate percent specific lysis using the following formula:

[0638] % cytotoxicity = [(ER–SR)*100 / (MR–SR)]

[0639] ER = experimental release (target cells + NK + [antibody])

[0640] SR = spontaneous release (target cells only)

[0641] MR = Maximum release (target cells + 2% Triton X)

[0642] Statistical analysis: Analyses were performed using GraphPad prism 9.1.2. The highest lysis value corresponds to the maximum lysis observed (mean of duplicate values). The half-maximal effective concentration (EC 50 ) values ​​are expressed in pM and were calculated according to Ratkowsky and Reedy using a 4-parameter logistic nonlinear regression model.

[0643] result

[0644] NK cell activation was determined by measuring the specific lysis % of RPMI 8226 cells by NK cells and one of the following: NKp46-BCMA_Fc-ADE-DSB, which binds NKp46 and CD16a; NKp46-BCMA-Fc-inactive-DSB (a molecule that binds only NKp46); X-BCMA-ADE-DSB (a molecule that binds only CD16a); a combination of a NKp46 binder only and a CD16a binder only or an isotype control antibody (X-BCMA-Fc-inactive-DSB that binds only to BCMA on tumor cells but not on NK cells, and NKp46-X-ADE-DSB that binds to NK cells but not to both NKp46 and CD16a on tumor cells). The best NK cell activation occurred with NKp46-BCMA_Fc-ADE-DSB compared to the other four antibodies as well as the combination of single targeting agents, suggesting that: (1) dual targeting of NKp46 and CD16a results in higher tumor cell killing potency and efficacy than single engagement, and (2) the importance of having both the NKp46 arm and the CD16a arm on the same molecule for optimizing potency ( Fig.11 ).

[0645] In addition, the high potency of NKp46-BCMA_Fc-ADE-DSB was found to allow potent tumor cell killing even in MM cell models expressing low levels of BCMA (e.g., MM1S cells). Fig.12 ).

[0646] NKp46-BCMA_Fc-ADE-DSB was also compared to an anti-BCMA monoclonal antibody with enhanced ADCC characteristics (e.g., a defucosylated anti-BCMA antibody). In RPMI 8226 cells and MM1S cells, NKp46-BCMA_Fc-ADE-DSB exhibited comparable maximal lysis and better potency ( Fig.13 ).

[0647] Example 6: Fc-engineered NKp46-BCMA NKCE exhibits strong and specific anti-tumor activity in vivo

[0648] introduction

[0649] To evaluate the in vivo efficacy of NKp46-BCMA NKCE against tumor cells, a xenograft mouse model that does not express CD16 was established. Fig.14A Schematic diagram of the experimental setup used to determine the in vivo anti-tumor activity of NKp46-BCMA_Fc in a xenograft mouse model. Briefly, a 1:1 mixture of green (eGFP) and red (dsRed) fluorescent mouse lymphoma RMA cells that do not express and express human BCMA, respectively, was injected intravenously (iv) into human NKp46 transgenic Rag1-deficient mice (TghuNKp46 Rag1- / -). Tumor-bearing mice (n=7 per group) were treated once with a total dose of 12.2 pmoles of NKp46-BCMA_Fc or vehicle as a control. The mouse livers were biopsied 48 h after treatment, and the absolute counts of infiltrating RMA cells were monitored by flow cytometry. The mouse livers were biopsied 48 hours after treatment, and the absolute counts of infiltrating RMA cells were monitored by flow cytometry as described below, and are shown in the corresponding Figure 14B-14E middle.

[0650] Materials and Methods

[0651] In vivo antitumor activity in short-term models

[0652] The activity of BCMA-NKCE molecules was evaluated in a disseminated tumor model using mouse RMA leukemia cells, which were transduced with RMA-dsRed-huBCMAC1.E6 (BCMA positive) or RMA-eGFPCl.5A6 (BCMA negative) (not for expressing human BCMA) and mixed at a 1:1 ratio for injection into the tail vein of immunodeficient mice (HuNKp46 Tg Rag1- / -) (N=14) expressing human NKp46 on NK cells on day 0. Mice were divided into two groups and treated with a flat dose of 12.3 pmoles / mouse of vehicle (N=7) or NKp46-BCMA_Fc molecules (N=7) on day 0.

[0653] On day 2 (48 h after treatment), the mice were killed and Disseminated RMA cells were extracted from the liver by trituration and Percoll gradient separation. Liver-infiltrating RMA cells were analyzed and counted by flow cytometry.

[0654] Quantitative and statistical analysis

[0655] GraphPad Prism V7 was used to perform sequential statistical analysis on the obtained data. Logarithmic transformation was applied to the obtained ratio data for statistical analysis. A normality test (d'Agostino-Pearson) was performed to confirm the use of nonparametric tests (Kruskal-Wallis test, followed by comparison post-test). Each treatment group was systematically compared with the control vehicle group. If the data were not normally distributed, the Wilcoxon paired signed rank test was used to determine the statistical significance of the differences between the paired sample populations. N is the number of samples used in the experiment. Mean values ​​or medians are shown, with or without error bars indicating SD. Significance is indicated as follows: *p≤0.05; **p≤0.01; ***p≤0.001; ****p≤0.0001. Four-parameter nonlinear regression analysis was used to calculate NKp46-BCMA_Fc NKCE EC 50 .

[0656] result

[0657] Before transplantation, dsRed-huBCMA RMA cells outnumbered eGFP-huBCMA negative cells by 1.5-fold, and only RMA dsRed cells expressed BCMA ( Figure 14B-Figure 14C The expression of human BCMA on dsRed RMA cells in pre-transplantation (in vitro) and post-transplantation (ex vivo) liver biopsies as analyzed by flow cytometry can also be detected ( Fig.14D Absolute counts of liver-infiltrating RMA cells (left) and dsRed / eGFP cell ratios (right) analyzed by flow cytometry after 48 h of treatment with NKp46-BCMA-FC or vehicle control demonstrate that NKp46-BCMA_Fc tumor killing is specific for BCMA-expressing tumor cells ( Fig.14E ).

[0658] Example 7: NKp46-BCMA_Fc-ADE-DSB promotes autologous NK cell activation and ex vivo multiple myeloma (MM) cell proliferation Cell killing

[0659] introduction

[0660] Bone marrow and peripheral blood samples containing multiple myeloma cells and autologous immune effector cells were obtained from patients diagnosed with de novo or relapsed multiple myeloma who were either treatment-naive or treated with standard of care to evaluate the cumulative impact of ex vivo NKp46-BCMA_Fc-ADE-DSB NKCE.

[0661] Materials and Methods

[0662] Cells and staining

[0663] Bone marrow and peripheral blood samples were obtained from the MYRACLE cohort (Benaniba et al., BMC Cancer, 2019). Peripheral blood mononuclear cells (PBMC) and bone marrow mononuclear cells (BMMC) were separated by gradient density centrifugation using Ficoll-Hypaque. Samples from patients receiving standard of care treatment had previously been treated with daratumumab, carfilzomib, dexamethasone, and lenalidomide (Revlimid).

[0664] Cells (4 × 10 5 Cells / well) were incubated for 24 hours in RPMI containing 5% FCS and 3ng / ml IL-6. At the end of the incubation, the cells were transferred to a V-bottom plate, and the plate was centrifuged at 3000 rpm for 1 min and washed once in PBS. Under each condition as described in the table below, a set of antibodies in BD pharmingen staining buffer BSA / Brilliant staining buffer was added.

[0665] Cells were resuspended in FACs buffer and analyzed by flow cytometry using FACS Symphony. NK cell activation as described further below was assessed by CD107a and CD69 expression on CD3- / CD56+ NK cells, and myeloma cell death was assessed by the disappearance of CD138+ / CD38+ cells.

[0666] Table 7 – Antibodies for NK activation and myeloma cell death

[0667]

[0668] NK cell activation assay

[0669] The molecules were added to a U-bottom 96-well plate. 50,000 resting NK cells and 50,000 RPMI 8226 cells were then added sequentially to each well to achieve a 1:1 effector cell to target cell (E:T) ratio. A control condition was performed by adding only 50,000 resting NK cells per well. BD GolgiSTOP TM Solution (BD Biosciences, 554724) is added to each well (control and experiment) with a final dilution of 1 / 6000e. The positive control of NK cell activation is carried out by using the final 125ng / mL phorbol 12-myristate 13-acetate (PMA, Sigma (SIGMA), P8139) and the final 1μg / mL ionomycin (IONO, Sigma, I0634) added on 50,000 resting NK cells by hole. Each condition is carried out in duplicate. After incubation for 4h at 37 ± 1 ℃ and 5% ± 1% CO2, CD3, CD56, CD69, CD107a and CD107b markers are extracellularly stained. After fixing and permeabilizing cells, intracellular staining is carried out to measure the production of intracellular IFNg, TNFα and MIP1β. The antibody mixture was centrifuged at 16 000 g for 10 min at +4°C to eliminate potential aggregates. After the last staining, cells were resuspended in staining buffer (PBS, 0.2% BSA, 2 mM EDTA, 0.02% Azide) and analyzed by flow cytometry (FC).

[0670] Flow cytometry data were analyzed with FlowJo software. NK cell activation percentage analysis was performed with GraphPad prism. The highest activation value corresponded to the maximum activation observed. The half-maximum effective concentration (EC50) value was calculated using a 4-parameter logistic nonlinear regression model corresponding to the following equation:

[0671]

[0672] The calculated activation minimum, calculated activation maximum, slope, and 95% confidence interval (CI) values ​​were calculated using the same model as the EC50.

[0673] result

[0674] Flow cytometric analysis of PBMCs from MM patients treated with NKp46-BCMA_Fc-ADE-DSB NKCE showed a decrease in the frequency of myeloma cells marked by the disappearance of CD138+ / CD38+ cells relative to anti-BCMA IgG1 DE antibody or no antibody control ( Fig.15A, left panel) and an increase in activated NK cells as assessed by CD107a and CD69 expression on CD3- / CD56+ NK cells ( Fig.15A , center and right panels). These differences in the expression levels of the markers are quantified in the corresponding bar graphs, as shown in Fig. 15B Figure 16 depicts ex vivo characterization of NKp46-BCMA_Fc-ADE-NKCE tumoricidal activity in an autologous setting using bone marrow aspirates from MM patients at diagnosis or who have failed multiple therapies (TC; therapeutic agent categories), including standard of care (SoC) treatments (daratumumab, isatuximab, proteasome inhibitors, IMIDs, dexamethasone, alkylating agents, BH3 mimetics, histone deacetylase inhibitors), anti-CD47, CD3-CD38 or CD3-BCMA T cell engagers. Samples exhibiting ≤10% lysis were associated with very low E:T ratios.

[0675] NKp46-BCMA_Fc-ADE-DSB NKCE showed similar ex vivo anti-myeloma activity (autologous environment) in samples from patients at diagnosis or relapse. No decrease in anti-myeloma activity was observed at relapse.

[0676] These data demonstrate that NKp46-BCMA_Fc-ADE-DSB NKCE activates ex vivo NK cells in primary samples from MM patients (eg, with multiple myeloma cells and NK cells from the same patient) in an autologous assay.

[0677] Example 8: Fc-engineered NKp46-BCMA NKCE exhibits strong and specific anti-tumor activity in vivo and has Has a favorable elimination half-life

[0678] introduction

[0679] This example evaluates the pharmacokinetic (PK) characteristics and parameters of NKp46-BCMA_Fc-ADE-DSB NKCE after a single intravenous administration (2.5 mg / kg) to female huFcRn Tg32 transgenic mice.

[0680] Materials and Methods

[0681] PK study in hFcRn transgenic mice

[0682] Mouse experiments were performed in transgenic Tg32 (B6.Cg-Fcgrttm, 1Dcr Tg(FCGRT)32Dcr / DcrJ) mice derived from C57BL / 6 mice and purchased from Jackson Laboratory (Bar Harbor, Maine). FcRn- / -hFcRn (line 32) Tg mice carry a null mutation of the mouse gene and a transgene expressing the hFcRn α chain transgene under the control of its native human promoter. Three Tg32 homozygous naive adult female mice (average weight of 21.4 g) were used at the beginning of the study.

[0683] For the dosing regimen, NKp46-BCMA_Fc-ADE-DSB NKCE (stock solution: 1.5 mg / ml) was prepared in 10 mM His, 150 mM NaCl, pH 6 buffer diluted temporarily in the same buffer, and administered to the tail vein at a single intravenous dose of 2.5 mg / kg at a dose volume of 10 mL / kg. During the 28-day study duration, animals were evaluated using a continuous sampling method at 0.083, 4, 24, 72, 168, 336, 504, and 672 hours after dosing. At each time point, blood samples (approximately 20 μL-continuous sampling) were drawn from the saphenous vein into a K3-EDTA collection device. Blood samples were placed on wet ice immediately after collection and then centrifuged. 4 μL of plasma was then diluted into 60 μl DPBS (phosphate buffered saline).

[0684] The analysis method is as follows:

[0685] The concentration at each time point was determined by bottom-up LC-MS / MS assay using the following general method: After precipitation of plasma aliquots, the plasma precipitate was subjected to protein denaturation, reduction, alkylation, trypsin digestion and solid phase extraction, followed by analysis of surrogate peptides. Based on its selectivity and response factor, a surrogate peptide VYACEVTHQGLSSPVTK belonging to the Fab region (light chain) was selected for each antibody for quantification. Calibration standards were prepared by spiking the antibody into plasma at 1, 2.8, 7, 14, 40, 80 and 100 μg / mL. The HPLC-MS / MS was performed on a Shimadzu UHPLC system using a reverse phase Xbridge BEH C18 column (2.1×150 mm, 3.5 μM, Waters (Waters) was used for peptide separation with a stepwise gradient of 0.1% formic acid in water and 0.1% formic acid in acetonitrile at a flow rate of 600 μL / min. For detection, a Sciex API6600 TripleTOF mass spectrometer was used in positive product ion mode with a source temperature of 500°C, an ion spray voltage of 5500V, a curtain gas of 35 and a spray gas of 50. The dwell time for each experiment was 15ms. The declustering voltage was 90V, and the collision energy was 26V. The peak area using the MQ4 integration algorithm of MultiQuant software was used to determine the concentration relative to standards and controls using the 807.4098m / z fragment of the 626.0m / z parent ion of the unique surrogate peptide of the antibody.

[0686] Determination method

[0687] An exploratory LBA approach was used to determine the NKp46-BCMA_Fc-ADE-DSB NKCE concentration in plasma. NKp46-BCMA_Fc-ADE-DSB NKCE was captured by biotin-BCMA antigen bound to streptavidin beads on Gyrolab microstructured discs and detected using goat anti-human IgG Fcg Alexa tag tracer. The lower limit of quantification (LLOQ) value was 1.00 μg / mL.

[0688] Statistical analysis

[0689] Individual plasma concentration values ​​of NKp46-BCMA_Fc-ADE-DSB NKCE (expressed in μg / mL) were summarized by descriptive statistics (mean, standard deviation (SD), and coefficient of variation (CV%)) and tabulated by sampling time. All results were reported to three significant figures, except for CV%, which had no decimal places.

[0690] Individual PK parameters were summarized by descriptive statistics as described above. Individual values ​​and means were expressed to three significant figures (except for tmax and tlast, which were appropriately rounded to time values, where only median and range [min-max] values ​​were reported).

[0691] result

[0692] No clinical signs or symptoms were observed during the study.

[0693] The mean and individual values ​​(N=3) of NKp46-BCMA_Fc-ADE-DSB NKCE plasma concentrations (ug / ml) obtained after a single IV administration (2.5 mg / kg) of NKp46-BCMA_Fc-ADE-DSB NKCE to female huFcRn tg32 mice are reported in Table 8 below, and the corresponding mean and individual plasma concentration versus time curves are shown in Fig.18 and Fig.19 middle.

[0694] Table 8 - NKp46-BCMA_Fc-ADE-DSB NKCE concentrations in plasma after administration of NKp46-BCMA_Fc-ADE-DSB NKCE to huFcRn tg32 mice

[0695]

[0696] The mean and individual (N=3) pharmacokinetic parameters of NKp46-BCMA_Fc-ADE-DSB NKCE in plasma following a single intravenous (2.5 mg / kg) administration of NKp46-BCMA_Fc-ADE-DSB NKCE are presented in Table 9 below.

[0697] Table 9 - PK parameters of NKp46-BCMA_Fc-ADE-DSB NKCE in plasma after administration of NKp46-BCMA_Fc-ADE-DSB NKCE to huFcRn tg32 mice

[0698]

[0699] After intravenous administration of 2.5 mg / kg, NKp46-BCMA_Fc-ADE-DSB NKCE concentrations were quantifiable in plasma for up to 28 days (last sampling time). Plasma clearance was estimated to be 6.4±0.546 mL / day / kg, and the steady-state distribution volume was 121±9.82 mL / kg, which resulted in a terminal elimination half-life (t1 / 2) of approximately 14 days.

[0700] Example 9: NKp46-BCMA Fc WT CODV-OL1 showed strong anti-tumor activity in a dose-response manner, and Better activity was exhibited by co-engaging both CD16 and NKp46 on NK cells.

[0701] introduction

[0702] The efficacy of NKp46-BCMA Fc WT CODV-OL1 was evaluated in huNKp46-Tg x Rag mice transplanted with disseminated murine EL4 cells expressing human BCMA. The active Fc domain of IgG1 is able to bind all activating murine FcγRs, recruit murine effector cells and induce ADCC with murine NK cells.

[0703] Materials and Methods

[0704] On day 0, mice were inoculated intravenously with 0.5 × 10 6 tumor cells. Treatment was administered IP on day 1 after tumor implantation. The following control antibodies were administered at 5 mg / kg: NKp46-CD16-XFc WT, which binds huNKp46 and murine FcγRs but not huBCMA; NKp46-X-BCMA, which binds huNKp46 and BCMA but has a LALA Fc mutation that inhibits binding to murine FcγRs and recruits murine effector cells via CD16; X-CD16-BCMA, which binds huBCMA and murine FcγRs but not huNKp46. NKp46-BCMA Fc WT CODV-OL1 was administered at 5, 0.5, and 0.05 mg / kg. The control group was not treated.

[0705] Mice were checked daily and adverse clinical reactions were noted. Individual mice were weighed daily until the end of the experiment (day 60). Mice were euthanized when they became moribund according to predetermined criteria to avoid animal suffering. Clinical signs considered critical and pathology-related were limb paralysis, ascites, palpable internal tumor masses, morbidity or weight loss greater than or equal to 20%.

[0706] The primary efficacy endpoints were median survival time (MST) in days, percent increase in lifespan (%ILS), and long-term survival.

[0707] The individual death date of each mouse (if any) was reported. The MST of each group was determined, and the ratio ILS was calculated and expressed as a percentage:

[0708] %ILS=100x(TC) / C

[0709] Where T = MST of treated group and C = MST of control group.

[0710] When %ILS is above 25%, the dose is considered to be therapeutically active, and when %ILS is above 50%, the dose is considered to be highly active (Johnson JI et al. (2001) Br J Cancer [British Journal of Cancer] 84(10):1424-1431). Relationship between drug activity in NCI preclinical in vitro and in vivo models and early clinical trials. Same as above.

[0711] Long-term survival was defined as the number of mice that survived for a duration greater than or equal to 2 times the MST of the control group divided by the total number of mice in the group, expressed as a percentage.

[0712] result

[0713] The results are presented in Fig. 20 and Table 10.

[0714] NKp46-BCMA Fc WT NKCE induced statistically significant activity in the EL4-huBCMA disseminated model at doses of 5, 0.5 and 0.05 mg / kg, with an ILS of 215% and long-term survival of 57% for a dose of 5 mg / kg; an ILS of 215% and long-term survival of 62.5% at a dose of 0.5 mg / kg; and an ILS of 132% and long-term survival of 12.5% ​​at a dose of 0.25 mg / kg compared to controls.

[0715] The control X-CD16-BCMA NKCE induced statistically significant activity at a dose of 5 mg / kg in the EL4-huBCMA disseminated model, with an ILS of 147% and a long-term survival rate of 28.6%, while the control NKp46-X-BCMA NKCE did not induce significant activity at a dose of 5 mg / kg, with an ILS of 84% and the absence of any long-term survivors.

[0716] In summary, NKp46-BCMA CODV-OL1 NKCE showed dose-dependent activity with robust activity starting at 0.05 mg / kg, and the activity of NKp46-X-BCMA and X-CD16-BCMA NKCE controls demonstrated the benefit of co-engagement of NK cells with NKp46 and FcγRs leading to improved in vivo efficacy.

[0717] Table 10: Activity of NKp46-BCMAFc WT CODV-OL1 and control bispecific antibodies in huNKp46-Tg x Rag mice bearing disseminated EL4-huBCMA tumor cells

[0718]

[0719] Example 10: ADCC-enhanced NKCE showed significant superiority in vivo compared to FcWT NKCE.

[0720] introduction

[0721] The efficacy of the alternatives muNKp46-huBCMA Fc WT and Fc-ADE CODV-OL1 was evaluated in huFcgR-Tg mice transplanted with disseminated murine EL4 cells expressing human BCMA. huFcgR-Tg mice have been produced by the Rockefeller Institute (Smith P et al. (2012) PNAS [Proceedings of the National Academy of Sciences of the United States], 109 (16): 6181-6186), and these mice express all 5 human Fcγ receptors. The ADE mutation enhances the affinity of the Fc receptor for the human FcgRIIIA receptor expressed by NK cells, but does not enhance the affinity for the mouse ortholog FcgRIV. HuFcgR-Tg mice were used to evaluate the potential enhanced activity of ADE compared to WT NKCE. The control alternative contains an active Fc domain of IgG1.

[0722] Materials and Methods

[0723] On day 0, mice were inoculated intravenously with 5 × 10 6 tumor cells. Treatment was administered IP on day 1 after tumor implantation. A control antibody that binds muNKp46 but not huBCMA (muNKp46-X) ​​was administered at 5 mg / kg. muNKp46-BCMA Fc WT and Fc-ADE CODV-OL1 were administered at 5, 0.5, and 0.05 mg / kg.

[0724] Mice were checked daily and adverse clinical reactions were noted. Individual mice were weighed daily until the end of the experiment (day 60). Mice were euthanized when they became moribund according to predetermined criteria to avoid animal suffering. Clinical signs considered critical and pathology-related were limb paralysis, ascites, palpable internal tumor masses, morbidity or weight loss greater than or equal to 20%.

[0725] The primary efficacy endpoints were median survival time (MST) in days, percent increase in lifespan (%ILS), and long-term survival.

[0726] The individual death date of each mouse (if any) was reported. The MST of each group was determined, and the ratio ILS was calculated and expressed as a percentage:

[0727] %ILS=100×(TC) / C

[0728] Where T = MST of treated group and C = MST of control group.

[0729] When the %ILS is above 25%, the dose is considered therapeutically active, and when the %ILS is above 50%, the dose is considered highly active (Johnson JI et al. (2001) Br. J. Cancer 84(10):1424-31).

[0730] Long-term survival was defined as the number of mice that survived for a duration greater than or equal to 2 times the MST of the control group divided by the total number of mice in the group, expressed as a percentage.

[0731] result

[0732] The results are presented in Fig.21 and Table 11.

[0733] The alternative muNKp46-huBCMA Fc WT NKCE did not induce statistically significant activity at doses of 5, 0.5 and 0.05 mg / kg in the EL4-huBCMA disseminated model (compared to the control NKCE group). In contrast, the alternative muNKp46-huBCMA Fc ADE NKCE induced statistically significant activity at doses of 5 and 0.5 mg / kg, with ILS>100% and long-term survival of 90%. The lower dose of 0.05 mg / kg did not induce statistically significant activity.

[0734] In conclusion, muNKp46-huBCMA Fc ADE surrogate NKCE showed better activity than WT Fc surrogate in a dose-dependent manner.

[0735] Table 11: Kaplan-Meier curves of surrogate muNKp46-huBCMA Fc WT and Fc-ADE CODV-OL1 in huFcgR-Tg mice bearing disseminated EL4-huBCMA tumor cells

[0736]

[0737] Example 11: Chemistry of the disulfide bond R292C_V302C within the NKp46-BCMA CODV-OL1 molecule under reducing conditions Stability / Integrity

[0738] introduction

[0739] Engineering of disulfide bonds (DSBs) on the Fc CH2 domain increases stability. See U.S. Provisional Patent Application Serial No. 63 / 193,665, which is incorporated herein by reference in its entirety. To ensure that the engineered DSBs (R292C_V302C) and ADE mutations (G236A / S239D / I332E) within the NKp46-BCMA CODV-OL1 molecule do not abnormally affect DSB reduction behavior, the reduction rate was measured by DTT and subsequent tryptic peptide mapping.

[0740] Materials and Methods

[0741] Reduction sensitivity assay

[0742] Serial dilutions of DTT in PBS-E were performed (final DTT concentrations in the assay: 20, 10, 5, 2, 1, 0.5, 0.2, and 0.1 mM). Protein batches FF-20-819-1, FF-20-821-1, and FF-21-170-5 were dialyzed into PBS-E buffer using a spin desalting column to ensure that pH 7.2 was obtained during reduction. Protein samples were normalized to 1.5 mg / mL in PBS-E. Two normalized samples were added to the PCR plate with one portion of each DTT dilution and mixed after addition. This step was performed from the lowest to the highest concentration of DTT concentration within one minute. Reduction was performed by incubating at 25° C. for 10 minutes on a Thermostat C Thermostat. The reaction was quenched by adding 3 portions of NEM stock solution to all wells. To ensure assay consistency, NEM addition was performed from the lowest to the highest DTT concentration within one minute and mixed after addition. The prepared plates were stored at room temperature until measured by capillary gel electrophoresis (cGE) and mass spectrometry (peptide mapping).

[0743] Tables 12 and 13 below contain lists of reagents and materials used for the reduction sensitivity assay and capillary gel electrophoresis, respectively.

[0744] Table 12 - List of reagents and materials used for reduction sensitivity assay

[0745]

[0746] Table 13 - List of reagents and materials used for capillary gel electrophoresis (cGE)

[0747]

[0748] After the reduction sensitivity assay was performed, samples were measured by using the non-reducing protocol of the Protein Clear HR assay according to the manufacturer's instructions.

[0749] To prepare the chip, all assay components were allowed to equilibrate to room temperature. ProteinClear HR Gel Matrix was mixed and filtered with Protein Clear HR Dye Solution according to the manufacturer's instructions and then added to the washed chip wells.

[0750] According to the manufacturer's instructions, the provided assay control VeriMAb standard was diluted in non-reducing sample buffer, denatured at 70°C for 10 minutes, mixed with water, and placed in the LabChip GXII Touch instrument for assay calibration. After diluting the Protein Clear HR ladder 1:10 in water, the specified volumes of the ladder solution and ProteinClear HR wash buffer were transferred to the corresponding tubes and placed in the LabChip GXII Touch instrument. The calibration process was successfully completed before measuring the samples.

[0751] To prepare the samples, 5 μL of each sample from the reduction sensitivity assay was added to 18 μL of non-reducing sample buffer in a PCR plate, the plate was sealed, and the samples were denatured on a Thermostat C Thermoblock at 70°C for 10 min. After denaturation, the samples were diluted with 35 μL of water. The prepared assay plates were stored at room temperature until they were measured with a LabChip GXII Touch instrument.

[0752] After the measurement, the data were analyzed using LabChip Reviewer software. All peaks with a relative peak area of ​​≥0.85% were integrated. The relative peak area [%] of the remaining intact molecule was plotted against the DTT concentration, and the curve was fitted by a 4-parameter logistic model / S-shaped dose-response model (Xlfit, Dose Response One Site, Model 205). The area of ​​the sample without DTT was used for standardization and set to 100%. The DTT concentration of each sample with 50% of the intact molecule remaining was used as the EC50 value to evaluate the sensitivity of the molecule to reduction.

[0753] Antibody sample preparation after reduction assay in tryptic peptide mapping experiments

[0754] After carrying out reduction sensitivity determination, make sample stand digestion procedure.By the buffer exchange carried out with 0.5mL Zeba rotating desalting column (Thermo Fisher Scientific, catalog number 89883), use 0.2mol / L histidine chloride, 5.6mmol / L guanidine hydrochloride (pH 6), make 100μg every kind of antibody sample denaturation.Repeat buffer exchange once to ensure to remove NEM completely.Then, by adding 10mmol / L TCEP (tris (2-carboxyethyl) phosphine, Thermo Fisher Scientific, catalog number T2556), sample is reduced 1h at 37 ℃.Subsequently, with 0.5mL Zeba rotating desalting column (Thermo Fisher Scientific, catalog number 89883), buffer exchange is 20mmol / L histidine chloride, 0.5mmol / LTCEP (pH 6).Antibody is digested with trypsin overnight with the enzyme and substrate ratio of 1:20 at 37 ℃. Digestion was stopped by adding 7 μL of 10% formic acid solution, and samples were frozen at -80°C until further analysis.

[0755] Detection of modified peptides by liquid chromatography tandem mass spectrometry

[0756] Used in conjunction with the orbitrap Fusion TM Lumos TM Tribrid TM Mass spectrometer (Thermo Fisher Scientific, San Jose, CA, USA) coupled to a Vanquish TM Flex UHPLC system for peptide analysis.

[0757] For peptide separation, a binary solvent system was used: (A) 0.1% formic acid and (B) 90% acetonitrile, 0.1% formic acid. 2 μg of the tryptic digested sample was separated on a Hypersil GOLDTM C18 LC column (150 mm×2.1 mm, 1.9 μm particle size, Thermo Fisher Scientific, catalog number 25003-152130-V) using the following 1 h gradient: linear increasing concentration of solvent B for 50 min, followed by a 5 min wash at 95% B, and re-equilibration to 5% solvent B over 5 min. The peptides separated on the column were detected with the following key settings: full MS spectra were acquired at a resolution of 120,000 (defined at 200 m / z), the mass range was set to 375-2000, the automatic gain control (AGC) target was 4.0e5, the maximum injection time was 50 ms and 1 μscan. After accumulating 5.0e4 AGC targets in an injection time of 200 ms, data-dependent (MS / MS) spectra were obtained in the first 5 data-dependent modes using a resolution of 15,000 (defined at 200 m / z). Ions were isolated at a 1.6 Th isolation window and fragmented using HCD, EthcD or EtciD at 30% normalized collision energy. Dynamic exclusion was set to 10 s.

[0758] Data processing

[0759] The obtained MS data were processed using Expressionist software (GeneData 13.5 version) and manually checked to ensure correct assignment and relative quantitative accuracy. Mass spectra were searched for the amino acid sequence of the sample molecule. The key setting was the mass tolerance of the MS and MS / MS spectra, which was set to 10 ppm respectively. The post-translational modifications considered within the search parameters were NEM modifications and common N-terminal glycosylation of cysteine ​​using the IgG N-glycan library from Expressionist.

[0760] result

[0761] From Fig. 22 EC50 values ​​were calculated from the dose response curves shown. Reduction of the main peak of the unreduced sample by DTT measured by capillary electrophoresis (cGE) was identical for CODV-OL1 wt, CODV-OL1 ADE, and CODV-OL1 ADE-DSB, indicating that neither the ADE mutation nor the engineered disulfide bond in the CH2 domain affected the reduction sensitivity of the protein.

[0762] The proteins CODV-OL1 wt, CODV-OL1 ADE, and CODV-OL1 ADE-DSB from the reduction sensitivity assay by peptide mapping analysis exhibited similar reduction behavior toward reduction-sensitive intermolecular disulfide bonds (DSBs), e.g. Fig.23A (CODV-OL1 wt), Fig. 23B (CODV-OL1ADE) and Fig.23C Based on the dose-response curves, the EC50 values ​​of the three proteins were estimated to be in the range of 1.2-1.5 mM DTT, indicating that the engineered DSBs are similarly reduction-stable to typical intermolecular DSBs.

[0763] CODV-OL1wt, CODV-OL1ADE and CODV-OL1ADE-DSB – expression yield Antibodies were generated as follows:

[0764] The expression plasmids encoding the different chains of the corresponding constructs are propagated in Escherichia coli DH5a. The plasmids for transfection were prepared from Escherichia coli with EndoFree plasmid Mega kit (Qiagen). HEK 293-FS cells grown in F17 serum-free suspension culture (Invitrogen) were transfected with the specified plasmid using polyethyleneimine transfection reagent. After culturing for 6 days at 37°C under 8% CO2, the cells were removed by centrifugation, and the supernatant was passed through a 0.22 μm filter to remove particles. The protein was captured on MabSelect SuRe (Situofan Company) and eluted with 0.1M citrate buffer pH3.0 and neutralized with 1M Tris pH 9. After refining these proteins and UV280 concentration determination by using the size exclusion chromatography (SEC) of Superdex20026 / 60 (Situofan Company) and 0.22 μm filtration, these proteins were used for further characterization. The yield is reported in Table 14 below.

[0765] Table 14. Yield of antibodies with wild-type IgG1 or with enhanced Fc domain (with or without disulfide bonds)

[0766] clone Sample yield (mg / L) CODV-OL1-WT 25.2 CODV-OL1-DE-R292C / V302C 21.7 CODV-OL1-ADE-R292C / V302C 25.7

[0767] The antibody with normal IgG1 Fc backbone exhibited a sample yield of 25.2 mg / L, while the antibody with ADE or DE mutation in the Fc backbone showed a strong decrease of less than 5 mg / L. The antibody with IgG1 Fc with ADE or DE mutation and with disulfide bonds showed similar sample yields to WT.

[0768] Example 12: Co-culture with BCMA-positive RPMI 8226 MM tumor cells and NKp46-BCMA_Fc-ADE-DSB In vitro cytokine release in PBMCs

[0769] Materials and Methods

[0770] In vitro safety program of IncuCyte S3 (PBMC+MM1R-RFP, effector cell:target cell ratio=3:1)

[0771] One day after PBMC purification, both PBMC and MM1R-RFP were counted on a Vi-Cell XR (Beckman Coulter, Brea).

[0772] Target cells: MM1R cell line was purchased from ATCC / Northwestern University BDW and transfected with Incucyte Nuclight Red lentivirus (Essen Biosciences, reference 4476) to express mKate2 red fluorescent protein (RFP), which can be tracked for several days using an Incucyte incubator. Selection of MM1R-RFP cells was obtained by adding puromycin dihydrochloride hydrate (Thermo Scientific, Denmark, reference 10781691) to a final concentration of 1 μg / ml in the culture medium [RPMI medium 1640 (1X) (GIBCO, Denmark, reference 31870-025) with 20% fetal bovine serum heat-inactivated FBS (Biowest, reference S140H-100) and 1% L-glutamine 200mM (100X) (GIBCO, Denmark, reference 25030-024).

[0773] Since MM1R-RFP cells are semi-adherent, the culture medium was removed and used to wash the Nunc EasY flask 75cm 2 5 ml PBS1X (Thermo Scientific, Denmark) was placed in a 50 ml falcon tube. 2 The remaining adherent cells were detached with Accutase Cell Detachment Solution (Corning, Reference No. 25-058-CI) from the flask. After 5 min at 37°C, the action of accutase was terminated with 9 ml of culture medium (RPMI + 20% FBS, final volume of 10 ml), and MM1R-RFP cells were counted on Vi-Cell XR. An appropriate number of cells were prepared and seeded at a density of 30,000 cells / well (50 μl / well) to have an E:T ratio of 3:1.

[0774] Antibodies: All Abs were prepared at 2X concentration in RPMI medium (since 50 μl target cells + 100 μl Ab 2X + 50 μl PBMC were added per well). Antibodies used for the experiments were diluted 1 / 100 times in medium in deep well plates (Axigen, reference number P-DW-11-CS). All Abs had a starting concentration of 1000 nM (so 2000 nM calculated) except for the CD3-BCMA T cell engager, which had an initial concentration of 100 nM (so 200 nM) and was diluted 3 times.

[0775] Effector cells: Total PBMCs (E:T ratio of 3:1) were prepared at a density of 300 000 cells / well (50 μl / well). After counting, the required number of PBMCs were centrifuged at 300 g for 5 min (acceleration = 9, deceleration = 9) and resuspended in an appropriate volume of RPMI medium (Sigma-Aldrich, reference number I4506) with human IgG at a concentration of 4 mg / ml, so that the final concentration was 1 mg / ml, in a final volume of 200 μl / well: [50 μl MM1R-RFP + 100 μl antibody (2X) + 50 μl PBMC].

[0776] The cells were seeded in 96-well plates poly D (Greiner bio-one, reference number 655946) and the outer wells were filled with 200 μl of PBS 1X.

[0777] After seeding of tumor cells (50 μl / well) + Ab (100 μl / well) + PBMC (50 μl / well), the plates were centrifuged at 100 g for 1 min at room temperature and placed in an IncuCyte S3 (Essen Biosciences) incubator, but the plates were read only after at least 30 min to avoid temperature differences.

[0778] The plate was read on the Incucyte S3 using the following parameters: Assay Type (Basic Analyzer), RED, Objectif10X, 4 images / well, Time Point 48h (imaging every 4h), Acquisition Time 400ms.

[0779] After 48 h, the Incucyte scanner was stopped and the plate was centrifuged at 300 g for 5 min, and 100 μl of supernatant / well was collected for analysis of cytokine release by Human Pro-Inflammatory I (4-Plex) Kit V-Plex.

[0780] Procedure for analyzing cytokine release by the Human Pro-Inflammatory I (4-Plex) Kit V-Plex

[0781] For analysis of cytokine release, the Human Pro-Inflammatory I (4-Plex) Kit V-Plex (MSD, reference number K15052D-1) was used.

[0782] First, a control range was prepared: the lyophilized tubes were reconstituted with 1000 μl of diluent 2 (calibrator, reference number C0049-2) and left to stand for 30 min. Seven serial 1 / 4 dilutions were prepared in diluent 2 (i.e., 75 μl Cx + 225 μl diluent 2); the last tube n.8 was considered as a negative control (diluent 2 only = zero), while the starting solution in tube n.1 was not diluted.

[0783] Samples were prepared sequentially with a dilution of 1 / 100 for DART (i.e., 50 μl / well, 5 μl DART / concentration + 495 μl preparation in diluent 2) and 1 / 5 for other antibodies (i.e., 50 μl / well, 100 μl Ab / concentration + 400 μl preparation in diluent 2).

[0784] Prepare secondary antibody in Diluent 3: 100 μl IFNγ + 100 μl IL1β + 100 μl IL6 + 100 μl TNFα + 4600 μl Diluent 3 (final volume 5 ml), then dispense 25 μl of the secondary Ab mix into each well.

[0785] Before adding the samples to the plate, the latter was washed 3 times with 150 μl of PBS 1X tween 0.05% (washing buffer prepared with 500 μl Tween20 in 1 L PBS 1X). Then, 50 μl / well of the dilution sample to be tested and 50 μl / well of the standard range were added. The plate was covered with a film and placed at room temperature under stirring for 2 hours.

[0786] The plate was washed 3 times with 150 μl of wash buffer, 25 μl of the second Ab was added to the sample (tap the plate to allow better distribution of the second Ab), and the plate was covered with film again and placed under agitation at room temperature for 2 hours. 3 washes were performed with 150 μl of wash buffer, and 150 μl of read buffer was added to all wells [read buffer (4X) prepared by 1 / 2 dilution in H2O]. The plate was read to the MSD instrument 1250.

[0787] result:

[0788] like Fig.24A and Fig. 24B As shown, NKp46-BCMA_Fc-ADE-DSB mediated potent cytotoxicity against BCMA-expressing cells and also resulted in minimal cytokine release from PBMCs in the co-culture. Fig.25A and Fig.25B As shown, NKp46-BCMA_Fc-ADE-DSB also mediates a reduction in MM1R tumor cell proliferation while minimally triggering cytokine release. The reduction in cytokine release in vitro is indicative of a good safety profile.

[0789] Example 13. Effect of NKCE on NK cell activation and cytokine / chemokine production by resting NK cells in the presence of MM cells In vitro characterization of factors.

[0790] This example was drawn up to characterize the in vitro efficacy of NKp46-BCMA_Fc-ADE-DSB on the activation and cytokine / chemokine production of NK cells in the presence of a BCMA-positive cell line (RPMI 8226 multiple myeloma cells).

[0791] Materials and Methods

[0792] Peripheral blood mononuclear cells: To isolate peripheral blood mononuclear cells (PBMC), the buffy coat was diluted approximately 1 / 5 in RPMI and transferred to a Pancoll tube at room temperature. The tube was centrifuged at 800 g for 20 min without deceleration. The first cell wash was performed in RPMI, centrifuged at 400 g for 10 min at room temperature with deceleration. The second cell wash was performed in RPMI, centrifuged at 130 g for 10 min at room temperature with deceleration.

[0793] NK cell collection: Human NK cells were purified from PBMC samples using the NK cell isolation kit (Miltenyi Biotec) by negative selection using manual magnetic labeling and subsequent manual separation using LS columns according to the protocol recommended by the supplier. NK cells were then isolated at 1 × 10 6 Cells / mL were cultured in complete RPMI at 37°C ± 1°C under 5% ± 1% CO2 for approximately 24 hours before use in activation assays (so-called "resting" NK cells).

[0794] The viability criterion for effector cells was set to ≥90%. On the day of the experiment, cell surface expression of both CD16a and NKp46 on resting NK cells was monitored by flow cytometry.

[0795] NK cell activation assay

[0796] NKCE molecules were added to the wells of a U-bottom 96-well plate. 50,000 resting (e.g., non-activated) NK cells and 50,000 RPMI 8226 MM cells were added sequentially to each well to obtain a 1:1 effector cell:target cell (E:T) ratio. A control condition was performed by adding only 50,000 resting NK cells to each well. GolgiStop was added to each well (control and experimental) at a final dilution of 1 / 1500.TM (BD Biosciences) solution to block intracellular protein transport to the extracellular side, thereby causing cytokine accumulation in the Golgi complex. Positive controls for NK cell activation were performed using phorbol 12-myristate 13-acetate (PMA) at a final concentration of 125 ng / mL and ionomycin at a final concentration of 1 μg / mL added to 50,000 resting NK cells. Each condition was performed in a simplified manner.

[0797] After 4 h of incubation at 37°C ± 1°C, cells were stained for flow cytometry analysis by staining for extracellular markers (CD3, Cd56, CD69, CD107a, and CD107b). After fixation and permeabilization steps, intracellular staining for IFNγ, TNFα, and MIP1β was performed. After the last staining, cells were fixed for 15 min using Cytofix (BD Biosciences) and stained with LSR Fortessa TM X-20 was analyzed by flow cytometry. FSC-A, FSC-H, FSC-W, SSC-A, SSC-H, SSC-W, FL-1, FL-3, FL-6, FL-7, FL-9, FL-13, and FL-16 parameters were recorded using BD FACSDiva software and analyzed using FlowJo software.

[0798] Analysis of NK cell activation percentage and median fluorescence intensity (MedFI) of activation markers was performed using GraphPad Prism. The highest activation value corresponds to the maximum activation observed. The half-maximal effective concentration (EC) was calculated using a 4-parameter logistic nonlinear regression model corresponding to the following equation: 50 )value:

[0799]

[0800] Use with EC 50 The same model calculated the calculated activation minimum value, calculated activation maximum value, slope and 95% confidence interval (CI) values.

[0801] Flow cytometric analysis of purity and phenotype of resting NK cells and target cells

[0802] Resting NK cells used in NK cell activation experiments were analyzed for purity, expression of CD16a and NKp46. RPMI 8226 MM cells were analyzed for CD32 and BCMA expression.

[0803] On the day of the experiment, staining of resting NK cells and target cells was performed. 1×10 cells were stained with antibodies conjugated to dyes (allophycocyanin, Pacific blue, or phycoerythrin) in a U-bottom 96-well plate.5 cells / well.

[0804] result:

[0805] NK cell activation was evaluated by: 1) expression of activation markers (CD69 and CD107a / b) on the cell surface, and 2) intracellular production of cytokines (IFNγ, TNFα) and chemokines (MIP1β).Seven NK cell donors were evaluated in this study.

[0806] like Figure 26A-26D As shown, in the absence of RPMI 8226 MM cells, PMA-ionomycin (positive control) activated NK cells by inducing the expression of CD69 and CD107a / b. In contrast, NKp46-BCMA_Fc-ADE-DSB and control NKCE induced a non-S-shaped dose response activation starting from 4.88 ng / mL to reach approximately 40% of CD69-positive cells (CD69 MedFI approximately 150) and 14% of CD107-positive cells (CD107 MedFI approximately 90) at the highest concentration (4.88 μg / mL).

[0807] In the presence of RPMI 8226 MM cells, NK cells were not activated in the absence of this molecule. Addition of control NKCE induced a low level of activation of NK cells, which was similar to the activation obtained in the absence of target cells. Addition of NKp46-BCMA_Fc-ADE-DSB induced an S-shaped dose response of NK cell activation that was higher than that obtained with control NKCE. More specifically, NKp46-BCMA_Fc-ADE-DSB observed a saturation phase at about 48.8 ng / mL for CD69 expression (about 60% of positive cells and a MedFI of 351 on NK cells) and CD107a / b expression (about 22% of positive cells and a MedFI of 132 on NK cells) (Table 15).

[0808] Table 15. Maximum observed NK cell activation values ​​obtained for CD69 and CD107a / b expression in the NK cell activation assay in the presence of NKp46-BCMA_Fc-ADE-DSB and RPMI 8226 MM cells.

[0809]

[0810] When saturation and a sigmoidal dose response of NKp46-BCMA_Fc-ADE-DSB against CD69 were achieved, ECs were extracted from seven selected donors. 50(Table 16) Considering the level of CD107a / b production (about or less than 20% positive cells in 3 out of 7 donors), the EC values ​​of CD107a / b activation markers were not estimated. 50 .

[0811] Table 16. ECs of CD69 expression obtained in NK cell activation assay in the presence of NKp46-BCMA_Fc-ADE-DSB and RPMI 8226 MM cells 50 value.

[0812]

[0813]

[0814] NK cells secrete IFNγ, TNFα, and MIP1β

[0815] In the same experiment, the intracellular cytokines (IFNγ and TNFα) and the chemokine MIP1β produced by NK cells were measured. The release of TNFα, IFNγ, and MIP1β is proportional to NK cell activation: higher NK cell activation leads to higher cytokine / chemokine production ( Figure 27A-27F ).

[0816] In the absence of RPMI 8226 MM cells and NKp46-BCMA_Fc-ADE-DSB, NK cells did not produce detectable TNFα and IFNγ, however, about 80% of NK cells produced MIP1β. Adding a positive control (PMA-ionomycin) induced NK cells to produce TNFα (about 84% for D584), IFNγ (about 83% for D584) and increased MIP1β (about 100% for D584). In contrast, adding NKp46-BCMA_Fc-ADE-DSB induced very low target-dependent expression of IFNγ and TNFα in a dose-dependent manner, with the highest activation values ​​observed being less than 20% of positive cells (8% ± 5% for IFNγ and 12% ± 7% for TNFα). In a dose response for both molecules, NK cells produced MIP1β starting from 4.88 ng / mL to reach approximately 95% positive cells (MIP1β MedFI on NK cells was approximately 5400).

[0817] The results showed that the presence of RPMI 8226 MM cells alone was not sufficient to induce cytokine secretion by NK cells in the absence of NKCE molecules. Addition of high concentrations of control NKCE molecules induced low or very low cytokine production by NK cells and induced high MIP1β production with a sigmoidal dose response. Addition of NKp46-BCMA_Fc-ADE-DSB induced cytokine and chemokine production. For these three cytokines / chemokines, maximal production levels were reached at concentrations of NKp46-BCMA_Fc-ADE-DSB ranging between 4.88 and 48.8 ng / mL, depending on the donor. For the seven donors tested, at the highest NKp46-BCMA_Fc-ADE-DSB concentration, the percentages of NK cells producing TNFα or IFNγ were approximately 12±7 (TNFαMedFI on NK cells: 39±7) and 8±5 (IFNγMedFI on NK cells: 137±30), respectively, and the percentage of NK cells producing MIP1β was approximately 94±2 (MIPβMedFI on NK cells: 10145±4416) (Table 17).

[0818] When saturation and sigmoidal dose responses were obtained for the production of NKp46-BCMA_Fc-ADE-DSB against TNFα, IFNγ, and MIP1β, the highest values ​​of activation observed from the seven tested donors (TNFα, IFNγ, and MIP1β) and the EC values ​​of MIP1β were 50 Considering the production levels of TNFα and IFNγ (less than 20% of positive cells), the EC values ​​of these two cytokines were not estimated. 50 (Table 18).

[0819] Table 17. Maximum observed NK cell activation values ​​obtained in the NK cell activation assay in the presence of NKp46-BCMA_Fc-ADE-DSB and RPMI 8226 MM cells.

[0820]

[0821] Table 18. ECs of MIP1β expression obtained in NK cell activation assay in the presence of NKp46-BCMA_Fc-ADE-DSB and RPMI 8226 MM cells 50 value.

[0822]

[0823] Example 14: Expression of NKp46-1 using co-cultured human donor whole blood cells and RPMI (multiple myeloma) cell lines In vitro cytokine release analysis using BCMA_Fc-ADE-DSB

[0824] introduction

[0825] To assess the variability / range of responses observed in this assay, whole blood cells from 11 human donors were co-cultured with RPMI-8226-RFP cells, which were treated with NKp46-BCMA_Fc-ADE-DSB or negative or positive controls. The co-cultures were incubated overnight at 37°C with 1, 10, 100, and 300 μg / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or with negative or positive controls, as detailed in the Materials and Methods section below. The treatment control groups included two negative controls (untreated co-cultures and co-cultures treated with 300 μg / mL isotype control) and three positive controls: human anti-CD3 / CD28 T cell activator (25 μg / mL; ImmunoCult TM ), anti-CD52 recombinant antibody (alemtuzumab 100 μg / mL; ) and an internal BCMA T cell engager tool compound (TCE-BCMA 100 μg / mL).

[0826] Materials and Methods

[0827] RPMI 8226 cell line was obtained from ATCC (American Type Culture Collection, USA) and transfected with red fluorescent protein (RFP). Such modified RPMI 8226-RFP cells were cultured in RPMI 1640 medium (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific) and 1% penicillin-streptomycin (10,000 U / mL, Thermo Fisher Scientific) at +37°C in a humidified atmosphere of 5% CO2.

[0828] On the day of the cytokine release assay, cells were counted and their viability was assessed on a Cellometer (Nexelcom, Lawrence, MA, USA). RPMI-8226-RFP cells were adjusted to a concentration of 800,000 cells / mL, and 25 uL of cells were seeded in 96-well tissue culture plates (Thermo Fisher Scientific) at a final density of 20,000 cells / well per well.

[0829] NKp46-BCMA_Fc-ADE-DSB and controls were dissolved in RPMI 1640 medium GlutaMax (Thermo Fisher Scientific) supplemented with 10% w / v fetal bovine serum and 1% penicillin-streptomycin (10,000 U / mL). 25 μL of NKp46-BCMA_Fc-ADE-DSB and controls were added to each well in triplicate. Negative controls were only culture medium and isotype controls at a final concentration of 300 μg / mL. Positive controls with their respective concentrations are listed above and are marked in Figures 28-32.

[0830] Whole blood from 11 consenting donors was placed into 10 mL vacuum blood collection tubes containing sodium heparin anticoagulant by venipuncture. The samples were gently mixed and kept under ambient conditions until the start of the study. After RPMI-8226-RFP cells were added to the NKp46-BCMA_Fc-ADE-DSB or treatment control groups, fresh whole blood samples (200 μL) from the donors were then added to the wells and the plates were incubated at +37°C in a humidified atmosphere of 5% CO2 for 24 hours.

[0831] At the end of the incubation period, the plates were centrifuged at 500 × g for 10 minutes. Plasma was collected from these plates and then directly transferred to new 96-well cell culture plates and then centrifuged at 2000 × g for 10 minutes to remove remaining cell debris. The final plasma samples were transferred to new 96-well culture plates and used for immediate assessment of cytokine levels.

[0832] Plasma samples were evaluated for the following levels using the MSD U-PLEX assay (Cat. No. K15067L-2; Batch No. 404471) according to the manufacturer's instructions (Mesoscale Discovery, Rockville, MD, USA): granulocyte-macrophage colony-stimulating factor (GM-CSF; quantification range 0.33-10,200 pg / mL), interferon gamma (IFN-γ; quantification range 9.45-27,000 pg / mL), interleukin-1β (IL-1β, quantification range 0.35-4430 pg / mL), interleukin-2 (IL-2, quantification range 1.24-1990 pg / mL), interleukin-4 (IL-5; quantification range 1.0-2.00 pg / mL), and IL-6 (IL-7; quantification range 2.0-3.00 pg / mL). -4, quantitative range of 0.16-1,780 pg / mL), interleukin-6 (IL-6, quantitative range of 0.89-2,050 pg / mL), interleukin-8 (IL-8, quantitative range of 0.35-2,180 pg / mL), interleukin-10 (IL-10, quantitative range of 0.35-3,770 pg / mL), macrophage inflammatory protein 1α (MIP-1α, quantitative range of 14.5-5,580 pg / mL), and tumor necrosis factor α (TNF-α; quantitative range of 0.66-2,940 pg / mL).

[0833] By fitting the signal from the calibration standard to a 2 A weighted 4-parameter logistic model or sigmoidal dose-response model was used to determine cytokine levels using calibration curves for each cytokine. Calculations to determine cytokine concentrations were performed using MSDDISCOVERYWORKBENCH analysis version 4.0 (Mesoscale Discovery, Rockville, MD, USA), and concentrations were expressed in pg / mL.

[0834] Cytokine data (triplicate) were analyzed, and the coefficient of variation (%CV) between triplicates was calculated using GraphPad Prism software version 9.1.2 (GraphPad Software, San Diego, California, USA). The S-shaped dose-response four-parameter variable slope calculation with the lower limit set to 0 was used for analysis. Samples that had technical errors and were not detected were reported as undetected (UD). Samples with a concentration equal to or lower than the lower limit of quantitation (LLOQ) were reported as LLOQ, and this value was used in all calculations. Samples with a concentration higher than the upper limit of quantitation (ULOQ) were reported as the extrapolated values ​​obtained, and this value was used in all calculations. Relative to negative control (untreated co-culture), the fold changes [overall mean (with SD) and median (with Q1 and Q3: first and third quartiles)] of the cytokine levels of each treated sample were calculated.

[0835] result

[0836] As shown in Figures 28-32, positive controls anti-CD3 / CD28 and TCE-BCMA showed IFN-γ ( Fig.28A )、MIP-1α( Fig.28B )、TNF-α( Fig.29A ), IL-1β( Fig.29B )、IL-6( Fig. 30A )、IL-8( Fig. 30B )、IL-2( Fig.31A )、GM-CSF( Fig.31B )、IL-4( Fig.32A ) and IL-10( Fig.32B ) Cytokine release was strongly increased. Positive control anti-CD52 induced IFN-γ ( Fig.28A )、IL-6( Fig. 30A )、MIP-1α( Fig.28B ), IL-1β( Fig.29B ) and IL-8( Fig. 30B ) cytokine release, but did not induce cytokines typically associated with T cell responses, such as IL-2 ( Fig.28A )、IL-10( Fig.31A )、GM-CSF( Fig.31B ) or IL-4 ( Fig.32A )). In contrast, NKp46-BCMA_Fc-ADE-DSB only induced the release of IFN-γ ( Fig.28A ) and MIP-1α( Fig.28B ) secretion; no changes were reported for all other cytokines evaluated.

[0837] When compared to untreated whole blood and RPMI 8226-RFP co-cultures (negative control), there was a clear NKp46-BCMA_Fc-ADE-DSB-associated increase in IFN-γ and MIP-1α in donors at all tested concentrations (1, 10, 100, and 300 μg / mL). IFN-γ levels in samples incubated with NKp46-BCMA_Fc-ADE-DSB (at all tested concentrations) were ( Fig.28A) was higher than the negative control (3 to 6 times), but much lower than the positive control. The increase in IFN-γ was not concentration-dependent with NKp46-BCMA_Fc-ADE-DSB, and the level was comparable to the isotype control, indicating that IFN-γ secretion was associated with the engagement of NKp46-BCMA_Fc-ADE-DSB on NK cells, rather than BCMA binding activity. NKp46-BCMA_Fc-ADE-DSB-induced MIP-1α ( Fig.28B ) levels were slightly higher than the negative control (1 to 3 fold), but significantly lower than the positive control. There was no difference in the cytokine release profiles between the two NKp46-BCMA_Fc-ADE-DSB batches tested (CER and GMP).

[0838] In summary, the results indicate that the risk of NKp46-BCMA_Fc-ADE-DSB causing CRS in humans is considered low. These results also confirm those results from the in vitro cytokine release assay (PBMC) shown in Example 12, supporting the conclusion that NKp46-BCMA_Fc-ADE-DSB has a good safety profile.

[0839] Example 15: Analysis of NK cell activation and MM cell lysis in response to NKp46 bispecific antibodies

[0840] introduction

[0841] This example uses flow cytometry to evaluate the ability of NKp46-BCMA_Fc-ADE-DSB to activate NK cells from MM peripheral blood and induce MM cell death. In the presence of increasing concentrations of NKp46-BCMA_Fc-ADE-DSB, isotype control antibody (10 mg / ml) or daratumumab (10 mg / ml), Karpas 620MM cells as target cells were co-cultured with PBMCs from MM patients (n=13, Table 18) as effector cells at an E:T ratio of 10:1.

[0842] To this end, Karpas 620MM cells co-cultured with PBMCs from MM patients (at MM diagnosis (N=2) or relapsed MM cases (N=11)) were treated with NKp46-BCMA_Fc-ADE-DSB. Samples were analyzed by flow cytometry for MM cell death due to loss of CD138 expression. In parallel, NK cells (CD3 - CD56 暗 ) activation.

[0843] Materials and Methods

[0844] (1) Cell purification and co-culture conditions. One day before the MM cell lysis assay, the PBMCs of MM patients separated after density gradient centrifugation were immediately stained with CD3-PE and CD56-APC, and the results were analyzed by flow cytometry before NK activation to determine the percentage of CD3- / CD56+ cells. When NK cells showed more than 5% lymphocytes, PBMCs were stored overnight in a culture medium containing 10% FCS (FCS from Innate Pharmaceuticals to preserve NK cells) at 37°C and 5% CO2. In the presence of the test molecule, resting PBMCs and MM target cell lines were co-cultured at a ratio of 10:1 for 4 hours. Then, (i) the expression of activation markers (CD107a) on NK cells and the intracellular production of cytokines (IFNg), and (ii) MM cell death (CD138) were analyzed by flow cytometry.

[0845] (2) Cell preparation and conditions of treatment and control groups. 300,000 PBMCs and 30,000 MM target cells (Karpas 620) were collected and counted into each well of a U-shaped bottom 96-well plate to obtain a 10:1 ratio of effector cells: target cells (E:T) ratio. 400,000 PBMCs were stored in an incubator for minimal phenotyping of patient NK cells (CD56, CD3, CD16, NKp46). The cells were centrifuged at 300g for 5 minutes, resuspended in culture medium (1 / 6000) containing BD GolgiSTOPTM solution, and distributed at 300,000 PBMCs and 30,000 MM cells per well. The control conditions were as follows: the negative controls were Karpas 620, PBMCs, and Karpas620+PBMCs without added treatment. The positive control for NK activation was PBMC treated with 125 ng / ml phorbol 12-myristate 13-acetate (PMA, Sigma, reference P8139) and 1 mg / ml ionomycin (Sigma, reference I0634). The treatment groups were isotype control (10 mg / ml), NKp46-BCMA_Fc-ADE-DSB (10 mg / ml), which were added to the co-culture samples at 37°C ± 1°C and 5% ± 1% CO2 for 4 hours. Prior to adding treatments, the antibodies were centrifuged at 16000xg for 10 minutes at +4°C to eliminate potential aggregates.

[0846] (3) Staining and flow cytometric analysis. After incubation for 4 hours at 37°C ± 1°C and 5% ± 1% CO2, cells were subjected to extracellular or intracellular staining for flow cytometric analysis. (3a)Extracellular staining. The cells were transferred to a V-shaped bottom plate and centrifuged at 1900xg for 1 minute, and the supernatant was discarded. The cells were washed with 200 μl PBS and centrifuged at 1900xg for 1 minute again, and the supernatant was discarded. 50 μl of BD Pharmingen staining buffer BSA / Brilliant staining buffer plus antibody premix was added to each sample. The antibodies used for NK activation and MM cell death analysis are shown in Table 19 below. Subsequently, the cells were incubated at 4°C in the dark for 20 minutes. Finally, the cells were washed with 200 μl staining buffer, centrifuged at 1900g for 1 minute, and the supernatant (x2) was discarded. (3b) Intracellular staining. The cells were resuspended in 100 ml BD Cytofix / Cytoperm and incubated at 4°C in the dark for 20 minutes. The cells were washed twice in 200 μl of 1X BD Perm / Wash buffer (10XBD Perm / Wash buffer in distilled H2O), centrifuged at 1900g for 1 minute, and the supernatant was discarded. The cells were resuspended in 50 μl of antibody premix plus BD Perm / Wash buffer and incubated at 4°C in the dark for 30 minutes. Subsequently, the cells were washed twice with 200 μl of BD Perm / Wash buffer, centrifuged at 1900g for 1 minute, and the supernatant was discarded. Finally, the cells were resuspended in 200 μl staining buffer and analyzed by flow cytometry. Before collection, UltraComp eBeads (Invitrogen) were stained with each antibody fluorophore to establish appropriate fluorescence compensation controls. The results were analyzed using BD FACSymphony A5 and BD FACSDiva software. FlowJo software was used for analysis.

[0847] Table 19. Antibodies used for NK activation and MM cell death analysis

[0848]

[0849] result

[0850] First, the Karpas 620MM cell death induced by NKp46-BCMA_Fc-ADE-DSB was analyzed by measuring the loss of CD138 expression by flow cytometry. Regardless of the disease stage, when co-cultured with PBMCs of 10 patients in 13 MM patients, NKp46-BCMA_Fc-ADE-DSB showed induction of Karpas 620MM cell death. As expected, the isotype control did not induce MM cell death. Interestingly, 10mg / ml NKp46-BCMA_Fc-ADE-DSB-induced MM cell death was significant (p=0.0105, Figure 33A).

[0851] In parallel, by measuring NK 暗 The ability of NKp46-BCMA_Fc-ADE-DSB to induce NK cell activation was evaluated by the expression of IFNg and CD107a on NK cells (Figure 33B and Fig.33C ). Compared with the isotype control, NKp46-BCMA_Fc-ADE-DSB more specifically induced the expression of IFNg and CD107a.

[0852] Taken together, these results suggest that NKp46-BCMA_Fc-ADE-DSB has therapeutic potential for the treatment of primary or refractory MM patients.

[0853] Example 16. In vitro functional activity of NKp46-BCMA_Fc-ADE-DSB on MM patient samples

[0854] This example uses primary samples from MM patients to evaluate the ability of NKp46-BCMA_Fc-ADE-DSB to induce MM cell death. + Reduction of MM cells determined cell death.

[0855] Materials and Methods

[0856] (1) Cell purification and co-culture conditions. On the day of the MM cell death assay, bone marrow mononuclear cells (BMMCs) from MM patients were isolated by gradient density centrifugation using Ficoll-Hypaque, and immediately stained with anti-CD138-PE monoclonal antibody and analyzed by flow cytometry to determine the expression of MM cells (CD138 + BMMC or PBMC were incubated for 18 hours in the presence of negative control or SAR445514 or daratumumab.

[0857] (2) Cell preparation and conditions of treatment and control groups. 400,000 BMMCs were seeded in RPMI (containing 5% FCS and 3ng / ml recombinant human IL-6) in each well of a U-shaped bottom 96-well plate. 600,000 PBMCs were kept in an incubator for minimal phenotyping of patient NK cells (CD56, CD3, CD16, NKp46) and determination of BCMA expression of MM cells. Control conditions were as follows: Negative control was BMMC or PBMC without added treatment. The treatment group was isotype control (10μg / ml), NKp46-BCMA_Fc-ADE-DSB (10μg / ml), which were added to the sample at 37°C ± 1°C and 5% ± 1% CO2 for 18 hours. Before adding treatment, the antibody was centrifuged at 16000xg for 10 minutes at +4°C to eliminate potential aggregates.

[0858] (3) Staining and flow cytometry analysis. After incubation for 18 hours at 37°C ± 1°C and 5% ± 1% CO2, the cells were extracellularly stained for flow cytometry analysis. (3a) The cells were transferred to a V-bottom plate and centrifuged at 1900xg for 1 minute. The supernatant was discarded, and the cells were washed with 200μl PBS and centrifuged again at 1900xg for 1 minute. The supernatant was discarded. 50μl of BD Pharmingen staining buffer BSA / Brilliant staining buffer plus antibody premix was added to each sample and incubated in the dark at 4°C for 30 minutes. The cells were washed with 200μl of BD Pharmingen staining buffer BSA, centrifuged at 1900g for 1 minute, and the supernatant was discarded. This was repeated a second time. The cells were resuspended in 50μl of 1% paraformaldehyde in PBS and incubated in the dark at 4°C for 15 minutes. The cells were then washed once in 200 μl of BD Pharmingen staining buffer BSA and resuspended in 200 μl of BD Pharmingen staining buffer BSA for flow cytometric analysis.

[0859] Prior to sample acquisition, UltraComp eBeads (Invitrogen) were stained with each antibody fluorophore to establish appropriate fluorescence compensation controls. Samples and eBeads were acquired using a BD FACSymphony A5 with BD FACSDiva software. Analysis was performed using FlowJo software.

[0860] Through CD3- / CD56 暗 NK cell activation was assessed by CD16, CD107a, and CD69 expression on NK cells. + Myeloma cell death was assessed by measuring the disappearance of myeloma cells.

[0861] Table 20. Antibodies used for NK phenotyping.

[0862]

[0863] Table 21. Antibodies for NK cell activation and myeloma cell death.

[0864]

[0865]

[0866] Table 22. Antibodies used for characterization of multiple myeloma cells.

[0867]

[0868] result

[0869] The ex vivo activity of NKp46-BCMA on MM patient samples (N=16) was studied. To this end, BMMC or PBMC from multiple myeloma patients were untreated, treated with 10 mg / ml NKp46-BCMA_Fc-ADE-DSB, or treated with 10 μg / mL isotype control for 18 hours. MM cell death was measured by loss of CD138 expression using flow cytometry. Figure 16A-16C Depicted are results comparing ex vivo NKp46=BCMA_Fc-ADE-DSB NKCE treatment in samples from untreated patients versus patients who had previously received standard of care therapy or were included in a clinical trial. Patient samples were more responsive to NKp46-BCMA_Fc-ADE-DSB treatment if daratumumab was untreated ( Fig.16A ), and if the patient has multiple rounds of relapse, the likelihood of response is slightly lower ( Fig. 16B ). Fig. 16C This indicates that after relapse in the case of >4TC, the samples were less responsive to NKp46-BCMA_Fc-ADE-DSB.

[0870] These data demonstrate that NKp46-BCMA_Fc-ADE-DSB NKCE induces MM cell death in samples from MM patients at different disease stages (diagnosis or relapse).

[0871] Example 17. Combination Pharmacokinetic (PK) and Safety Study Following Repeated Subcutaneous Administration in Cynomolgus Monkeys

[0872] Methods and Materials

[0873] A stock solution of NKp46-BCMA_Fc-ADE-DSB was provided at a concentration of 50 mg / mL in 10 mM histidine (pH 5.5), 8% sucrose, 0.05% PS80, and 10 μM EDTA.

[0874] Dose Levels and Administration: NKp46-BCMA_Fc-ADE-DSB was administered to non-human primate (NHP) cynomolgus monkeys (Macaca fascicularis) of both sexes (male and female) via the subcutaneous route (SC, dorsal region) at 1 mL / kg once a week (on days 1, 8, and 15) for three weeks.

[0875] Table 23. Dose levels and animal identification per group.

[0876]

[0877] Sample Collection: Plasma was collected for pharmacokinetic (PK) and cytokine evaluations.

[0878] PK samples : Plasma samples for PK data were collected at the following times: Day 1 at 1, 5, and 24 hours; Day 8 at 0 and 24 hours; and Day 15 at 0, 1, 5, 24, and 144 hours.

[0879] Cytokine (INF-g, IL-6, IL-8 and TNF-a) evaluation: Sampling time points are before treatment, 5 and 24 hours after each administration (on the 1st, 8th and 15th days). Sampling sites are from femoral vein, saphenous vein and / or cephalic vein. Blood samples (0.5mL) are collected in K2-EDTA sampling tubes. The determination of INF-g, IL-6, IL-8 and TNF-a in monkey plasma samples is carried out using the exploratory ECLIA (electrochemiluminescence immunoassay) method (U-PLEX Proinflam Combo 1 (NHP) SECTOR assay kit, catalog number K15070K-2) from Mesoscale Discovery. All changes are expressed as compared to baseline values ​​(before the first administration on the 1st day). Due to the variability of the analysis, when the value is more than 2 times higher than the corresponding baseline value, the increase of cytokines is considered to be biologically significant. The following grading was applied: ≤2-fold change: no biologically relevant change; 3- to 10-fold change: very minimal increase; 11- to 100-fold change: minimal increase; 101- to 1000-fold change: moderate increase; and ≥1001-fold change: significant increase.

[0880] result

[0881] The concentra...

Claims

1. A binding protein comprising a first antigen binding domain (ABD) having binding specificity for BCMA and a second ABD having binding specificity for NKp46, wherein: (a) the first ABD comprises: (a1) a first immunoglobulin heavy chain variable domain (VH1) comprising a HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), a HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and a HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); and (a2) a first immunoglobulin light chain variable domain (VL1), the first immunoglobulin light chain variable domain comprising CX 1 SSTGX 2 VTPX 3 X 4 The LCDR1 sequence of the amino acid sequence of YAN (SEQ ID NO: 4), wherein X 1 is R or A, X 2 It is T or A, X 3 is S or G, and X 4 Is N or Y; contains DNNX 5 X 6 The LCDR2 sequence of the amino acid sequence of PP (SEQ ID NO: 5), wherein X 5 is S, I or N and X 6 is R or K; and contains ALX 7 X 8 GX 9 The LCDR3 sequence of the amino acid sequence of QWV (SEQ ID NO: 6), wherein X 7 W or Y, X 8 is F or Y, and X 9 is N or G; and (b) The second ABD has binding specificity for NKp46.

2. The binding protein of claim 1, wherein (b) the second ABD comprises: (b1) a second immunoglobulin heavy chain variable domain (VH2), the second immunoglobulin heavy chain variable domain comprising: - A HCDR1 sequence containing DYVIN, a HCDR2 sequence containing EIYPGSGTNYYNEKFKA, and a HCDR3 sequence containing RGRYGLYAMDY; - a HCDR1 sequence comprising GYTFSDYVIN (SEQ ID NO: 19), a HCDR2 sequence comprising EIYPGSGTN (SEQ ID NO: 20), and a HCDR3 sequence comprising RGRYGLYAMDY (SEQ ID NO: 21); - a HCDR1 sequence comprising SDYAWN (SEQ ID NO: 22), a HCDR2 sequence comprising YITYSGSTSYNPSLES (SEQ ID NO: 23), and a HCDR3 sequence comprising GGYYGSSWGVFAY (SEQ ID NO: 24); - a HCDR1 sequence comprising EYTMH (SEQ ID NO: 25), a HCDR2 sequence comprising GISPNIGGTSYNQKFKG (SEQ ID NO: 26), and a HCDR3 sequence comprising RGGSFDY (SEQ ID NO: 27); - a HCDR1 sequence comprising SFTMH (SEQ ID NO: 28), a HCDR2 sequence comprising YINPSSGYTEYNQKFKD (SEQ ID NO: 29), and a HCDR3 sequence comprising GSSRGFDY (SEQ ID NO: 30); or - a HCDR1 sequence comprising SDYAWN (SEQ ID NO: 31), a HCDR2 sequence comprising YITYSGSTNYNPSLKS (SEQ ID NO: 32), and a HCDR3 sequence comprising CWDYALYAMDC (SEQ ID NO: 33); and (b2) a second immunoglobulin light chain variable domain (VL2), the second immunoglobulin light chain variable domain comprising: - a LCDR1 sequence containing RASQDISNYLN (SEQ ID NO: 34), a LCDR2 sequence containing YTSRLHS (SEQ ID NO: 35), and a LCDR3 sequence containing QQGNTRPWT (SEQ ID NO: 36); - a LCDR1 sequence containing RVSENIYSYLA (SEQ ID NO: 37), a LCDR2 sequence containing NAKTLAE (SEQ ID NO: 38), and a LCDR3 sequence containing QHHYGTPWT (SEQ ID NO: 39); - a LCDR1 sequence containing RASQSISDYLH (SEQ ID NO: 40), a LCDR2 sequence containing YASQSIS (SEQ ID NO: 41), and a LCDR3 sequence containing QNGHSFPLT (SEQ ID NO: 42); - a LCDR1 sequence comprising RASENIYSNLA (SEQ ID NO: 43), a LCDR2 sequence comprising AATNLAD (SEQ ID NO: 44), and a LCDR3 sequence comprising QHFWGTPRT (SEQ ID NO: 45); or - A LCDR1 sequence comprising RTSENIYSYLA (SEQ ID NO: 46), a LCDR2 sequence comprising NAKTLAE (SEQ ID NO: 47), and a LCDR3 sequence comprising QHHYDTPLT (SEQ ID NO: 48).

3. The binding protein of claim 1, wherein the VL1 comprises: - a LCDR1 sequence comprising the amino acid sequence of CASSTGTVTPSNYAN (SEQ ID NO: 7), a LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 8), and a LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 9); - a LCDR1 sequence comprising the amino acid sequence of CRSSTGTVTPSNYAN (SEQ ID NO: 10), a LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 11), and a LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 12); - a LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPSNYAN (SEQ ID NO: 13), a LCDR2 sequence comprising the amino acid sequence of DNNIKPP (SEQ ID NO: 14), and a LCDR3 sequence comprising the amino acid sequence of ALWYGGQWV (SEQ ID NO: 15); or - a LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPGYYAN (SEQ ID NO: 16), a LCDR2 sequence comprising the amino acid sequence of DNNNKPP (SEQ ID NO: 17), and a LCDR3 sequence comprising the amino acid sequence of ALYYGGQWV (SEQ ID NO: 18).

4. The binding protein according to claim 1 or 2, wherein: - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:55; - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:50; - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:51; - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:52; - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:53; or - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:54, Optionally among them: - the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO: 55; - the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO: 50; - the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO: 51; - the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO: 52; - the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO: 53; or - the VH1 comprises the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO:

54.

5. The binding protein according to any one of claims 1 to 4, wherein: - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:56, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:64; - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 57, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 65; - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:58, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:66; - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:59, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO:67; - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 60, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 68; - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 61, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 69; - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 62, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 70; or - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 63, and wherein the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 71, Optionally among them: - the VH2 comprises the amino acid sequence of SEQ ID NO: 56, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 64; - the VH2 comprises the amino acid sequence of SEQ ID NO: 57, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 65; - the VH2 comprises the amino acid sequence of SEQ ID NO: 58, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 66; - the VH2 comprises the amino acid sequence of SEQ ID NO: 59, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 67; - the VH2 comprises the amino acid sequence of SEQ ID NO: 60, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 68; - the VH2 comprises the amino acid sequence of SEQ ID NO: 61, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 69; - the VH2 comprises the amino acid sequence of SEQ ID NO: 62, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO: 70; or - the VH2 comprises the amino acid sequence of SEQ ID NO:63, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO:

71.

6. The binding protein according to any one of claims 1 to 5, further comprising all or part of an immunoglobulin Fc domain or a variant thereof, optionally wherein: All or part of the immunoglobulin Fc domain or its variant binds to human Fc-γ receptor; All or part of the immunoglobulin Fc domain or its variant binds to the human CD16A (FcγRIII) polypeptide; the Fc domain comprises a native glycan at amino acid position 297 according to EU numbering; and / or The binding protein is N-glycosylated.

7. The binding protein of claim 6, wherein the Fc domain or variant thereof comprises a first Fc heavy chain and a second Fc heavy chain.

8. The binding protein of claim 7, wherein at least one Fc heavy chain comprises an engineered intrachain disulfide bond mediated by a pair of cysteines (C) substituted with: (i) leucine (L) at amino acid position 242 and lysine (K) at amino acid position 334; or (iii) arginine (R) at amino acid position 292 and valine (V) at amino acid position 302; The amino acid positions are numbered according to EU.

9. The binding protein of claim 8, wherein the first Fc heavy chain and the second Fc heavy chain each comprise a L242C / K334C substitution.

10. The binding protein of claim 8, wherein the first Fc heavy chain and the second Fc heavy chain each comprise a R292C / V302C substitution.

11. The binding protein of any one of claims 7-10, wherein at least one Fc heavy chain comprises a substitution at amino acid position 332 according to EU numbering, optionally wherein the substitution at amino acid position 332 is glutamic acid (E); optionally further comprising at least one Fc heavy chain further comprising one or more substitutions at amino acid positions 236, 239 or 330 according to EU numbering, optionally wherein the substitution at amino acid position 236 is alanine (A), the substitution at amino acid position 239 is aspartic acid (D), and the substitution at amino acid position 330 is leucine (L).

12. The binding protein according to any one of claims 7 to 11, wherein: at least one Fc heavy chain further comprises an aspartic acid (D) at amino acid position 239 and a glutamic acid (E) at amino acid position 332 according to EU numbering; at least one Fc heavy chain further comprises an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid position 239, and a glutamic acid (E) at amino acid position 332 according to EU numbering; or At least one Fc heavy chain further comprises an alanine (A) at amino acid position 236, an aspartic acid (D) at amino acid position 239, a leucine (L) at amino acid position 330, and a glutamic acid (E) at amino acid position 332 according to EU numbering.

13. The binding protein of any one of claims 1 to 12, comprising at least two polypeptide chains forming at least two antigen binding sites, wherein at least one polypeptide chain comprises a structure represented by the following formula: VL1-L1-VL2-L2-CL[I]; And at least one polypeptide chain comprises a structure represented by the following formula: VH2-L3-VH1-L4-CH1[II]; in: CL is the immunoglobulin light chain constant domain; CH1 is an immunoglobulin CH1 heavy chain constant domain; and L1, L2, L3 and L4 are amino acid linkers, wherein any one or more of L1, L2, L3 and L4 are optionally absent, and wherein the polypeptide of formula I and the polypeptide of formula II form a crossover light chain-heavy chain pair, Optionally, the binding protein comprises three polypeptide chains forming two antigen binding sites, wherein one polypeptide chain comprises a structure represented by the following formula: VL1-L1-VL2-L2-CL[I]; A polypeptide chain consists of the structure represented by the following formula: VH2-L3-VH1-L4-CH1-hinge-CH2-CH3[III]; and A polypeptide chain consists of the structure represented by the following formula: Hinge-CH2-CH3[IV] in: CL is the immunoglobulin light chain constant domain; CH1 is the immunoglobulin CH1 heavy chain constant domain; CH2 is the immunoglobulin CH2 heavy chain constant domain; CH3 is the immunoglobulin CH3 heavy chain constant domain; The hinge is an immunoglobulin hinge region connecting the CH1 domain and the CH2 domain; and L1, L2, L3 and L4 are amino acid linkers, wherein any one or more of L1, L2, L3 and L4 are optionally absent, and wherein the polypeptide of formula I and the polypeptide of formula II form a crossover light chain-heavy chain pair.

14. The binding protein of claim 13, wherein: (a) L1, L2, L3 and L4 are each independently zero amino acids in length or comprise a sequence selected from the group consisting of GGGGSGGGGS, GGGGSGGGGSGGGGS, S, RT, TKGPS, GQPKAAP and GGSGSSGSGG; or (b) L1, L2, L3 and L4 each independently comprise a sequence selected from the group consisting of GGGGSGGGGS, GGGGSGGGGSGGGGS, S, RT, TKGPS, GQPKAAP and GGSGSSGSGG.

15. The binding protein of any one of claims 1 to 14, comprising: (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72; (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73; and (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO:

74.

16. A binding protein comprising a first antigen binding domain (ABD) having binding specificity for BCMA and a second ABD having binding specificity for NKp46, wherein: (a) the first ABD comprises a first immunoglobulin heavy chain variable domain (VH1) comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and a first immunoglobulin light chain variable domain (VL1) comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 55; and (b) the second ABD comprises a second immunoglobulin heavy chain variable domain (VH2) and a second immunoglobulin light chain variable domain (VL2), the second immunoglobulin heavy chain variable domain comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 56, and the second immunoglobulin light chain variable domain comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 64, optionally wherein: The VH1 comprises the amino acid sequence of SEQ ID NO:49, and wherein the VL1 comprises the amino acid sequence of SEQ ID NO:55; and The VH2 comprises the amino acid sequence of SEQ ID NO:56, and wherein the VL2 comprises the amino acid sequence of SEQ ID NO:

64.

17. The binding protein of claim 16, comprising: (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72; (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73; and (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO:

74.

18. A binding protein comprising a first antigen binding domain (ABD) having binding specificity for BCMA and a second ABD having binding specificity for NKp46, wherein the binding protein comprises: (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72; (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73; and (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO:

74.

19. The binding protein of any preceding claim for use as a medicament.

20. The binding protein of any preceding claim for use in a method of treating or preventing a disease or disorder.

21. The binding protein of any preceding claim for use in a method of treating or preventing cancer.

22. The binding protein of any preceding claim for use in a method of treating or preventing multiple myeloma.

23. A pharmaceutical composition comprising the binding protein of any one of claims 1 to 18.

24. An isolated nucleic acid molecule comprising a nucleotide sequence encoding the binding protein of any one of claims 1 to 18.

25. An expression vector comprising the nucleic acid molecule of claim 24.

26. An isolated cell comprising the nucleic acid molecule of claim 24.

27. An isolated cell comprising the expression vector of claim 25.

28. The isolated cell of claim 27, wherein the cell is a mammalian cell.

29. A method for preparing a binding protein as claimed in any one of claims 1 to 18, the method comprising culturing the isolated cell as claimed in claim 26 or 27 under suitable conditions and recovering the binding protein.

30. A method of treating or preventing a disease or disorder, the method comprising administering the pharmaceutical composition of claim 23 to a subject in need thereof.

31. A method for treating or preventing cancer, comprising administering the pharmaceutical composition of claim 23 to a subject in need thereof.

32. A method for treating or preventing multiple myeloma, comprising administering the pharmaceutical composition of claim 23 to a subject in need thereof.

33. A method of restoring or enhancing the activity of cells expressing NKp46 in a patient in need thereof, the method comprising administering to the patient the pharmaceutical composition of claim 23.

34. A method of eliminating cancer cells in a patient in need thereof, the method comprising administering to the patient the pharmaceutical composition of claim 23.

35. A method of triggering or increasing NK cell-mediated lysis of cancer cells in a patient in need thereof, the method comprising administering to the patient the pharmaceutical composition of claim 23.

Images