Sound phase change nano liquid drop for delivering biological orthogonal PDL1 degradation agent as well as preparation method and application of sound phase change nano liquid drop

Abstract

The invention provides an acoustic phase change nano-droplet for delivering a biological orthogonal PDL1 degradation agent and a preparation method and application thereof, and belongs to the technical field of biological medicine. The invention provides a sound phase change nano liquid drop for delivering a biological orthogonal PDL1 degradation agent. The sound phase change nano liquid drop comprises an internal core and a shell layer, the inner core of the nano-droplet is perfluorohexane, and the shell layer expresses or contains RGD and a bio-orthogonal PD1 mutant mPD1. The sound phase change nano liquid drop disclosed by the invention can be subjected to liquid-gas phase change; the RGD-guided NDs can promote drug enrichment in tumor vasculature, and can be seen by ultrasound. Nano-droplet rupture caused by inertial cavitation promotes mPD1 to be poured into a tumor and forms a covalent bond with PDL1, and a lysosome degradation process is started. The acoustic phase change nano liquid drop can effectively deliver a PDL1 degradation agent and overcome the drug resistance of an immune checkpoint retardant, and has a better effect of activating immunosuppression tumor growth.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an acoustic phase-change nanodroplet for delivering a bioorthogonal PDL1 degradation agent, and a preparation method and application thereof. Background Art

[0002] Immunotherapy targeting the programmed death 1 (PD1) / programmed death ligand 1 (PDL1) pathway has revolutionized the paradigm of cancer treatment, showing significant clinical therapeutic advantages and broad prospects. Although a variety of PD1 / PDL1 monoclonal antibody inhibitors have been approved for the treatment of various tumors, they face challenges such as immune-related adverse reactions, poor tumor tissue penetration, insufficient drug metabolism characteristics, and high production costs, all of which limit their wider clinical application. PDL1 degradation has advantages in functional blocking efficiency, and it will serve as an alternative to antibodies.

[0003] Vascular dysfunction in tumors, characterized by leaky, fenestrated, tortuous, and dilated vasculature, significantly impedes drug delivery and undermines therapeutic efficacy. Due to the heterogeneity of microvascular function within tumors, only a small fraction of injected drugs reaches solid tumors. The development of efficient drug delivery systems with enhanced tumor accumulation is also critical to achieving the desired therapeutic effects. Promoting drug extravasation from the walls of tumor vasculature and facilitating drug diffusion into poorly perfused areas within solid tumors are critical to improving the efficacy of targeted therapy. Therefore, there is an urgent need to develop a new degrader targeting PDL1 protein to block the PD1 / PDL1 pathway. Summary of the invention

[0004] The present invention provides an acoustic phase-change nanodroplet for delivering a bioorthogonal PDL1 degrader, and a preparation method and application thereof. The nanodroplet can be used to deliver the bioorthogonal PDL1 degrader through ultrasound targeting guidance, and has a better tumor treatment effect.

[0005] The first object of the present invention is to provide an acoustic phase-changing nanodroplet for delivering a bioorthogonal PDL1 degrader, comprising an inner core and a shell layer;

[0006] The inner core includes perfluorohexane; the shell expresses or contains RGD and a bioorthogonal PD1 mutant mPD1.

[0007] In one embodiment of the present invention, the shell layer comprises a cell membrane engineered to express the RGD and the bioorthogonal PD1 mutant mPD1.

[0008] In a specific embodiment of the present invention, the source of the cell membrane includes eukaryotic cells.

[0009] The second object of the present invention is to provide a method for preparing the above-mentioned acoustic phase change nanodroplets, comprising the following steps: (1) constructing eukaryotic cells engineered to express RGD and the bioorthogonal PD1 mutant mPD1, and collecting the cell membranes after lysis;

[0010] (2) Dissolving the collected cell membranes and mixing them with perfluorohexane, subjecting the mixture solution to ultrasonic treatment and then extruding it to obtain the acoustic phase change nanodroplets.

[0011] In a specific embodiment of the present invention, the method for collecting the cell membrane in step (1) comprises resuspending the eukaryotic cells in a lysis buffer containing a protease inhibitor and allowing the cells to stand, disrupting the cells and removing the nucleus and mitochondria, and then centrifuging the supernatant to collect the cell membrane precipitate;

[0012] The centrifugal force of the centrifugation was 100,000 g and the centrifugation time was 60 minutes.

[0013] In a specific embodiment of the present invention, the solvent used for dissolving in step (2) is a mixture of PBS and glycerol, wherein the volume ratio of PBS to glycerol is 9:1.

[0014] In a specific embodiment of the present invention, the volume of the perfluorohexane is 1 / 8 of the volume of the solvent.

[0015] In a specific embodiment of the present invention, the temperature of the ultrasonic treatment in step (2) is 4°C, the frequency is 20 kHz, the power is 500 W, and the time is 130 seconds.

[0016] The third object of the present invention is to provide the use of the above-mentioned acoustic phase change nanodroplets or the acoustic phase change nanodroplets prepared by the above-mentioned preparation method in the preparation of drugs for treating tumors.

[0017] The last object of the present invention is to provide a drug for treating tumors, which uses the above-mentioned acoustic phase change nanodroplets or the acoustic phase change nanodroplets prepared by the above-mentioned preparation method as an active ingredient and also includes pharmaceutically acceptable excipients.

[0018] Beneficial effect: The present invention provides an acoustic phase-changing nanodroplet NDs for delivering a bioorthogonal PDL1 degrader mTx , including an inner core and a shell; the inner core of the nanodroplet is perfluorohexane PFH (C6F 14 ), the shell expresses or contains RGD and the bioorthogonal PD1 mutant mPD1, which can undergo a liquid-gas phase transition. RGD-guided NDs can promote drug enrichment in the tumor vasculature and can be visualized by ultrasound. Subsequently, the nanodroplet rupture caused by inertial cavitation promotes the perfusion of mPD1 into the tumor and forms a covalent bond with PDL1, thereby initiating the lysosomal degradation process. As a promising approach, the NDs of the present inventionmTx It can effectively deliver PDL1 degraders and overcome the resistance of immune checkpoint blockers. Specifically, (1) NDs mTx With its relatively small size advantage, it overcomes the limitation of tumor blood vessels and can be better enriched in tumor blood vessels; (2) NDs mTx It has good phase change advantages and can be imaged by ultrasound under LFUS induction; (3) Under LFUS induction, NDs mTx The radio frequency force generated by inertial cavitation can promote the delivery of drugs into the tumor parenchyma and improve the delivery efficiency; (4) The constructed bioorthogonal mPD1 has a higher PDL1 degradation efficiency when combined with PDL1 compared with wild-type PD1; (5) Synthetic NDs mTx In tumor-bearing mice, compared with NDs Tx , which has a better effect of activating immunity and inhibiting tumor growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 NDs for targeting tumor blood vessels RGD Figure 1: Construction diagram of the RGD fusion protein modified cell membrane extraction process, B: RGD fusion protein analysis of HEK293T cells and derived cell membranes by western blot, C: NDs targeting β3 RGD Schematic diagram of the synthesis of (A), D: Schematic diagram of the in vitro experimental procedure, HUVECs were incubated with DiO-labeled NDs, E: Fluorescence staining analysis of NDs that preferentially accumulated on the surface of HUVECs, NDs were labeled with DiO (green), HUVECs and HEK293T were labeled with CellTracker (red), and cell nuclei were stained with Hoechst 33342 (blue), F: Quantitative analysis of (E), G: Schematic diagram of the in vivo experiment, mice were injected with DiR-labeled NDs, H: Ex vivo images of the distribution of DiR-labeled NDs in tumor tissues and major organs, I: NDs injected sCtrl or NDs RGD Statistical evaluation of the fluorescence intensity of various organs of mice;

[0020] Figure 2 The echo characteristic results of NDs. A: Schematic diagram of the in vitro experiment, NDs were irradiated with LFUS and experienced phase change; B: Representative ultrasound images of NDs in vitro, NDs Ctrl and PBS as control group; C: Quantitative results of B; D: Schematic diagram of in vivo experiment, NDs were injected into tumor-bearing mice and then irradiated with LFUS for phase transition; E: Representative ultrasound images of tumors, NDs Ctrl and PBS as control group; F: Quantitative results of E;

[0021] Figure 3 Figure 2: Inertial cavitation promotes the penetration of nanodroplet fragments in tumors. A: Schematic diagram of the experiment to evaluate the penetration depth. 4T1 tumor-bearing mice were injected with DiI-labeled NDs, followed by control or LFUS irradiation, and tumors were collected for immunofluorescence staining. B: Representative immunostaining images showing the distribution of NDs in tumor tissues. The tumor vasculature was stained with anti-CD31 (green), NDs were stained with DiI (red), and cell nuclei were labeled with Hoechst (blue). Ctrl Used as a control, scale bar = 50 μm; C: Quantification results of DiI in B, n = 3, ***P < 0.001; P < 0.0001 by one-way ANOVA; D: 3D image analysis results of tumor penetration in mice treated with the indicated treatments; E: 3D imaging showing the distribution of red fluorescence signals; F: Quantification results of penetration determined by the relative volume of red fluorescence signals;

[0022] Figure 4 The results of the effects of NDs on mice are shown in Figure A: Experimental flow chart of treating mice with different doses of NDs; B: When the injection of NDs reaches 3X10 7 de, the penetration efficiency reaches its peak; C: Experimental flow chart of LFUS treatment of mice with different intensities; D: When the intensity reaches 2.5W / cm 2 When , the penetration efficiency reaches its peak value;

[0023] Figure 5 The results of mPD1 covalently binding to PDL1 through proximity reaction, in Figure A: PD1 plasmid, mPD1 plasmid and bioorthogonal PylRS / tRNA Pyl Schematic diagram of plasmid; B: Schematic diagram of mPD1 expression on cell membrane; C: Western analysis on treated HEK293T cell membrane, GAPDH was used as a control; D: Schematic diagram of covalent binding of mPD1 and PDL1; E: Western blot confirms the covalent binding between mPD1 and PDL1;

[0024] Figure 6 For NDs mPD1 The fragments induce PDL1 degradation in tumor cells. A: NDs mPD1 Schematic diagram of the construction; B: Western analysis of mPD1 fusion protein expression in cells and cell membranes; C: Schematic diagram of the experimental procedure, NDs mPD1 The fragments were then incubated with cells expressing PDL1; NDs mPD1 The fragments are theoretically internalized by 4T1-PDL1 cells; D: Immunostaining shows that 4T1 cells and 4T1-PDL1 cells internalize NDs mPD1Uptake of debris, NDs Ctrl As a control, NDs were stained with DiI (red) and the nuclei were labeled with Hoechst (blue); E: Western blot analysis of PDL1 expression in treated cells, using GAPDH as a control; FG: Flow cytometry was used to evaluate the expression of PDL1 in 4T1-PDL1 cells treated the same as above, and F is a representative flow cytometry image; HI: NDs mPD1 Lysosomal degradation of PDL1 by fragments. PDL1-GFP (green) overexpressing 4T1 cells was treated with PBS and NDs Ctrl or NDs mPD1 fragments were treated, and additionally treated with bafilomycin A. Nuclei were labeled with Hoechst (blue), and lysosomes were stained with LysoTrackerDeep Red (red);

[0025] Figure 7 For NDs mTx Results of inhibiting tumor progression in the 4T1 mouse model, A: Schematic diagram of the experiment, tumor-bearing mice were injected with NDs, and LFUS irradiation was performed every hour starting 30 minutes after injection for a total of 3 times. The above process was repeated every other day, and tumors were collected on the 25th day; B: The growth of tumors in mice treated as indicated was monitored every 5 days; C: Tumor weight at the end of the experiment; D: TUNEL staining of 4T1 tumor tissues showed cell death in each group; E: Statistical analysis of D;

[0026] Figure 8 For NDs mTx Activation of anti-tumor immunity by degradation of PDL1, A: Schematic diagram of the experiment, 4T1 tumor-bearing mice were injected with NDs via the tail vein on the 7th day of inoculation, followed by LFUS, the mice were killed on the 8th day, and the tumors were collected for subsequent analysis; B: Western blot analysis of PDL1 expression in tumor samples of mice with different treatments, GAPDH was used as a control; C: Representative immunohistochemical images showing PDL1 expression (brown) in tumor tissues, scale bar = 50 μm; D: Flow cytometric analysis of CD8+ T cell infiltration in tumor tissues of mice receiving designated treatments; E: Statistical analysis of D; F: Immunostaining images showing the expression of CD3 (red) and CD8 (green) in tumor tissues of treated mice; G: Quantitative IFN-γ levels in tumor tissues determined by ELISA; H: Representative immunohistochemical images showing the expression of granzyme B in tumor tissues from mice receiving designated treatments;

[0027] Fig. 9 These are the results of PDL1 overexpression, A: qPCR confirmed PDL1 overexpression results; B: western confirmed PDL1 overexpression results. DETAILED DESCRIPTION

[0028] The present invention provides an acoustic phase-changing nanodroplet NDs for delivering a bioorthogonal PDL1 degradation agent mTx , including an inner core and a shell;

[0029] The inner core includes perfluorohexane; the shell expresses or contains RGD and a bioorthogonal PD1 mutant mPD1.

[0030] In one embodiment of the present invention, the shell layer can be a cell membrane engineered to express the RGD and the bioorthogonal PD1 mutant mPD1, and the cell membrane is derived from eukaryotic cells, such as the HEK293T cells used in the examples. In one embodiment of the present invention, the inner core of the nanodroplet is perfluorohexane PFH (C6F 14 ), the outside is a cell membrane engineered to express RGD and mPD1, NDs mTx The structure is spherical, with a particle size of 580±20 nm and a potential of 20±5 mV. In one embodiment, RGD has the sequence shown in SEQ ID No. 1: TGTGCGGTGATAAGGGTCCGGATTGT;

[0031] In the embodiment of the present invention, HEK293T cells overexpressing mPD1 and RGD were constructed, specifically including the steps of PylRS / tRNA Pyl HEK293T cells were co-transfected with three plasmids, namely, RGD-PTGFRN and mPD1-PTGFRN-flag, to obtain HEK293T cells overexpressing mPD1 and RGD. Pyl The nucleotide sequence of the plasmid is the sequence shown in SEQ ID No.4; the construction method of the RGD-PTGFRN plasmid (RGD-PTGFRN-flag) comprises cloning the RGD (SEQ ID No.1) and PTGFRN (SEQID No.2) fragments into the pcDNA3.1(-) vector to construct the plasmid shown in SEQ IDNo.3; the construction method of the mPD1-PTGFRN-flag plasmid comprises cloning mPD1-PTGFRN into the pcDNA3.1(-) vector, wherein mPD1 (SEQ ID No.5) is obtained by mutating the codon CAG75 of PD1 (SEQ ID No.6) into TAG, and the sequence of the constructed plasmid mPD1-PTGFRN-flag is shown in SEQ ID No.7.

[0032] The shell layer of the present invention can also be coupled to mPD1 and RGD on the cell membrane by other methods, such as chemically coupling the purified polypeptide on the surface of nanodroplets, so that mass production is feasible.

[0033] The second object of the present invention is to provide a method for preparing the above-mentioned acoustic phase change nanodroplets, comprising the following steps: (1) constructing eukaryotic cells engineered to express RGD and the bioorthogonal PD1 mutant mPD1, and collecting the cell membranes after lysis;

[0034] (2) Dissolving the collected cell membranes and mixing them with perfluorohexane, subjecting the mixture solution to ultrasonic treatment and then extruding it to obtain the acoustic phase change nanodroplets.

[0035] In one embodiment of the present invention, the acoustic phase change nanodroplet NDs is prepared by overexpressing mPD1 and RGD in the cell membrane as a shell. mTx , firstly, eukaryotic cells expressing RGD and bio-orthogonal PD1 mutant mPD1 are constructed and cell membranes are collected after lysis, wherein the cell membrane collection method comprises resuspending the eukaryotic cells in a lysis buffer containing a protease inhibitor and letting it stand, breaking the cells and removing the nucleus and mitochondria, and then centrifuging the supernatant to collect the cell membrane precipitate; the centrifugal force of the centrifugation is 100,000g, and the centrifugation time is 60 minutes. In one embodiment of the present invention, HEK293T cells overexpressing mPD1 and RGD are harvested in a centrifuge tube and resuspended in a hypotonic lysis buffer containing a protease inhibitor (Roche, Switzerland), and placed on ice for more than 30 minutes. The suspension is homogenized 20 times by a Dounce homogenizer (Kimble885300-0002, Mexico) to break the cells. The homogenized lysis buffer is then centrifuged at 700g for 5 minutes to remove the nucleus and unbroken cells, and then centrifuged at 7000g for 15 minutes to separate the mitochondria. Finally, the remaining supernatant was centrifuged at 100,000 g for 60 min to collect the cell membrane pellet.

[0036] The present invention dissolves the cell membrane and mixes it with PFH, then ultrasonicates it, and obtains the nanodroplets by extrusion. In a specific embodiment, the extracted cell membrane is dissolved in a mixture of PBS and glycerol mixed in a volume ratio of 9:1, and PFH is added to the cell membrane mixed solution at a ratio of 1 / 8 of the total volume. The mixture solution is ultrasonicated on ice at 4°C, 130 seconds (Cole-Parmer, IL, USA), 20kHz, 500W; then extruded using an avanti micro extruder (Avanti PolarLipids Inc., AL, USA) with 800nm ​​and 400nm polycarbonate membranes; the final solution is stored at 4°C.

[0037] The present invention provides the use of the acoustic phase change nanodroplets or the acoustic phase change nanodroplets prepared by the above preparation method in the preparation of drugs for treating tumors.

[0038] NDs of the present inventionmTx It can effectively deliver PDL1 degraders and overcome the resistance of immune checkpoint blockers. Specifically, (1) NDs mTx With its relatively small size advantage, it overcomes the limitation of tumor blood vessels and can be better enriched in tumor blood vessels; (2) NDs mTx It has good phase change advantages and can be imaged by ultrasound under LFUS induction; (3) Under LFUS induction, NDs mTx The radio frequency force generated by inertial cavitation can promote the delivery of drugs into the tumor parenchyma and improve the delivery efficiency; (4) The constructed bioorthogonal mPD1 has a higher PDL1 degradation efficiency when combined with PDL1 compared with wild-type PD1; (5) Synthetic NDs mTx In tumor-bearing mice, compared with NDs Tx , which has a better effect of activating immunity and inhibiting tumor growth.

[0039] The last object of the present invention is to provide a drug for treating tumors, which uses the above-mentioned acoustic phase change nanodroplets or the acoustic phase change nanodroplets prepared by the above-mentioned preparation method as an active ingredient and also includes pharmaceutically acceptable excipients.

[0040] To further illustrate the present invention, the acoustic phase change nanodroplets for delivering a bioorthogonal PDL1 degradation agent provided by the present invention, as well as its preparation method and application are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0041] In the examples of the present invention, the reagents and methods used are conventional reagents and methods in the art unless otherwise specified.

[0042] (1) Raw materials: RGD-PTGFRN-flag plasmid, PD1-PTGFRN-flag plasmid (SEQ ID No. 8), mPD1-PTGFRN-flag plasmid, HEK293T cells, PylRS / tRNA Pyl plasmids, fluorosulfate-L-tyrosine (FSY), and perfluorohexane (PFH);

[0043] (2) Source of raw materials: The plasmid was commissioned to Nanjing GenScript for synthesis, PFH was purchased from Thermo Fisher Scientific, and FSY was purchased from Achemblock, USA.

[0044] (3) Plasmid construction method: GenScript software was used to introduce sequences into the pcDNA3.1(-) vector. The △687 segment of PTGFRN was selected, and RGD and the extracellular segment of PD1 / mPD1 were introduced into the N segment of △687PTGFRN. The flag was introduced into the C segment.

[0045] (4) Cell transfection: Prepare the constructed plasmid PylRS / tRNA Pyl , RGD-PTGFRN-flag, PD1-PTGFRN-flag and mPD1-PTGFRN-flag.

[0046] HEK293T cells were seeded in culture dishes 24 h before the experiment and transfected with 5 μg of mPD1-PTGFRN-flag / 5 μg of PD1-PTGFRN and 5 μg of PylRS / tRNA using 20 μL of Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Pyl (or 5 μg of RGD-PTGFRN) plasmid. 6 hours after transfection, the culture medium was replaced with fresh DMEM containing 1 mM FSY.

[0047] (5) Cell membrane extraction: HEK293T cells overexpressing mPD1 / PD1 and RGD were harvested in a centrifuge tube and resuspended in a hypotonic lysis buffer containing protease inhibitors (Roche, Switzerland), and placed on ice for more than 30 minutes. The suspension was homogenized 20 times by a Dounce homogenizer (Kimble 885300-0002, Mexico) to disrupt the cells. The homogenized lysis buffer was then centrifuged at 700g for 5 minutes to remove the nuclei and unbroken cells, and then centrifuged at 7000g for 15 minutes to separate the mitochondria. Finally, the remaining supernatant was centrifuged at 100,000g for 60 minutes to collect the cell membrane precipitate.

[0048] (6) Nanodroplet construction: The extracted cell membrane was dissolved in a mixture of PBS and glycerol mixed in a volume ratio of 9:1, and PFH was added to the cell membrane mixed solution at a ratio of 1 / 8 of the total volume. The mixture solution was sonicated on ice for 130 seconds (Cole-Parmer, IL, USA) and then extruded using an avanti microextruder with 800 nm and 400 nm polycarbonate membranes (Avanti PolarLipids Inc., AL, USA). The final solution was stored at 4°C.

[0049] Example 1

[0050] NDs used in this example RGD The cell membrane used was collected after HEK293T cells were transfected with RGD-PTGFRN-flag plasmid, and the nanodroplets were obtained by extrusion; NDs Ctrl The cell membranes used were collected after HEK293T cells were transfected with pcDNA3.1(-) vectors, and the nanodroplets were obtained by extrusion.

[0051] Observing NDs at the cellular level RGD Targeting performance: HUVEC highly expresses integrin β3, HEK293T cells are used as negative control, and the enrichment ability of NDs on the surface of HUVEC is observed. RGD and NDs Ctrl , NDs Ctrl As a control group. Celltracker labeled cells, DiO labeled NDs were added to the cell culture dish for 30 minutes, and it was observed that compared with NDs Ctrl , NDs RGD More targeted HUVEC, HEK293T cells only had a few droplets targeted ( Figure 1 (in DF).

[0052] Animal level: Balb / c mice were purchased from the Animal Center of Air Force Medical University and injected with 1x10 6 4T1 cells were used to establish a breast cancer 4T1 tumor-bearing mouse model with a tumor volume of 100 mm 3 The mice were randomly divided into NDs RGD and NDs Ctrl NDs labeled with DiI were injected into the tail vein and IVIS analysis was performed 4 hours later. Ctrl In contrast, the distribution of NDs in tumors RGD More( Figure 1 Medium GI).

[0053] Example 2

[0054] The continuous expansion and compression of nanodroplets during the phase change process is called stable cavitation, in which the volume of nanodroplets increases to form microbubbles, which generate enhanced ultrasonic signals. Therefore, ultrasonic irradiation is used to induce the phase change of NDs and enhance the echo of conventional ultrasound.

[0055] 293 cells were transfected with empty plasmid or RGD plasmid, cell membranes were extracted, and NDs were prepared.

[0056] In vitro imaging results Figure 2 As shown in Figures AC, the echo intensity of NDs was significantly enhanced under 650 kHz low-frequency ultrasound (LFUS). RGD and NDs Ctrl No obvious difference in echo intensity was observed between the two groups, indicating that the modification did not affect the phase transition ability of NDs. Figure 2 DF and NDs were used to perform targeted ultrasound imaging of tumor vasculature in tumor-bearing mice. Ctrl In contrast, ultrasound examination showed NDs RGD The echo signal is stronger in tumors.

[0057] Example 3

[0058] Inertial cavitation of nanodroplets during the phase transition of nanodroplets will generate a large number of microjets and enhance the subsequent payload delivery. To evaluate whether inertial cavitation promotes the penetration of nanodroplet fragments, 4T1 tumor-bearing mice were injected with DiI-labeled NDs and irradiated with LFUS (650 kHz, 5 min, 2.5 W / cm 2 ). The mice were then killed and the tumor tissues were collected for sectioning, fluorescent staining, and confocal observation.

[0059] 293 cells were transfected with empty plasmid or RGD plasmid, cell membranes were extracted, and NDs were prepared.

[0060] The results are as follows Figure 3 As shown, NDs RGD and NDs Ctrl Mainly distributed in the tumor vasculature (CD31 staining marker), more NDs RGD Colocalized with blood vessels before the burst. After inertial cavitation, increased penetration of NDs fragments was found. In addition, NDs RGD The fragments are more than NDs Ctrl 3D analysis of tumor tissue further confirmed that Ctrl Compared with the previous outbreak, there were more NDs RGD Co-localization with tumor vasculature and higher penetration efficiency can be observed after inertial cavitation.

[0061] The present invention further explored whether the number and burst intensity of NDs could affect tumor penetration.

[0062] The source of cell membranes was the same as above. The treatment of mice was the same as above.

[0063] The results are as follows Figure 4 As shown, the number of NDs and ultrasound intensity dose-dependently increased the NDs RGD Tumor penetration of fragments, when NDs RGD The number is 3×10 7 And LFUS is 2.5W cm -2 The penetration efficiency reaches its peak value.

[0064] Example 4

[0065] The present invention designs a plasmid expressing a fusion protein mPD1-PTGFRN-flag, wherein the 75th codon CAG of mouse PD1 (18566) (homologous to the 75th codon CAG of human PD1 (5133)) is mutated to an amber stop codon TAG. PylFSY was transferred, thereby replacing Gln(Q) with FSY by genetic codon amplification (GCE) technology. mPD1 was overexpressed on the membrane of HEK293T cells transfected with mPD1-PTGFRN plasmid. Western blot analysis results are shown in Figure 5 As shown in middle C, the mPD1-PTGFRN-flag fusion protein was overexpressed.

[0066] The ability of mPD1 to covalently bind to PDL1 was then explored. Therefore, 4T1-PDL1 cells overexpressing PDL1 were established (4T1 cells were infected with blank and PDL1-expressing lentiviruses), and qPCR and Western blot analysis confirmed that ( Fig. 9 Then, HEK293T-mPD1 cells overexpressing mPD1-PTGFRN-flag were mixed with 4T1-PDL1 cells.

[0067] The primers are as follows (5'-3'):

[0068] Pdl1-F (SEQ ID No. 9): GCCTGCTGTCACTTGCTACG;

[0069] Pdl1-R (SEQ ID No. 10): GTCCAGCTCCCGTTCTACAG;

[0070] Gapdh-F (SEQ ID No. 11): AGGTCGGTGTGAACGGATTTG;

[0071] Gapdh-R (SEQ ID No. 12): GGGGTCGTTGATGGCAACA.

[0072] The results are as follows Figure 5 As shown in Figure E, a band with a changed molecular weight was observed, confirming the covalent bond formed between mPD1 and PDL1 through proximity reactivity (PER).

[0073] Example 5

[0074] To evaluate whether mPD1 on nanodroplets could induce PDL1 degradation, NDs were prepared with cell membranes engineered with mPD1-PTGFRN fusion protein. mPD1 LFUS irradiation induced DiI-labeled NDs mPD1 Then, the NDs mPD1 The fragments were co-cultured with control 4T1 or 4T1-PDL1 cells at 37°C for 4 h.

[0075] The results are as follows Figure 6 As shown in D, compared with the control 4T1 cells, NDsmPD1 The fragments were preferentially taken up by 4T1-PDL1 cells. Ctrl The uptake of was similar to that of but to a much lower extent.

[0076] To evaluate the mPD1-induced degradation of PDL1, NDs mPD1 After culturing 4T1-PDL1 cells at 37°C for 24 hours, it was observed that the expression of PDL1 decreased ( Figure 6 (EG).

[0077] To further confirm whether lysosomal degradation is involved in this process, cells were treated with a lysosomal inhibitor (bafilomycin A1). 4T1 cells were transfected with PDL1-GFP plasmid and randomly divided into bafilomycin A1-treated and untreated groups. NDs mPD1 Fragments of 4 hours.

[0078] The results of microfluorescence analysis were as follows Figure 6 As shown in Figure HI, lysosomal inhibition almost blocked the reduction of PDL1 expression, further confirming that NDs mPD1 Fragments induce lysosomal degradation of PDL1.

[0079] Example 6

[0080] Delivery of mPD1 to tumor cells to construct NDs mTx , where both mPD1 and RGD are located on the nanodroplets. In addition, nanodroplets carrying wild-type PD1 and RGD were also included as controls, referred to as NDs Tx , as a control.

[0081] Study of NDs in 4T1-vaccinated Balb / c mice mTx Therapeutic effect on inhibiting tumor growth. The mice were divided into 6 groups for indicated treatment. G1: NDs Ctrl / LFUS(+)G2:NDs Ctrl / LFUS(+)G3:NDs Tx / LFUS(-)G4:NDs Tx / LFUS(+)G5:NDs mTx / LFUS(-)G6:NDs mTx / LFUS(+). Tumor-bearing mice were injected with NDs, and LFUS irradiation was performed 30 minutes later, once every hour, for three consecutive times. The above operation was performed once every other day, and repeated three times.

[0082] The results are as follows Figure 7 As shown, NDs mTxThe mice in the LFUS group showed the best treatment effect, with the lowest tumor volume and weight. No significant changes were observed in the body weight of each group during the treatment period. H&E staining of major organs and serum biochemical analysis showed no abnormal infiltration of inflammatory cells and no adverse effects on liver and kidney function, indicating that NDs are non-toxic.

[0083] In view of the therapeutic effect, the present invention also explores NDs mTx Whether the addition of LFUS treatment exerts its effect by inducing PDL1 degradation and CD8+ T cell activation. Mice were divided into 6 groups to receive different treatments, G1:NDs Ctrl / LFUS(+)G2:NDs Ctrl / LFUS(+)G3:NDs Tx / LFUS(-)G4:NDs Tx / LFUS(+)G5:NDs mTx / LFUS(-)G6:NDs mTx / LFUS(+). On the seventh day, NDs were injected, and LFUS irradiation was performed 30 minutes later, once every hour for three times in a row. The mice were treated on the eighth day.

[0084] The results are as follows Figure 8 As shown, consistent with the in vitro data, western blot and immunohistological analysis showed that NDs mTx Treatment with LFUS can reduce the expression of PDL1 in tumors. Flow cytometry and immunostaining showed that the proportion of CD3+CD8+T cells in tumors was significantly higher. In addition, the proinflammatory factors IFN-γ and Granzyme B secreted by CTLs were significantly increased in the treatment group compared with other groups. All these data indicate that NDs mTx Inhibits tumor growth by degrading PDL1 and triggering an immune response.

[0085] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An acoustic phase-change nanodroplet for delivering a bioorthogonal PDL1 degradation agent, characterized in that: Includes inner core and shell; The inner core includes perfluorohexane; the shell expresses or contains RGD and a bioorthogonal PD1 mutant mPD1.

2. The acoustic phase change nanodroplet according to claim 1, characterized in that: The shell layer includes a cell membrane engineered to express the RGD and the bioorthogonal PD1 mutant mPD1.

3. The acoustic phase change nanodroplet according to claim 2, characterized in that: The sources of the cell membrane include eukaryotic cells.

4. The method for preparing the acoustic phase change nanodroplets according to any one of claims 1 to 3, characterized in that: The following steps are involved: (1) constructing eukaryotic cells engineered to express RGD and the bioorthogonal PD1 mutant mPD1, and collecting cell membranes after lysis; (2) Dissolving the collected cell membranes and mixing them with perfluorohexane, subjecting the mixture solution to ultrasonic treatment and then extruding it to obtain the acoustic phase change nanodroplets.

5. The preparation method according to claim 4, characterized in that: The method for collecting the cell membrane in step (1) comprises resuspending the eukaryotic cells in a lysis buffer containing a protease inhibitor and letting it stand, disrupting the cells and removing the nucleus and mitochondria, and then centrifuging the supernatant to collect the cell membrane precipitate; The centrifugal force of the centrifugation was 100,000 g and the centrifugation time was 60 minutes.

6. The preparation method according to claim 4, characterized in that: The solvent used for dissolving in step (2) is a mixture of PBS and glycerol, wherein the volume ratio of PBS to glycerol is 9:

1.

7. The preparation method according to claim 6, characterized in that: The volume of the perfluorohexane is 1 / 8 of the volume of the solvent.

8. The preparation method according to claim 4, characterized in that: The temperature of the ultrasonic treatment in step (2) is 4°C, the frequency is 20kHz, the power is 500W, and the time is 130 seconds.

9. Use of the acoustic phase change nanodroplet according to any one of claims 1 to 3 or the acoustic phase change nanodroplet prepared by the preparation method according to claims 4 to 8 in the preparation of drugs related to tumor treatment.

10. A drug related to tumor treatment, characterized in that: The acoustic phase change nanodroplets according to any one of claims 1 to 3 or the acoustic phase change nanodroplets prepared by the preparation method according to claims 4 to 8 are used as active ingredients, and also include pharmaceutically acceptable excipients.

Images