Preparation and application of self-assembling glycopeptide nanoparticles for mRNA vaccine delivery

Abstract

The application belongs to the technical field of biological medicine, and specifically discloses preparation and application of self-assembled glycopeptide nanoparticles for mRNA vaccine delivery, wherein the nanoparticles are formed by self-assembly of a glycopeptide carrier, mRNA and manganese ions. In the nanoparticle preparation process, the manganese ions are adsorbed onto tryptophan and histidine through metal chelation, and play an adjuvant role in activating the cGAS-STING pathway after administration. The nanoparticles can effectively adsorb mRNA, can stably exist for 4 weeks at 4 DEG C, protect mRNA from enzymatic degradation, promote intracellular mRNA internalization and lysosome escape, effectively transfect eGFP-mRNA and Fluc-mRNA in DC2.4 and BMDC cells, and effectively target mRNA delivery to lymph nodes, activate the cGAS-STING pathway, effectively activate the specific immune system in a B16F10-OVA prevention model, delay tumor growth, and prolong the survival cycle of mice.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and particularly relates to preparation and application of self-assembled glycopeptide nanoparticles for mRNA vaccine delivery. BACKGROUND

[0002] In recent years, mRNA vaccines have become an increasingly popular means of treating infectious diseases or cancers. mRNA vaccines have the following advantages: high efficiency, high potential for rapid development, low-cost manufacturing, and safe administration. Since mRNA is easily degraded and needs to be expressed in the cytoplasm, efficient mRNA delivery and expression are crucial. However, for mRNA delivery carriers, targeted delivery and lysosomal escape are still challenging, highlighting the need for safe and effective mRNA delivery materials.

[0003] A variety of materials for mRNA delivery have been developed, including lipids, lipid materials, polymers, and protein derivatives. Lipid nanoparticles (LNPs) can be widely used to deliver small molecules, siRNA, and mRNA, and have successfully entered clinical trials, but their lack of targeting ability can cause inflammatory reactions in non-immune cells and organs such as the liver and kidneys, posing a significant safety risk. For mRNA cancer vaccines, targeted delivery to lymphoid organs is a promising strategy to improve efficacy and reduce side effects. Peptide-based delivery carriers have been extensively studied, and self-assembling peptides (SAPs) composed of amino acids can spontaneously form nanoparticles, are very suitable for structural modification, and exhibit high biological safety. Although previous studies have reported the use of SAPs to deliver mRNA, they are limited by poor targeting and expression efficiency.

[0004] The targeting ability and immunostimulatory potency of SAPs can be enhanced through structural modification and the introduction of adjuvants, thereby addressing the above problems. Adjuvants are key components that initiate and enhance the breadth, amplitude, and duration of the immune response. Alum, the most widely used adjuvant, can effectively initiate a strong humoral immune response and CD4 + T cell response, but cannot induce CD8 + T cell response. Research results show that Mn 2+ is a new agonist of the cyclic GMP-AMP synthase (cGAS)-stimulator of interferon genes (STING) pathway, and has the potential to be used as an adjuvant, especially for enhancing cellular immune response. However, the non-specific distribution of free Mn 2+ limits the therapeutic effect and makes Mn 2+ easily accumulate in the brain and spinal cord, causing neurotoxicity. Efficient adsorption of Mn 2+ in a suitable carrier is an indispensable prerequisite for fully utilizing its immune adjuvant function, but this remains a challenge to be solved. SUMMARY

[0005] To solve the above technical problems, the present application provides a preparation and application of self-assembled glycopeptide nanoparticles for mRNA vaccine delivery.

[0006] The self-assembled glycopeptide nanoparticles for mRNA vaccine delivery of the present application, which are formed by self-assembly of a glycopeptide carrier with mRNA and manganese ions to form Man-MPm nanoparticles, can effectively target and deliver mRNA to lymph nodes, activate the cGAS-STING pathway, and activate the specific immune system.

[0007] The structure of the glycopeptide carrier is expressed as Man-HHHHHHHH-RRRRRRRRR-WLWLWLWLWLWLWL, which sequentially from C-terminal to N-terminal is a hydrophobic peptide segment WLWLWLWLWLWLWL with a function of promoting self-assembly of glycopeptide, a cationic peptide segment RRRRRRRRR with a function of adsorbing mRNA, a peptide segment HHHHHHHH with a function of promoting lysosomal escape, and a mannose ligand with a function of realizing lymph node targeting.

[0008] Preferably, the polypeptide part of the glycopeptide carrier is synthesized by solid-phase polypeptide synthesis, and a linker containing an alkyne group is coupled at the N-terminal of the polypeptide.

[0009] Preferably, PEG4 is used as a linker to connect each peptide segment of the glycopeptide carrier.

[0010] Preferably, the polypeptide containing an alkyne group of the glycopeptide carrier is coupled with the mannose containing an azide group by Click reaction.

[0011] The present application also provides a preparation method of the above-mentioned nanoparticles, comprising the following steps:

[0012] S1, using RNase / DNase-free water to prepare polypeptides HHHHHHHH-RRRRRRRRR-WLWLWLWLWLWLWL and Man-HHHHHHHH-RRRRRRRRR-WLWLWLWLWLWLWL respectively, and mixing to form a polypeptide mixture;

[0013] S2, adding manganese chloride stock solution to the polypeptide mixture, and shaking at room temperature;

[0014] S3, preparing an mRNA solution, adding the polypeptide-manganese chloride mixture to the mRNA solution, shaking at room temperature, and forming a Man-MPm nanoparticle solution after ultrafiltration.

[0015] Preferably, the polypeptide HHHHHHHHH-RRRRRRRRR-WLWLWLWLWLWLWL and Man-HHHHHHHH-RRRRRRRRR-WLWLWLWLWLWLWL solution in S1 is mixed to form a polypeptide mixture with a mannose content of 10%.

[0016] Preferably, the polypeptide HHHHHHHHH-RRRRRRRRR-WLWLWLWLWLWLWL and Man-HHHHHHHH-RRRRRRRRR-WLWLWLWLWLWLWL solution in S1 is mixed to form a polypeptide mixture with a mannose content of 10%. 2+ The mixture is shaken at room temperature for 30 min.

[0017] Preferably, the mRNA solution and the polypeptide-manganese chloride mixture in S3 are mixed to form a Man-MPm nanoparticle solution with a N:P ratio of 8:1, shaken at room temperature for 30 min, and then ultrafiltered through a 10 kDa ultrafiltration tube at 4500 rpm to form a Man-MPm nanoparticle solution with a manganese ion content of 7.41% (w / w, Mn 2+ relative to the mass of the polypeptide) after ultrafiltration.

[0018] Finally, the application also provides the use of the above-mentioned nanoparticles in the preparation of a tumor prevention vaccine.

[0019] The application has the following advantages:

[0020] Compared with the prior art, (1) the application designs and prepares a new self-assembled glycopeptide delivery nanoparticle Man-MPm and determines its excellent performance as an mRNA delivery carrier and potential for developing an mRNA vaccine.

[0021] (2) The application combines the lymph node targeting function and cGAS-STING pathway activation ability into a new carrier, which can synergistically improve the immune level of the mRNA vaccine.

[0022] (3) The application uses the metal chelating ability of amino acids to adsorb manganese ions and develops an mRNA vaccine as a vaccine adjuvant, expanding the application approach of metal adjuvants. BRIEF DESCRIPTION OF DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the application, the following will briefly introduce the drawings needed to be used in the embodiment description. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0024] Figure 1 is a synthetic route map of the self-assembled glycopeptide;

[0025] Figure 2is a graph of (a) purity and (b) molecular weight of self-assembled glycopeptides;

[0026] Figure 3 is a graph of average particle size of self-assembled glycopeptide nanoparticles;

[0027] Figure 4 is a graph of zeta potential of self-assembled glycopeptide nanoparticles;

[0028] Figure 5 is a TEM graph of self-assembled glycopeptide nanoparticles;

[0029] Figure 6 is a graph of agarose gel electrophoresis of self-assembled glycopeptide nanoparticles on mRNA at different N:P;

[0030] Figure 7 is a graph of enzymatic protection effect of self-assembled glycopeptide nanoparticles on mRNA;

[0031] Figure 8 is a graph of effect of self-assembled glycopeptide nanoparticles on cell viability of DC2.4 cells at different concentrations;

[0032] Figure 9 is a schematic diagram of self-assembled glycopeptide nanoparticles promoting mRNA cellular uptake, wherein (a) is a laser confocal microscopic graph of cellular uptake, and (b) is a graph of percentage of cells positive for Cy5 fluorescence signal detected by flow cytometry at different time points;

[0033] Figure 10 is a schematic diagram of self-assembled glycopeptide nanoparticles promoting mRNA to achieve lysosomal escape, wherein (a) is a laser confocal microscopic graph of lysosomal escape, and (b) is a quantitative graph of Pearson correlation coefficient of each group;

[0034] Figure 11 is effect of self-assembled glycopeptide nanoparticles on (a) IFN-β and (b) CXCL10 mRNA of DC2.4 cells at different manganese ion concentrations;

[0035] Figure 12 is effect of self-assembled glycopeptide nanoparticles on transfection of (a) eGFP-mRNA and (b) Fluc-mRNA in DC2.4 cells, and (c) eGFP-mRNA in BMDC cells;

[0036] Figure 13 is a schematic diagram of self-assembled glycopeptide nanoparticles promoting maturation and antigen presentation of BMDC cells, wherein (a) is expression of CD80 and CD86 of BMDC cells after administration to characterize effect of nanoparticles on promoting cell maturation, and (b) is expression of surface antigens of BMDC cells after administration to characterize effect of nanoparticles on promoting antigen presentation;

[0037] Figure 14 is a schematic diagram of self-assembled glycopeptide nanoparticle lymph node targeted mRNA delivery, wherein the left panel is an imaging diagram of lymph nodes after administration, and the right panel is a bioluminescence quantification diagram in lymph nodes;

[0038] Figure 15 is a schematic diagram of self-assembled glycopeptide nanoparticle for tumor prevention model, wherein (a) is an immune flow chart, (b) is the effect of DC cell maturation in lymph nodes after administration, (c) is the effect of DC cell antigen presentation in lymph nodes after administration, (d) is the antibody titer to OVA antigen in mouse serum after administration, (e) is the IFN-γ + CD8 + representative flow diagram of T cells, (f) is the IFN-γ + CD8 + quantification diagram of T cells, (g) is a representative flow diagram of SIINFEKL-tetramer CD8 + T cells in lymph nodes after administration, (h) is a representative flow diagram of SIINFEKL-tetramer CD8 + T cells in lymph nodes after administration, (i) is a tumor growth curve diagram of tumor-bearing mice, (j) is a survival curve diagram of tumor-bearing mice. DETAILED DESCRIPTION

[0039] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all embodiments.

[0040] Embodiment 1

[0041] I) Preparation and purification of self-assembled glycopeptide

[0042] The polypeptide was synthesized by polypeptide solid-phase synthesis method, and the synthesis scale was 0.1 mmol. The polypeptide chain synthesis was carried out with a loading of 0.23 mmol / g starting from Fmoc-Leu-Wang Resin. Fmoc removal was performed using 20% piperidine-DMF solution. Fmoc-amino acid and resin coupling was performed by activating amino acids in N-methyl pyrrolidone (NMP) using DIEA and O-(benzotriazol-1-yl)-N, N, N', N'-tetramethyluronium tetrafluoroborate (TBTU). Fmoc-amino acids (6.0 eq), TBTU (6.0 eq) and DIEA (12 eq) were automatically added using a polypeptide synthesizer. Fmoc-12-amino-4, 7, 10-trioxa dodecanoic acid and propargyl-PEG3-carboxylic acid were used as building blocks similar to amino acids, and were connected to the polypeptide Figure 1). After all building blocks were coupled, the resin was transferred from the peptide synthesizer to a flask and treated with a mixture of trifluoroacetic acid / thiophenyl methyl ether / 1,2-ethanedithiol / anisole (90 / 5 / 3 / 2, v / v / v / v) for 2 hours to cleave the peptide. The crude peptide was purified by high performance liquid chromatography (HPLC) on a Waters e2695 HPLC system equipped with a dual absorbance UV detector, with a C18 column (Waters SymmetryPrep™, 19 x 300 mm, 7 μm) at a flow rate of 20 mL / min using a linear gradient of 60%-80% acetonitrile containing 0.1% trifluoroacetic acid over 20 minutes. The target glycopeptide was synthesized by click chemistry reaction Figure 1 ), the azido-modified Man ligand (1.2 eq), the alkyne-modified peptide (1.0 eq), a catalytic equivalent of trihydroxypropyltriazolylmethylamine (THPTA) and CuOAc were dissolved in water, the mixture was stirred at 40 °C for 18 hours, lyophilized, the crude product was purified using preparative reverse-phase HPLC, the glycopeptide purity was determined using analytical HPLC Figure 2 a), the molecular weight of the glycopeptide was determined by MALDI-TOF MS Figure 2 b).

[0043] II) Preparation and characterization of Man-MPm nanoparticles

[0044] To construct Man-MP nanoparticles, the glycopeptide and the peptide were dissolved in DNase / RNase-free water respectively, mixed to reach a Man content of 10%, manganese chloride was added to reach a manganese ion concentration of 63.41% (w / w, manganese ion relative to peptide), and the peptides were self-assembled by incubation at room temperature for 30 minutes. Man-MP was mixed with mRNA at room temperature for another 30 minutes of shaking to reach a nitrogen to phosphorus ratio of 8:1, and Man-MPm nanoparticles were obtained. Man-Pm and Pm were prepared in the same way, except that neither included Mn 2+ , and Pm did not contain glycopeptide. Finally, Man-MPm nanoparticles were ultrafiltrated, and the Mn 2+ content adsorbed in Man-MPm was determined by ICP-OES. The average particle size Figure 3 ) and zeta potential Figure 4 ) of the nanoparticles were determined using a Zetasizer Nano ZS90. The morphology of the nanoparticles Figure 5 ) was determined using transmission electron microscopy.

[0045] The characterization results showed that the final Mn 2+ content adsorbed to Man-MPm was 7.41%, the average particle size of the nanoparticles was 70 nm, the potential was +25.58 mV, and the morphology was spherical.

[0046] iii) Determination of mRNA adsorption capacity of Man-MP nanoparticles

[0047] The mRNA adsorption capacity of Man-MP nanoparticles was determined by agarose gel retardation assay. Different concentrations of Man-MP were mixed with the same amount of mRNA (1 μg) at different N / P ratios. The free mRNA and different Man-MP m complexes were mixed with 5x loading buffer (2.5 μL) and electrophoresed on 1% agarose gel in Tris-EDTA at 80 V for 30 min. The RNA bands were visualized by gel image analysis system. The results, as shown in Figure 6 , indicated that mRNA could be completely adsorbed at N / P ratio of 2:1.

[0048] iv) Enzyme protection assay of mRNA by Man-MP nanoparticles

[0049] To explore the enzyme protection capacity of Man-MP on mRNA, Man-MP m (N / P ratio of 8) was incubated with 75 ng RNase A at 37 °C for 10 min. Then, RNase inhibitor and heparin solution were added into the above solution successively, and incubated at 37 °C for 15 min and at 50 °C for 4 h, respectively. Figure 7 The results, as shown in Figure 7 , indicated that the mRNA displaced from Man-MP m nanoparticles remained structurally intact under enzymatic degradation, suggesting that the nanoparticles could protect mRNA from enzymatic degradation.

[0050] v) Cytotoxicity assay of Man-MP nanoparticles

[0051] DC2.4 cells were seeded in 96-well plates at a density of 1 x 10 4 per well. The next day, the cells were treated with a series of concentrations of Man-MP m. After 24 h, CCK-8 reagent was added into the culture medium, and the absorbance was measured at 450 nm after 2 h of incubation. The results, as shown in Figure 8 , indicated that the cell viability was still above 80% at a concentration of 128 μg / mL of Man-MP, suggesting that Man-MP had high safety.

[0052] vi) Cellular uptake and lysosomal escape

[0053] To evaluate the cellular uptake and lysosomal escape, Man-MP m was prepared using Cy5-labeled mRNA. DC2.4 cells were seeded in confocal dishes (1 x 10 5cells / well) and incubated overnight. After incubation with Man-MPm (Cy5 mRNA) for different time (0, 0.25, 0.5, 1, 2, 4 and 6 hours), cells were washed with PBS for three times, stained with DAPI, and analyzed for intracellular uptake Figure 9 After incubation with Man-MPm (Cy5 mRNA) for 24 hours, cells were washed with PBS for three times, stained with LysoTracker Red and DAPI for lysosome and nucleus respectively, and analyzed for lysosomal escape Figure 10 Intracellular fluorescence was observed under confocal laser scanning microscope. Or cells were seeded in 6-well plates and incubated with Man-MPm (Cy5 mRNA) for the same time, and flow cytometry was used to analyze intracellular uptake.

[0054] Results showed that the percentage of Cy5 positive DC2.4 cells reached 96.1% at 1h after administration, indicating that Man-MPm could be rapidly taken up by cells. Pearson correlation coefficient indicated the co-localization of lysosome and mRNA, and the Pearson correlation coefficient was less than 0.5 after administration of Man-MPm, indicating that Man-MPm could promote mRNA to achieve lysosomal escape.

[0055] Seven) Activation of STING pathway by Man-MP nanoparticles

[0056] To study the activation effect of STING pathway, the contents of IFN-β and CXCL10 mRNA in vitro were detected by qRT-PCR after administration. DC2.4 cells were seeded in 6-well plates at a concentration of 2x10 5 per well, and treated with Man MPm containing different concentrations of Mn 2+ for 24 hours. Then total RNA was extracted with Trizol, reverse transcribed into cDNA, and RT-PCR was performed to calculate 2 -ΔΔCt The primers used in the experiment are shown in Table 1:

[0057] Table 1 Primers used in the experiment

[0058] Forward Primer Reverse Primer CXCL10 CCAAGTGCTGCCGTCATTTTC GGCTCGCAGGGATGATTTCAA IFN-β CTGGGTGGAATGAGACTATTGT AAGTTCCTGAAGATCTCTGCTC GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA

[0059] Results are shown in Figure 11 , the contents of IFN-β and CXCL10 mRNA in DC2.4 cells increased with the increase of manganese ion content, indicating that Man-MP nanoparticles had a dose-dependent activation effect on STING pathway.

[0060] Eight) Transfection of mRNA by Man-MP nanoparticles

[0061] For mRNA transfection, DC2.4 cells (1x10 5Cells / mL) were added and incubated overnight. The cells and Man-MPm / Man-Pm / Pm (2 μg / mL eGFP-mRNA or Fluc-mRNA) were cultured in serum-free RPMI 1640 for 6 hours and then incubated with serum for 18 hours. Subsequently, the expression of fluorescent proteins was quantitatively analyzed by flow cytometry. After lysing DC2.4 cells, D-luciferin potassium salt was added as a substrate for firefly luciferase. The fluorescence expression (RLU) was then measured using a chemiluminescence instrument, and the protein content (mg / mL) was determined by Bradford assay. The expression level of Fluc-mRNA was expressed as RLU / mg. BMDCs were inoculated (2×10 5 cells / mL) and were transfected with eGFP-mRNA using the same method as DC2.4 cells.

[0062] The results are as follows Figure 12 As shown, Man-MP nanoparticles can effectively transfect eGFP-mRNA and Fluc-mRNA into DC2.4 cells, and can effectively transfect eGFP-mRNA into BMDCs.

[0063] IX) Man-MP nanoparticles induce DC maturation and antigen presentation

[0064] BMDCs were collected from healthy C57BL / 6 mice and seeded in culture dishes (5 × 10 5 Cells / dish) were cultured with complete RPMI1640 medium containing granulocyte-macrophage colony-stimulating factor (GM-CSF, 20 ng / mL) and interleukin-4 (IL-4, 20 ng / mL) for 7 days to obtain BMDCs. After culturing with Man-MPm / Man-Pm / Pm (2 μg / mL OVA-mRNA) for 24 hours, DC maturation was determined by flow cytometry after staining with anti-CD11c-APC, anti-CD80-PE and anti-CD86-PE-Cy7 antibodies. b -After staining with PE-Cy7 antibody, antigen presentation by DCs was determined.

[0065] The results are as follows Figure 13 As shown, Man-MP nanoparticles can effectively stimulate BMDC maturation and antigen presentation.

[0066] 10) Targeted delivery of Man-MP nanoparticles to LN

[0067] In vivo distribution and expression were evaluated using an in vivo imaging system (IVIS). Female C57BL / 6 mice (6-8 weeks old) were subcutaneously injected with 10 μg Fluc-mRNA containing ManMPm / Man-Pm / Pm in vivo. 24 hours after injection, D-luciferin potassium salt (150 mg / kg) was intraperitoneally injected into the mice. 10 minutes later, the mice were euthanized and the isolated LN were bioluminescence imaged using the IVIS system.

[0068] Results are shown in Figure 6. The Man-MPm administration group showed the strongest bioluminescence in the isolated lymph nodes, indicating that the Man-MP nanoparticles can achieve effective LN-targeted delivery of mRNA. Figure 14

[0069] Eleven) Mouse immunization and tumor prevention model

[0070] For the prevention model, female C57BL / c mice (6-8 weeks old) were randomly divided into several groups. The mice were immunized with different formulations containing 10 μg OVA-mRNA every seven days, and received two subcutaneous immunizations in total. On day 7 after the second administration, blood and LN were collected for analysis of antibody titers and immune cell proportions, respectively. The remaining mice were given 5x10 5 B16F10-OVA cells by unilateral subcutaneous injection, and the tumor volume was monitored every two days to evaluate the inhibition of tumor growth by the established immune response. The tumor volume was calculated as follows: V = 0.5 x L x W 2 (L is the longest diameter of the tumor, and W is the shortest diameter perpendicular to the length).

[0071] Results are shown in Figure 6. The Man-MPm administration group showed the strongest bioluminescence in the isolated lymph nodes, indicating that the Man-MP nanoparticles can achieve effective LN-targeted delivery of mRNA. Figure 15

[0072] The preferred embodiments of the present application disclosed above are only used to help explain the present application. The preferred embodiments do not describe all of the details of the application, and the application is not limited to the specific embodiments described. Obviously, many modifications and variations can be made according to the content of the present specification.​​

Claims

1. A self-assembling glycopeptide nanoparticle for mRNA vaccine delivery, characterized in that: The nanoparticles are self-assembled from glycopeptide carriers, mRNA, and manganese ions to form Man-MPm nanoparticles, which can effectively target and deliver mRNA to lymph nodes, activate the cGAS-STING pathway, and activate the specific immune system. The glycopeptide carrier structure is expressed as Man-HHHHHHHH-RRRRRRRRRR-WLWLWLWLWLWLWLWL, which, from C-terminus to N-terminus, consists of a hydrophobic peptide segment WLWLWLWLWLWLWLWL that promotes glycopeptide self-assembly, a cationic peptide segment RRRRRRRRR that adsorbs mRNA, a peptide segment HHHHHHHH that promotes lysosomal escape, and a mannose ligand that achieves lymph node targeting.

2. The self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to claim 1, characterized in that The polypeptide portion of the glycopeptide carrier is synthesized by solid-phase polypeptide synthesis, and an alkyne-containing linker is coupled to the N-terminus of the polypeptide.

3. The self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to claim 2, characterized in that The peptide segments of the glycopeptide carrier are connected using PEG4 as a linker.

4. The self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to claim 3, characterized in that The alkyne-containing polypeptide of the glycopeptide carrier is coupled to the azide-containing mannose via a Click reaction.

5. The method for preparing self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to any one of claims 1 to 4, characterized in that: The following steps are involved: S1. Use RNase / DNase-free water to prepare the peptides HHHHHHHH-RRRRRRRRRR-WLWLWLWLWLWLWLWL and Man-HHHHHHHH-RRRRRRRRR-WLWLWLWLWLWLWL, respectively, and mix them to form a peptide mixture; S2. Add manganese chloride mother solution to the polypeptide mixture and shake at room temperature; S3. Prepare the mRNA solution, add the polypeptide-manganese chloride mixture to the mRNA solution, shake at room temperature, and form a Man-MPm nanoparticle solution after ultrafiltration.

6. The method for preparing self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to claim 5, characterized in that: The polypeptide solutions HHHHHHHHH-RRRRRRRRRR-WLWLWLWLWLWLWLWL and Man-HHHHHHHH-RRRRRRRRR-WLWLWLWLWLWLWLWL in S1 are mixed to make the mannose content reach 10%, thereby forming a polypeptide mixture.

7. The method for preparing self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to claim 5, characterized in that: In S2, manganese chloride mother solution is added to the polypeptide mixture to make the concentration of the added polypeptide solution 63.41%, and the mixture is shaken at room temperature for 30 minutes.

8. The method for preparing self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to claim 5, characterized in that: The mRNA solution in S3 and the polypeptide-manganese chloride mixture were mixed to adjust the N:P ratio to 8:1, shaken at room temperature for 30 minutes, and ultrafiltered using a 10 kDa ultrafiltration tube at 4500 rpm to form a Man-MPm nanoparticle solution. The manganese ion content after ultrafiltration was 7.41%.

9. Use of the self-assembling glycopeptide nanoparticles for mRNA vaccine delivery according to any one of claims 1 to 4 in the preparation of tumor prevention vaccines.

Images