An anti-nrnp / sm antibody or antigen-binding fragment thereof and uses thereof

By preparing anti-nRNP/Sm antibodies or their antigen-binding fragments, the problem of unstable raw materials for antibody quality control products has been solved, enabling the production of high-titer and high-accuracy antibodies that meet the needs of clinical testing.

CN119371547BActive Publication Date: 2025-11-28SHENZHEN AIVD BIOTECH INC
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411781032.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-05
Publication Date
2025-11-28
Estimated Expiration
2044-12-05

AI Technical Summary

Technical Problem

The existing quality control materials for anti-nRNP/Sm antibodies have unstable raw material sources, large batch-to-batch variations, and low specificity, which limits the clinical application of the test products.

Method used

Develop an anti-nRNP/Sm antibody or its antigen-binding fragment, including a heavy chain variable region and a light chain variable region, and prepare monoclonal or polyclonal antibodies using methods such as hybridoma technology and phage display technology. Achieve large-scale production in host cells through gene cloning and expression vectors.

Benefits of technology

It provides high-titer, high-accuracy, and stable anti-nRNP/Sm antibodies or their antigen-binding fragments, solving the problems of traceability and large-scale supply of positive blood, and providing an excellent source of raw materials for calibration products, positive controls, and quality control products of anti-nRNP/Sm detection kits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119371547B_ABST
    Figure CN119371547B_ABST
Patent Text Reader

Abstract

The application discloses an anti-nRNP / Sm antibody or antigen binding fragment thereof and application thereof, and relates to the technical field of in vitro diagnostic reagents. The anti-nRNP / Sm antibody or antigen binding fragment thereof provided by the application comprises a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 1; and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 2. The detection reagent provided by the application comprises the anti-nRNP / Sm antibody or antigen binding fragment thereof. The anti-nRNP / Sm antibody or antigen binding fragment thereof provided by the application solves the problems of traceability and large-scale supply of positive blood. The anti-nRNP / Sm or antigen binding fragment thereof prepared by using the scheme of the application has high titer, high accuracy and good stability, and provides a raw material source with excellent performance for the preparation of a standard, positive control and quality control of an anti-nRNP / Sm detection kit.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological detection technology, and in particular to an anti-nRNP / Sm antibody or antigen-binding fragment thereof and application thereof. BACKGROUND

[0002] Autoimmune diseases (referred to as "self-immune diseases" for short) are diseases caused by the immune system reacting to the body's own components and causing damage. Under normal circumstances, the immune system only reacts to foreign substances invading the body, such as bacteria, viruses, parasites, and transplants, and eliminates or rejects these foreign substances. Under the influence of certain factors, the body's tissue components or the immune system itself have some abnormalities, causing the immune system to mistakenly attack the body's own components as foreign substances. At this time, the immune system produces antibodies and active lymphocytes against some components of the body, damaging and destroying the body's own tissues and organs, leading to disease.

[0003] Due to the large number of autoimmune diseases, autoimmune diseases are usually divided into two categories. One is systemic autoimmune disease, which is mainly characterized by multiple organ or tissue involvement, such as rheumatoid arthritis, systemic lupus erythematosus, Sjogren's syndrome, systemic vasculitis, etc. The other is organ-specific autoimmune disease, which only involves one tissue or organ, such as autoimmune liver disease, type I diabetes, etc.

[0004] Systemic sclerosis (SSc) is a connective tissue disease characterized by collagen fiber hardening of the skin and various systems. Systemic scleroderma involving internal organs is also known as systemic sclerosis. This disease is the second most common connective tissue disease after lupus erythematosus and belongs to "self-immune diseases".

[0005] Anti-nRNP / Sm antibody positivity is part of the autoantibody test and is of great significance for the diagnosis of autoimmune diseases. nRNP antibody is an antibody against ribonucleic acid and is often found in mixed connective tissue disease and other connective tissue diseases such as lupus erythematosus, rheumatoid arthritis, Sjogren's syndrome, dermatomyositis, and scleroderma. Sm antibody is a specific antibody for systemic lupus erythematosus, and its positive rate in patients with systemic lupus erythematosus is about 40%, with good specificity.

[0006] Anti-nRNP / SM positivity indicates abnormal immune function and may be associated with autoimmune diseases. Anti-nRNP antibody positivity is mainly found in mixed connective tissue disease and is an important basis for the diagnosis of mixed connective tissue disease. Anti-SM antibody positivity is closely related to systemic lupus erythematosus and is a marker antibody for systemic lupus erythematosus. Therefore, anti-nRNP / SM positivity mainly represents abnormal immune function in patients and may be associated with autoimmune diseases such as systemic lupus erythematosus and mixed connective tissue disease.

[0007] Stable indoor quality control products can effectively monitor the precision and accuracy of the detection results. However, the current market commercial anti-nRNP / Sm antibody quality control products are mostly human positive serum, but the serum source is difficult, and the batch difference is large, the batch is small, and the source is imported, which is expensive, limiting the clinical application of the detection product. Therefore, it is urgent to independently develop an anti-nRNP / Sm antibody with high affinity and specificity, which can be mass-produced and used for daily quality control of clinical laboratories. SUMMARY

[0008] The technical problem to be solved by the present application is to provide an anti-nRNP / Sm antibody or antigen binding fragment thereof and application, to solve the problems of unstable source of existing quality control antibody raw materials, large batch difference and low specificity.

[0009] In order to solve the above problems, the present application proposes the following technical scheme:

[0010] In a first aspect, the present application provides an anti-nRNP / Sm antibody or antigen binding fragment thereof, comprising a heavy chain variable region and a light chain variable region.

[0011] The amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 1, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO. 2.

[0012] The antibody or antigen binding fragment thereof is a monoclonal antibody or a polyclonal antibody. The monoclonal antibody can be developed by various methods and technologies, including hybridoma technology, phage display technology, single lymphocyte gene cloning technology, etc.

[0013] Further, the anti-nRNP / Sm antibody or antigen binding fragment thereof further comprises a heavy chain constant region, and the heavy chain constant region comprises:

[0014] CH1 with an amino acid sequence shown as SEQ ID NO. 3;

[0015] Hinge with an amino acid sequence shown as SEQ ID NO. 4; and

[0016] Fc with an amino acid sequence shown as SEQ ID NO. 5.

[0017] Further, the heavy chain constant region is selected from the conservative amino acid sequence of the human IgG1 heavy chain constant region.

[0018] Further, the anti-nRNP / Sm antibody or antigen binding fragment thereof further comprises a light chain constant region CL, and the amino acid sequence of the light chain constant region CL is shown as SEQ ID NO. 6.

[0019] Further, the light chain constant region CL is selected from the conserved amino acid sequence of human IgGl light chain constant region.

[0020] Further, the heavy chain amino acid sequence of the anti-nRNP / Sm antibody or antigen binding fragment thereof is shown in SEQ ID NO. 7, and the light chain amino acid sequence is shown in SEQ ID NO. 8.

[0021] The method for preparing the antibody or antigen binding fragment thereof is a conventional preparation method in the art. Preferably, the preparation method is: isolation from a host cell expressing the antibody or antigen binding fragment thereof, or obtaining by artificially synthesizing the protein sequence. The isolation from the host cell expressing the antibody or antigen binding fragment thereof is preferably as follows: cloning a nucleic acid molecule encoding the antibody or antigen binding fragment thereof and carrying a point mutation into a vector, transforming the obtained vector into a host cell, and obtaining the antibody or antigen binding fragment thereof by culturing the obtained host cell.

[0022] In a second aspect, the present application provides a nucleic acid molecule encoding the anti-nRNP / Sm antibody or antigen binding fragment thereof of the first aspect.

[0023] Further, the heavy chain variable region nucleotide sequence of the anti-nRNP / Sm antibody or antigen binding fragment thereof is shown in SEQ ID NO. 9, and the light chain variable region nucleotide sequence is shown in SEQ ID NO. 10.

[0024] Further, the heavy chain constant region CH1 region nucleotide sequence of the anti-nRNP / Sm antibody or antigen binding fragment thereof is shown in SEQ ID NO. 11; the Hinge region nucleotide sequence is shown in SEQ ID NO. 12; and the Fc region nucleotide sequence is shown in SEQ ID NO. 13.

[0025] Further, the light chain constant region CL nucleotide sequence of the anti-nRNP / Sm antibody or antigen binding fragment thereof is shown in SEQ ID NO. 14.

[0026] Further, the heavy chain nucleotide sequence of the anti-nRNP / Sm antibody or antigen binding fragment thereof is shown in SEQ ID NO. 15, and the light chain nucleotide sequence is shown in SEQ ID NO. 16.

[0027] The method for preparing the nucleic acid molecule is a conventional preparation method in the art, and preferably includes the following steps: obtaining a nucleic acid molecule encoding the above-mentioned antibody or antigen binding fragment thereof by gene cloning technology, or obtaining a nucleic acid molecule encoding the above-mentioned antibody or antigen binding fragment thereof by artificial full sequence synthesis method.

[0028] The skilled person will appreciate that the base sequence encoding the amino acid sequence of the above-mentioned antibody or antigen-binding fragment thereof can be appropriately substituted, deleted, altered, inserted or added to provide a homologue of the polynucleotide. A homologue of the polynucleotide of the present application can be prepared by substituting, deleting or adding one or more bases of the sequence of the gene encoding the antibody or antigen-binding fragment thereof within the range of maintaining the activity of the antibody, and is also included in the present application.

[0029] In a third aspect, the present application provides a vector comprising the nucleic acid molecule of the second aspect.

[0030] The vector can be obtained by a conventional method in the art, i.e. by ligating the nucleic acid molecule of the present application to various expression vectors. The expression vector is any conventional vector in the art as long as it can accommodate the aforementioned nucleic acid molecule. Preferably, the vector includes various plasmids, cosmids, bacteriophages or viral vectors, etc.

[0031] In a fourth aspect, the present application provides a host cell comprising the nucleic acid molecule or the vector.

[0032] The host cell can be prepared by a conventional method in the art, preferably by transforming the aforementioned vector into the host cell. The host cell is any conventional host cell in the art as long as it can satisfy the stable self-replication of the aforementioned vector and the effective expression of the nucleic acid carried by the vector. Preferably, the host cell is E. coli TG1 or BL21 cell (for expressing single-chain antibody or Fab antibody), or CHO-K1 cell (for expressing full-length IgG antibody). The aforementioned recombinant expression plasmid is transformed into the host cell to obtain the preferred host cell of the present application. The transformation method is any conventional transformation method in the art, preferably chemical transformation, heat shock or electroporation.

[0033] The present application also provides a method for detecting the presence or level of anti-nRNP / Sm antibody in a sample using the anti-nRNP / Sm antibody or antigen-binding fragment thereof of the present application, or the use of the anti-nRNP / Sm antibody or antigen-binding fragment thereof of the present application in the preparation of a kit for detecting the presence or level of anti-nRNP / Sm antibody in a sample.

[0034] In a fifth aspect, the present application provides a detection reagent comprising the anti-nRNP / Sm antibody or antigen-binding fragment thereof of the first aspect.

[0035] In a sixth aspect, the present application provides a kit comprising the anti-nRNP / Sm antibody or antigen-binding fragment thereof of the present application, or the detection reagent of the present application.

[0036] The application also provides the use of the anti-nRNP / Sm antibody or antigen-binding fragment thereof in detecting the presence or level of anti-nRNP / Sm antibody in a sample, or in preparing a kit for detecting the presence or level of anti-nRNP / Sm antibody in a sample; or the use of the detection reagent, the kit in detecting the presence or level of anti-nRNP / Sm antibody in a sample.

[0037] It should be noted that the kit usually comprises one or more detection reagents containing the specific antibody to be measured, which can be used as a quality control, positive control or standard. The standard is used to establish a standard curve with the concentration of the antibody, or a single positive control can be used near the positive / negative cutoff value. Preferably, the standard or positive control is prepared with the specific antibody to be tested or a material chemically similar thereto. Ideally, the standard or control is manufactured to interact with other assay components in a manner similar to the test analyte (specific antibody). Usually, a plurality of standards containing different concentrations of specific antibodies spanning the concentration range of the analyte to be tested are included. When the detection reagent is used as a standard, positive control or quality control for anti-nRNP / Sm antibody detection, the concentration of the anti-nRNP / Sm antibody in the detection reagent is indicated, that is, explicit, and its concentration can be adjusted according to the needs of detection.

[0038] Of course, the kit also includes other necessary detection reagent components for detecting anti-nRNP / Sm antibody, such as chemiluminescence immunoassay related reagent components, specifically nRNP / Sm antigen coated solid phase carrier components and labeled antibody reagent components, etc.

[0039] In other aspects, the application also provides a screening method for anti-nRNP / Sm antibody or antigen-binding fragment thereof, the specific steps of which are as follows:

[0040] S1, collecting positive whole blood of autoimmune nRNP / Sm patients;

[0041] S2, isolating lymphocytes in the positive whole blood and extracting RNA;

[0042] S3, synthesizing cDNA by reverse transcription with the RNA obtained in step S2 as a template, and then performing PCR amplification with the obtained cDNA as a template, connecting the amplification product with a vector, and electrotransferring into TG1 competent cells to construct a gene library of anti-nRNP / Sm antibody or antigen-binding fragment thereof;

[0043] S4, amplifying the phage gene library, adding helper phage, and then adding IPTG for induction expression to obtain a protein display library of anti-nRNP / Sm antibody or antigen-binding fragment thereof;

[0044] S5, obtaining specific anti-nRNP / Sm antibody or antigen-binding fragment thereof phage by at least three rounds of biopanning with biotinylated nRNP / Sm antigen;

[0045] S6, sequencing the phage to obtain the gene sequence of the anti-nRNP / Sm antibody or antigen-binding fragment thereof, and then performing molecular cloning to obtain the anti-nRNP / Sm antibody or antigen-binding fragment thereof by recombinant expression.

[0046] Compared with the prior art, the technical effects that can be achieved by the present application include:

[0047] The anti-nRNP / Sm antibody or antigen-binding fragment thereof provided by the present application solves the problems of tracing and large-scale supply of positive blood. The application of the scheme of the present application can prepare high-titer, high-accuracy and good stability anti-nRNP / Sm or antigen-binding fragment thereof, which provides a good raw material source for the preparation of performance excellent anti-nRNP / Sm detection kit standard / positive control / quality control. BRIEF DESCRIPTION OF DRAWINGS

[0048] Figure 1 RNA agarose gel electrophoresis results extracted from positive whole blood by the present application;

[0049] Figure 2 Agarose gel electrophoresis results of the heavy chain variable region amplified by the present application;

[0050] Figure 3 Agarose gel electrophoresis results of the light chain variable region amplified by the present application;

[0051] Figure 4 ScFv fragment amplification results of the present application;

[0052] Figure 5 SDS-PAGE detection results of a strain of anti-nRNP / Sm antibody with high affinity and specificity screened by the present application;

[0053] Figure 6 Immunoblotting film strip detection results of the nRNP / Sm antibody of the present application. DETAILED DESCRIPTION

[0054] The technical solutions in the embodiments will be described clearly and completely below with reference to the drawings in the embodiments of the present application. Obviously, the following described embodiments are only a part of the embodiments of the present application, not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0055] Construction of ScFv phage display library and screening of anti-nRNP / Sm antibody

[0056] 1.1 Collection of positive blood

[0057] 30 nRNP / Sm autoimmune patients aged between 20-50 years were collected, and 2 mL of positive whole blood was collected from each patient.

[0058] 1.2 Isolation of lymphocytes and extraction of total RNA

[0059] The collected positive whole blood was separated into lymphocytes using the QIAamp RNA Blood Mini kit (50) instructions, and total RNA was extracted according to the Trizol kit instructions. The required amount of RNase-free water was added for dissolution and preservation, and agarose gel electrophoresis was performed for detection. The results are shown in Figure 1 Note that all materials used should be free of RNAse, and a mask should be worn during operation to prevent the introduction of RNAse and degradation of RNA.

[0060] 1.3 Amplification of antibody heavy chain variable region and light chain variable region

[0061] According to the Takara reverse transcription kit instructions PrimeScriptTMII 1st strand cDNA synthesis kit, the RNA obtained in 1.2 was used as a template for reverse transcription to synthesize cDNA. Then the obtained cDNA was used as a template for PCR reaction to amplify the heavy chain variable region and light chain variable region sequences. The PCR reaction conditions and procedures were as follows: 95°C for 5 minutes; 95°C for 30 seconds, 55°C for 60 seconds, 68°C for 60 seconds, 30 cycles; 68°C for 5 minutes. The PCR products were identified by 1.2% agarose gel electrophoresis, and the length of the heavy chain variable region gene was about 375 bp; the length of the light chain variable region gene was about 330 bp. The primer sequences are shown in Table 1, and the agarose gel electrophoresis of the heavy chain variable region and light chain variable region are shown in Figure 2 and Figure 3 .

[0062] Table 1 Amplification primers of heavy chain variable region and light chain variable region

[0063]

[0064]

[0065] 1.4 Amplification of ScFv fragment

[0066] The amplified heavy chain variable region and light chain variable region genes were used as templates for PCR reaction with specific primers. The PCR reaction conditions and procedures were as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 60 s, 68°C for 60 s, 30 cycles; 68°C for 5 min. The PCR products were identified by 1.2% agarose gel electrophoresis. The length of the ScFv fragment gene was about 750 bp. The primer sequences are shown in Table 2. The results of ScFv gel electrophoresis are shown in Figure 2. Figure 4

[0067] Table 2 Primer sequences for amplifying ScFv fragments

[0068] Primer Name Primer Sequence MH-VH-scFv-F gtcctcgcaccatggcc MHkappaCLscFv-NotI raccgcctccgcggccgcgaagacagatggtgcagccacagt MH-VH-scFv-F gtcctcgcaccatggcc MHLambdaCLscFv-NotI raccgcctccgcggccgcagaggasggygggaacagagtgac

[0069] 1.5 Construction of antibody gene library

[0070] The vector pCANTAB-5E and the second round amplification product were double digested with Not I and Nco I, respectively. The digested products were recovered by a gel recovery kit and ligated by T4 DNA ligase. The ligation product was purified by a PCR product purification kit. The purified ligation product was added to 50 μL of TG1 electrotransformation competent cells, and electrotransformed under the following conditions: 1 mm electrotransformation cup, 1800 V voltage. After recovery culture in medium, 10 μL of gradient dilution was plated to calculate the number of colonies, and the capacity of the antibody library was 2.4 x 1010. 8 .

[0071] 1.6 Amplification of phage library

[0072] Fifty microliters of the above bacterial library was inoculated into 50 mL of 2*YT medium containing 2% glucose and ampicillin, and cultured at 37°C and 220 rpm until OD600=0.5. Then, 500 μL of helper phage M13KO7 was added, and the mixture was incubated at 37°C for 1 h. The mixture was centrifuged, and the supernatant was replaced with 50 μg / mL kanamycin and 100 μg / mL ampicillin. The mixture was cultured at 26°C and 220 rpm overnight. Forty milliliters of supernatant was collected, and 10 mL of PEG / NaCl (20% / 2.5 M) solution was added to mix well. The mixture was centrifuged, and the supernatant was discarded. The precipitate was washed with 1 mL of pre-cooled PBS on ice, and centrifuged to remove insoluble substances.

[0073] 1.7 Antibody screening

[0074] ​The streptomycin affinity beads were blocked with 3% milk-PBS for 2 hours, and the phage library was blocked for 1 hour. The blocked phage library was added with an appropriate amount of biotinylated nRNP / Sm antigen, and mixed with a shaker at room temperature at 36°C for 1 hour. The blocked magnetic beads were added, washed with PBST for 10 times, and the phage bound with the antigen was eluted with 0.2M glycine solution. The eluted phage was transfected into TG1 for the next round of screening. The screening operation was repeated, and after 3 rounds of screening, the positive clones were verified by ELISA, and a strain with high affinity was obtained, named nRNP / Sm-14D9. The sequencing analysis of nRNP / Sm-14D9 obtained the amino acid sequence of the heavy chain variable region as SEQ ID NO. 1, and the nucleotide sequence encoded thereby as SEQ ID NO. 9. The amino acid sequence of the light chain variable region was SEQ ID NO. 2, and the nucleotide sequence encoded thereby was SEQ ID NO. 10.

[0075] Example 2: Recombinant preparation and performance verification of nRNP / Sm antibody

[0076] 2.1 Gene synthesis

[0077] 2.1.1 This embodiment provides an anti-nRNP / Sm antibody, which comprises a light chain and a heavy chain. The amino acid composition of the light chain, from N-terminal to C-terminal, is VL-CL, and the sequence is SEQ ID NO. 2-SEQ ID NO. 6. The amino acid composition of the heavy chain, from N-terminal to C-terminal, is VH-CH1-Hinge-Fc, and the sequence is SEQ ID NO. 1-SEQ ID NO. 3-SEQ ID NO. 4-SEQ ID NO. 5.

[0078] 2.1.2 According to the sequence of the anti-nRNP / Sm antibody, the Kozak sequence: gccgccacc, the signal peptide sequence (SEQ ID NO. 17), and the stop codon sequence: taa are introduced, and are sent to a gene synthesis company (Qingke) for codon optimization and gene synthesis.

[0079] SEQ ID NO. 17: signal peptide sequence

[0080] atggactggacgtggcggattctctttcttgttgcagcagcaaccggagcacatagc.

[0081] 2.2 Construction of antibody expression vector

[0082] 2.2.1 Amplification of antibody heavy chain and light chain fragments

[0083] The synthesized light chain and heavy chain genes were used as templates, and then the PCR reaction solution was prepared according to the following components: 50 ng of DNA template, 1 μL of forward primer, 1 μL of reverse primer, 5 μL of 10x ExTaq buffer, 0.25 μL of HS ExTaq, and ddH2O was added to 50 μL. The reaction conditions were as follows: 98 ℃ for 3 min; 94 ℃ for 50 s, 55 ℃ for 30 s, 68 ℃ for 40 s, for 40 cycles; 72 ℃ for 10 min. The DNA was recovered and the concentration was determined, and it was stored at -20 ℃ for short-term preservation.

[0084] Table 3: Heavy chain and light chain amplification primer sequences

[0085]

[0086] 2.2.2 pcDNA3.1 vector digestion, vector and antibody ligation

[0087] The vector digestion reaction system was as follows: 5 μg of pcDNA3.1 empty vector, 2 μL of Hind III, 2 μL of EcoR I, 10 μL of 10x buffer, and ddH2O was added to 100 μL, and the reaction was carried out at 37 ℃ for 1 h. 1% agarose gel electrophoresis was performed, the DNA was recovered and the concentration was determined, and it was stored at -20 ℃ for short-term preservation.

[0088] The vector and antibody ligation system was as follows: 50 ng of vector fragment, 10 ng of antibody fragment, 5 μg of 2x buffer, 1 μL of seamless cloning ligase, and ddH2O was added to 10 μL. The reaction was carried out at 37 ℃ for 30 min.

[0089] 2.2.3 Plating and sequencing

[0090] The transformation system was as follows: 100 μL of Top10 competent cells, 10 μL of ligation reaction solution, mixed, ice bath for 30 min. 42 ℃ heat shock for 90 s, ice bath for 5 min. Then plated on LB solid plate containing 100 μg / mL of ampicillin antibiotic, 37 ℃ inverted overnight culture. Pick single colony to LB liquid medium containing 100 μg / mL of ampicillin antibiotic, 37 ℃, 220 rpm shaking bed for 6 h, sent for sequencing.

[0091] 2.2.4 Plasmid extraction

[0092] The sequence alignment sequencing results, the correct sequence of bacteria liquid was inoculated into 400 mL of LB liquid containing 100 μg / mL of ampicillin antibiotic, 37 ℃, 220 rpm shaking bed overnight culture. The plasmid was extracted by plasmid extraction kit (OMEGA, D6924-04), and the plasmid concentration was detected by ultraviolet spectrophotometer, and it was stored at -20 ℃ for standby.

[0093] 2.3 Preparation of anti-nRNP / Sm antibody

[0094] 2.3.1 Resuscitate 293F cells with serum-free medium (Expi 293 medium) and wait for the density to 3-5 x 10 6 cells / mL, then subculture at 0.5 x 10 6 cells / mL, subculture every 3-4 days, subculture for 3 generations, subculture at 3 x 10 6 cells / mL, subculture 500 mL / bottle, take the heavy chain plasmid 250 μg and the light chain plasmid 300 μg which have been extracted, mix with 25 mL of serum-reduced medium (Opti-MEM TM ), take 1.65 mL PEI (1 mg / mL), mix with 25 mL of serum-free medium (Expi 293 medium), then add PEI to the plasmid, mix, stand for 15 min, then add to the subcultured 500 mL cells, and put into a shaker for culture (culture conditions are 37℃, 8% CO2, 120 rpm).

[0095] 2.3.2 After 24 h of plasmid addition, add feed (0.5% enhancer 1 and 5% enhancer 2), then culture for 4-6 days until the cell density is about 60%. Centrifuge at 1000 rpm, room temperature for 10 min. Take the supernatant, centrifuge at 12000 rpm, room temperature for 30 min, filter with 0.22 μm, purify the quality control antibody with Protein G (cytiva) filler, dialyze with PBS and ultrafiltrate, detect the protein concentration with a spectrophotometer and detect the protein purity with SDS-PAGE. The detection results are shown in Table 4 and Figure 5 .

[0096] Table 4 Detection results of plasmid bulk concentration

[0097] - Heavy Chain Light Chain Concentration (ng / μL) 1233 1089 Volume (mL) 2.1 2.3

[0098] Table 5 Detection results of antibody concentration

[0099] - nRNP / Sm Antibody Expression Volume (mL) 500 Detection Concentration (mg / mL) 4.72 Final Yield (mg / L) 141.6

[0100] 2.4 ELISA activity verification of the antibody

[0101] The expressed antibody was detected by ELISA method. The nRNP / Sm antigen was coated on the enzyme-labeled strip, and coated at 4℃ overnight, and the plate was washed 3 times; the blocking solution was used to block the enzyme-labeled strip, and incubated at 37℃ for 2 h, and the plate was washed 3 times; the sample was added, and incubated at 37℃ for 30 min, and the plate was washed 3 times; the human secondary antibody HRP was added, and incubated at 37℃ for 30 min, and the plate was washed 3 times; color development, 10 min, termination, and reading. The detection results are shown in Table 6.

[0102] Table 6 Detection results of nRNP / Sm antibody ELISA activity

[0103]

[0104]

[0105] Example 3 Stability verification of the antibody

[0106] This example uses the anti-nRNP / Sm antibody to prepare negative blood into a quality control product for stability evaluation.

[0107] 3.1 Thermal stability: The prepared nRNP / Sm quality control product was divided into four equal parts, 1 mL per part. One part was placed at -20°C as a control, and the other three parts were placed at 37°C. At the 7th day, 14th day, and 1 month time points, one part was removed and then placed at -20°C. After 1 month, the four quality control products were tested, and the samples taken at each time point were compared with the sample stored at -20°C for ELISA detection results.

[0108] 3.2 Freeze-thaw stability: The prepared nRNP / Sm quality control product was divided into four equal parts, 1 mL per part. One part was placed at -20°C as a control, and the other three parts were placed at -20°C and then subjected to freeze-thaw cycles 3 times, 5 times, and 10 times, respectively. After collecting the samples, their activity was analyzed by ELISA. The results are shown in Table 7

[0109]

[0110] From the ELISA detection results, the anti-nRNP / Sm antibody of the present application has good stability after 1 month of accelerated stability investigation at 37°C, and its performance is comparable to that of the control group (-20°C storage). After 3 freeze-thaw cycles, its activity is comparable to that before freeze-thaw, and after 5 freeze-thaw cycles, its activity decreases significantly. The antibody of the present application has good thermal stability, and storage should not exceed 5 freeze-thaw cycles.

[0111] Example 4 Application of nRNP / Sm antibody in immunoblotting

[0112] 4.1 Preparation of the kit (anti-nuclear antibody spectrum IgG detection kit, DL1590-6401-3G), according to the kit operation manual.

[0113] 4.1.1 All reagents must be equilibrated at room temperature (18-25°C) for 30 minutes before use.

[0114] 4.1.2 Coated antigen detection film strip: use directly. To prevent condensation of the film strip, only when the film strip is equilibrated to room temperature can the packaging be opened. After removing the film strip, it should be immediately sealed in the original packaging and stored at 2-8°C.

[0115] 4.1.3 Washing Buffer: 10x concentrated. Use a clean pipette to draw the required amount from the bottle and dilute with distilled water 1:10. If incubating one test strip, dilute 1 mL of concentrated buffer with 9 mL of distilled water. The diluted buffer should be used within the same working day.

[0116] 4.1.4 Sample buffer: Use directly.

[0117] 4.1.5 Substrate solution: Use directly. It is light-sensitive and the cap should be tightened immediately after use.

[0118] 4.1.6 Enzyme Conjugate: 10-fold concentrated. When using, use a clean pipette to draw the required amount of enzyme conjugate from the vial and dilute it 1:10 with sample buffer. If incubating one detection strip is required, dilute 0.15 mL of enzyme conjugate with 1.35 mL of sample buffer. Diluted enzyme conjugate should be used within the same working day.

[0119] 4.1.7 nRNP / Sm antibody dilution: Dilute the nRNP / Sm antibody 1:101 with sample buffer. For example, dilute 15 μL of nRNP / Sm antibody with 1.5 mL of sample buffer and mix thoroughly. The diluted nRNP / Sm should be used within the same working day.

[0120] 4.2 Immunoblot detection

[0121] 4.2.1 Preprocessing:

[0122] Remove the required membrane strip and place it in the incubation bath with the numbered side facing up. Add 1.5 mL of sample buffer to each incubation bath and incubate at room temperature on a shaking incubator for 5 minutes. Then, aspirate the liquid from the incubation bath.

[0123] 4.2.2 nRNP / Sm antibody incubation

[0124] Add 1.5 mL of diluted nRNP / Sm antibody to each incubator and incubate on a rocking incubator at room temperature (18℃~25℃) for 30 minutes.

[0125] 4.2.3 Cleaning:

[0126] Remove the liquid from the tank, and wash the membrane strip three times with 1.5 mL of washing buffer on a shaker for 5 minutes each time.

[0127] 4.2.4 Incubation of enzyme conjugates:

[0128] Add 1.5 mL of diluted enzyme conjugate (alkaline phosphatase-labeled anti-human IgG) to the incubation bath and incubate at room temperature for 30 minutes on a rocking incubator.

[0129] 4.2.5 Cleaning:

[0130] Suck the liquid in the groove, and wash the membrane strip with 1.5 mL of the washing buffer for 3 times, 5 minutes each time, on a rocking shaker.

[0131] 4.2.6 Substrate incubation:

[0132] Add 1.5 mL of the substrate solution into the incubation groove respectively, and incubate for 10 minutes at room temperature (18℃-25℃) on a rocking shaker in the dark.

[0133] 4.2.8 Result judgment:

[0134] Place the detection membrane strip in the result judgment template, and judge the result after air-drying.

[0135] The result is shown in Table 1. Figure 6 From the result of the membrane strip, it can be seen that the anti-nRNP / Sm antibody of the present application can specifically bind to the nRNP / Sm antigen, and can be used for nRNP / Sm autoimmune detection.

[0136] In the above examples, the description of each example has its own emphasis, and the parts not described in detail in a certain example can be referred to the relevant description of other examples.

[0137] The above is the specific embodiment of the present application, but the protection scope of the present application is not limited to this, any person skilled in the art can easily think of various equivalent modifications or replacements within the technical range disclosed by the present application, and these modifications or replacements should be covered in the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.

Claims

1. An anti-nRNP / Sm antibody or antigen-binding fragment thereof, characterized in that, comprises a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 1; the amino acid sequence of the light chain variable region is shown as SEQ ID NO.

2.

2. The anti-nRNP / Sm antibody or antigen-binding fragment thereof of claim 1, wherein, further comprises a heavy chain constant region, which comprises: CH1 with an amino acid sequence shown as SEQ ID NO. 3; Hinge with an amino acid sequence shown as SEQ ID NO. 4; and Fc with an amino acid sequence shown as SEQ ID NO.

5.

3. The anti-nRNP / Sm antibody or antigen-binding fragment thereof of claim 1, wherein, further comprises a light chain constant region CL with an amino acid sequence shown as SEQ ID NO.

6.

4. A nucleic acid molecule, characterized in that, The anti-nRNP / Sm antibody or antigen-binding fragment thereof according to any one of claims 1-3.

5. Vector, characterized in that, The nucleic acid molecule according to claim 4.

6. A host cell characterized in that, The nucleic acid molecule according to claim 4, or the vector according to claim 5.

7. An assay reagent, characterized in that, The detection reagent according to claim 7, wherein the anti-nRNP / Sm antibody or antigen-binding fragment thereof according to any one of claims 1-3 is used as a positive control or quality control.

8. A kit, characterized in that, The detection reagent according to claim 7, wherein the anti-nRNP / Sm antibody or antigen-binding fragment thereof according to any one of claims 1-3 is used as a positive control or quality control.

9. Use of the anti-nRNP / Sm antibody or antigen-binding fragment thereof according to any one of claims 1-3, or the detection reagent according to claim 7, as a positive control or quality control in the preparation of a kit for detecting the presence or level of anti-nRNP / Sm antibody in a sample.

10. Use of the detection reagent according to claim 7, as a positive control or quality control in the preparation of a kit for detecting the presence or level of anti-nRNP / Sm antibody in a sample.

Citation Information

Patent Citations

  • Kit for quantitatively determining anti-nRNP / Sm antibody IgG by using magnetic particle chemiluminescence and detection method

    CN105300965A

  • Application of anti-nRNP / Sm antibody as congenital megacolon diagnostic marker

    CN113075410A