Glyceraldehyde-3-phosphate dehydrogenase B cell epitope and its application in detecting Mycoplasma hyopneumoniae infection

Abstract

The present invention discloses a B cell epitope on the surface of a glyceraldehyde-3-phosphate dehydrogenase protein, its nucleic acid molecule, and its application in detecting Mycoplasma hyopneumoniae infection. The B cell epitope of the present invention can be functionally expressed on the surface of an inert carrier S9 bacterium. Based on the LN7-antibody direct-mediated agglutination test detection method established by LN7 functionally expressed on the surface of the S9 bacterium, LN7 specifically recognizes only Mycoplasma hyopneumoniae infection serum antibodies and vaccine immune serum antibodies containing the GAPDH antigen, generating a specific binding reaction, while having no cross-reaction or non-specific binding reaction with other mycoplasma pathogens, porcine respiratory disease pathogen infection serum, and vaccine immune serum. This diagnostic method is expected to become an important technical means for the accurate diagnosis of Mycoplasma hyopneumoniae infection and the monitoring and evaluation of the immune effect of Mycoplasma hyopneumoniae vaccine.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and immune diagnosis and detection technology, and particularly relates to a glyceraldehyde-3-phosphate dehydrogenase B cell epitope and an application thereof in detecting Mycoplasma hyopneumoniae infection. Background Art

[0002] Enzootic pneumonia (EP) is a respiratory disease caused by Mycoplasma hyopneumoniae (Mhp), also considered one of the primary pathogens of porcine respiratory disease complex (PRDC). It is widespread and has a high incidence rate. Both domestic and wild boar are susceptible, primarily affecting fattening and mature commercial pigs, resulting in reduced growth rate and feed conversion efficiency, and causing economic losses of up to $1 billion annually to the swine industry. Currently commercially available Mhp vaccines can only inhibit Mhp colonization in the lower respiratory tract and prevent transmission between pathogen populations. However, the continued use of preventive and therapeutic drugs can lead to the development of acquired drug resistance in Mhp and increase food safety risks. Faced with the challenging epidemic prevention and control situation, purification of the Mhp pathogen should be an effective means of epidemic prevention and control. Detection / elimination methods are commonly used for disease control. Existing Mycoplasma hyopneumoniae detection methods include isolation and culture of the M. hyopneumoniae pathogen, nucleic acid probe technology, PCR, and enzyme-linked immunosorbent assay (ELISA). Isolation and culture of the M. hyopneumoniae pathogen is time-consuming and easily contaminated by other microorganisms, making M. hyopneumoniae one of the most difficult pathogens to isolate and culture. The low number of pathogens in pigs after drug treatment or recovery significantly reduces the success rate of pathogen isolation. The curved pig trachea makes swab sampling difficult, limiting the application of pathogen isolation and culture in vivo. Nucleic acid probe technology is susceptible to interference with Mycoplasma suis, which has a high homology to M. hyopneumoniae, and is not suitable for in vivo testing. Traditional PCR is less sensitive than real-time PCR (RT-PCR), and RT-PCR testing is costly, requiring expensive equipment and well-trained testing personnel. PCR technology also faces sampling challenges. Sample collection methods and limited sample distribution significantly impact PCR detection results. Existing ELISAs for detecting serum antibodies have low specificity and are prone to cross-reactions with antibodies against Mycoplasma flocculus and Mycoplasma hyorhinis. In summary, these current detection methods have many shortcomings, which seriously restrict the accurate diagnosis and purification procedures of Mycoplasma hyopneumoniae. Therefore, a method for detecting Mycoplasma hyopneumoniae with strong specificity, high sensitivity, convenience and rapidity is needed.

[0003] Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a protease involved in glycolysis, composed of four 30-40 kDa subunits with a molecular weight of approximately 146 kDa. This enzyme is highly expressed in nearly all tissues, and its expression level is generally constant within the same cell type. Studies have found that its expression level is higher in virulent strains of Mycoplasma hyopneumoniae than in less virulent strains, suggesting that GAPDH may be involved in the virulence of Mhp. Recombinantly expressed r-GAPDH can bind to porcine kidney cells, PK-15, and this binding process can be blocked by anti-r-GAPDH antibodies. GAPDH is stably expressed at all stages of the cell infection process and on the bacterial surface, stimulating the body's early immune response. It is also a key adhesion and virulence factor for Mhp. Therefore, GAPDH can be considered as the preferred antigen detection target. However, the traditional classic serological detection method is based on the intact protein antigen as the detection antigen. Since the surface of the intact protein antigen includes antigenic epitopes that specifically recognize and bind to antibody reactions, there are also many redundant protein components, which are prone to cross-react with other components and different antibodies, resulting in non-specific reactions of the detection method. Screening specific B cell epitopes and constructing B cell epitope-mediated direct detection methods can effectively solve the problem of non-specific reactions and improve the specificity of the detection method. Summary of the Invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a highly specific and conserved B cell epitope on the surface of glyceraldehyde-3-phosphate dehydrogenase protein of Mycoplasma hyopneumoniae GAPDH.

[0005] The technical problem that the present invention also aims to solve is to provide a nucleic acid molecule encoding the B cell epitope on the surface of the glyceraldehyde-3-phosphate dehydrogenase protein.

[0006] The technical problem that the present invention also aims to solve is to provide a recombinant gene fragment or a recombinant protein encoding the recombinant gene fragment.

[0007] The technical problem that the present invention also aims to solve is to provide an expression cassette, a recombinant vector, a recombinant cell or a recombinant strain.

[0008] The technical problem that the present invention also aims to solve is to provide an anti-LN7 Mycoplasma hyopneumoniae specific antibody detection system.

[0009] The technical problem that the present invention also aims to solve is to provide a method for constructing a recombinant vector or a recombinant strain.

[0010] The technical problem that the present invention also aims to solve is to provide the use of the B cell epitope, the nucleic acid molecule, the recombinant gene fragment, the expression cassette, the recombinant vector, the recombinant cell or the recombinant strain, and the anti-LN7 Mycoplasma hyopneumoniae-specific antibody detection system in the preparation of a reagent or kit for detecting anti-LN7 Mycoplasma hyopneumoniae-specific antibodies.

[0011] The technical problem that the present invention also aims to solve is to provide a reagent or kit for detecting anti-LN7 Mycoplasma hyopneumoniae specific antibodies.

[0012] Technical solution: In order to solve the above technical problems, the present invention provides a B cell epitope on the surface of glyceraldehyde-3-phosphate dehydrogenase protein, the amino acid sequence of which is LKDNGKN, referred to as LN7.

[0013] The present invention also includes a nucleic acid molecule encoding the B cell epitope on the surface of the glyceraldehyde-3-phosphate dehydrogenase protein. The DNA sequence of the nucleic acid molecule is TTAAAAGATAACGGGAAAAAT, abbreviated as TT21.

[0014] The present invention also includes a recombinant gene fragment, which is a chimeric gene fragment obtained by inserting the nucleic acid molecule into a vector containing the Peg pilus gene sequence. The sequence of the recombinant gene fragment is shown in SEQ ID NO.3 or SEQ ID NO.5.

[0015] SEQ ID NO.3 (recombinant PegA protein encoding gene):

[0016] ATGAAACGTTCACTTATTGCTGCTTCTGTATTGTCTGCTGTATTTATGAGCGCTGGGGTTTTTGCTGCTGATGAAGATATGGGGGAATTAAAAATAAACGGAGAAGTGGTGGGAACATCCTGTACTTTCGAAG GTGCAAATAGCGCGACTATTGAATTATCCCAGGTAGGTGTTGATAGATTGACTGACTTAAACCCTGGCGATATATATACAGGATACACTAGCCCAGAAGCGATTTTAAAAGTAAGATGTACGAATACAGCTAAT CCACGAATTAGTTTTAACCGTTCTCAATTTGTGGATAACATGCAAATCACCAAAAATAATGCTACTAATAATGGTGCGGGCTTCGCTGTTTATCTTGATGGTATTCAGTTAAAAGATAACGGGAAAAATAAGT TTGAACTGAATTCAAGTAAGTTTGAAAATGGTGTATATACCCTGAACTTTTCTGCCCGCTATGCCGCCGTTGAAAATACTGTAACACCAGGTTCTGTTGAATCTGTACTGACGATGACGGTATTAACTGATTAA

[0017] The present invention also includes a recombinant protein encoding the recombinant gene fragment, and the amino acid sequence of the recombinant protein is shown in SEQ ID NO.4.

[0018] SEQ ID NO.4 (recombinant PegA protein sequence):

[0019] MKRSLIAASVLSAVFMSAGVFAADEDMGELKINGEVVGTSCTFEGANSATIELSQVGVDRLTDLNPGDIYTGYTSPEAILKVRCTNTANPRISFNRSQFVDNMQITKNNATNNGAGFAVYLDGIQLKDNGKNKFELNSSKFENGVYTLNFSARYAAVENTVTPGSVESVLTMTVLTD

[0020] The present invention also includes an expression cassette, a recombinant vector, a recombinant cell or a recombinant strain, which contains the nucleic acid molecule or the recombinant gene fragment. The recombinant strain is obtained by introducing the recombinant vector into a carrier bacterium.

[0021] The present invention also includes an anti-LN7 Mycoplasma hyopneumoniae-specific antibody detection system, which includes the expression cassette, recombinant vector, recombinant cell or recombinant strain.

[0022] The present invention also includes a method for constructing the recombinant vector, comprising the following steps:

[0023] (1) Obtaining the B cell epitope DNA sequence of Mycoplasma hyopneumoniae GAPDH; the DNA sequence is TTAAAAGATAACGGGAAAAAT;

[0024] (2) Inserting the DNA sequence obtained in step (1) into a vector containing the Peg fimbriae gene sequence to construct a recombinant vector.

[0025] Furthermore, the recombinant vector is constructed by inserting the nucleic acid molecule of the B cell epitope into the vector pBR322 plasmid containing the Peg pilus encoding gene sequence to obtain the recombinant vector pBR-Peg-GAPDH-TT21 containing GAPDH-TT21.

[0026] The construction method comprises introducing the recombinant vector into the carrier bacteria by electroporation.

[0027] The present invention also includes the use of the B cell epitope, the nucleic acid molecule, the chimeric gene fragment, the expression cassette, the recombinant vector, the recombinant cell or the recombinant strain, and the anti-LN7 Mycoplasma hyopneumoniae-specific antibody detection system in the preparation of a reagent or kit for detecting anti-LN7 Mycoplasma hyopneumoniae-specific antibodies.

[0028] The present invention also includes a reagent or kit for detecting anti-LN7 Mycoplasma hyopneumoniae-specific antibodies, wherein the reagent or kit comprises the B cell epitope, the recombinant protein, the expression cassette, the recombinant vector, the recombinant cell or the recombinant strain or the anti-LN7 Mycoplasma hyopneumoniae-specific antibody detection system.

[0029] Mechanism of the Invention: The present invention utilizes bioinformatics software and structural biology techniques to clarify that GAPDH is highly conserved in Mycoplasma hyopneumoniae. The reported amino acid sequence analysis shows a sequence identity of 99.4% ± 0.6%, which can be understood as complete conservation, and contains the conserved B cell epitope LKDNGKN (LN7). Therefore, based on the prediction, analysis, and verification of the characteristic B cell epitope LKDNGKN (LN7) of GAPDH, the present application establishes a reagent or kit for detecting anti-LN7 Mycoplasma hyopneumoniae-specific antibodies in Mycoplasma hyopneumoniae-infected or immunized pigs based on an LN7-antibody direct-mediated agglutination test, providing a more convenient and rapid Mycoplasma hyopneumoniae-specific antibody detection system, and verifying the specificity and sensitivity of the detection system.

[0030] Beneficial Effects: Compared with existing detection technologies, the present invention has the following significant advantages: The B-cell epitope LN7 of Mycoplasma hyopneumoniae described in the present invention is derived from the conserved antigenic epitope determinant cluster domain of GAPDH. Using Peg pili to display and express a functional specific B-cell epitope, an LN7-antibody-mediated agglutination test has been established to detect anti-LN7 Mycoplasma hyopneumoniae-specific antibodies in Mycoplasma hyopneumoniae-infected or immunized pigs. The functional B-cell epitope LN7 displayed on the bacterial surface specifically recognizes and binds to antibodies against the GAPDH B-cell epitope, thereby enabling specific, sensitive, convenient, and rapid detection or monitoring of Mycoplasma hyopneumoniae antibodies. The anti-LN7 Mycoplasma hyopneumoniae antibody detection system specifically recognizes and binds only with antibodies from Mycoplasma hyopneumoniae-infected serum and antibodies from vaccine-immunized serum containing the GAPDH B-cell epitope, and does not cross-react or non-specifically react with other mycoplasma antibodies, respiratory pathogens, or other pathogens. Given that the present invention has strong specificity, high sensitivity and simple operation, the test results can be read quickly and easily, and it is easy to promote in the clinical front line and be used for the detection of Mycoplasma hyopneumoniae antibodies in the breeding front line. It is expected to become a technology and platform for the early diagnosis of Mycoplasma hyopneumoniae infection, monitoring of vaccine immunity levels, and purification of Mycoplasma hyopneumoniae pathogens. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Figure 2 shows the results of bioinformatics analysis of the B cell epitope of Mycoplasma hyopneumoniae GAPDH. The amino acid sequence of GAPDH in Mycoplasma hyopneumoniae differs significantly from that in other mycoplasmas and from porcine genes. The light yellow portion of the first row shows the amino acid sequence of the linear B cell epitope of Mycoplasma hyopneumoniae GAPDH provided by the present invention.

[0032] Figure 2Electropherogram of PCR amplification and identification of the complete operon gene of the recombinant vector peg-GAPDH-TT21 inserted into GAPDH-TT21. Lane M is Trans 2K Plus II DNA Marker, lane 1 is the genome of the avian pathogenic Escherichia coli isolate APEC-XM as a negative control; lane 2 is the PCR amplification product of the peg operon gene, with template DNA from the standard Salmonella pullorum strain CVCC 526 as a positive control; lane 3 is the PCR amplification product of peg-GAPDH-TT21 (4868 bp).

[0033] Figure 3 Electrophoresis of enzyme digestion analysis of the recombinant plasmid pBR-Peg-GAPDH-TT21 containing the peg-GAPDH-TT21 gene. Lane M is Trans 2K Plus II DNA Marker; lane 1 is the pBR322 circular plasmid; lane 2 is the pBR-Peg-GAPDH-TT21 circular plasmid; lane 3 is the product of the double digestion of pBR-Peg-GAPDH-TT21 with Nhe I and BamH I.

[0034] Figure 4 , Schematic diagram of the recombinant plasmid pBR-Peg-GAPDH-TT21 containing GAPDH-TT21.

[0035] Figure 5 , The agglutination reaction results of the Mycoplasma hyopneumoniae-specific antibody detection system S9-pBR-Peg-GAPDH-TT21 and the Peg pili empty vector control S9-pBR-Peg with Mycoplasma hyopneumoniae antibody positive serum and negative serum respectively. A: Agglutination reaction results of the Mycoplasma hyopneumoniae antibody detection system (right) and the control system (left) with the antibody-positive serum after immunization with the whole-cell Mycoplasma hyopneumoniae vaccine, respectively. The white arrows indicate the agglutinated particles; B: The Mycoplasma hyopneumoniae antibody detection system (right) and the control system (left) did not agglutinate with the serum of SPF pigs (without Mhp infection); C: The Mycoplasma hyopneumoniae antibody detection system (right) and the control system (left) did not agglutinate with the serum of 7-day-old pigs that were not vaccinated and had no clinical symptoms related to Mycoplasma hyopneumoniae; D: The Mycoplasma hyopneumoniae antibody detection system (right) and the control system (left) did not agglutinate with the serum positive for porcine reproductive and respiratory syndrome virus antibody; E: The Mycoplasma hyopneumoniae antibody detection system (right) and the control system (left) did not agglutinate with the Escherichia coli F4 monoclonal antibody; F: The Mycoplasma hyopneumoniae antibody detection system (right) and the control system (left) did not agglutinate with the serum positive for pseudorabies virus antibody. DETAILED DESCRIPTION

[0036] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are intended to describe specific specific embodiments and are not intended to limit the scope of protection of the present invention. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the examples, any methods, equipment, and materials of the prior art that are similar or equivalent to the methods, equipment, and materials described in the examples of the present invention may also be used to implement the present invention based on the prior art knowledge of those skilled in the art and the description of the present invention.

[0037] Example 1 Conservative comparison analysis of Mycoplasma hyopneumoniae GAPDH gene sequences

[0038] The GAPDH gene information of Mycoplasma hyopneumoniae was retrieved from the NCBI (https: / / www.ncbi.nlm.nih.gov / ) Nucleotide database. Eleven strains of Mycoplasma hyopneumoniae GAPDH gene sequences were selected. The GAPDH gene sequence of Mycoplasma Hyopneumoniae 168-L (complete genome, GenBank accession number: AGM21810.1) (location: AGM21810.1: 38423-39433, expression product annotated as "Glyceraldehyde 3-phosphate dehydrogenase") was used as a reference sequence. The amino acid sequences of these 11 strains of Mycoplasma hyopneumoniae were aligned and analyzed using the bioinformatics software (DNAStar MegAlign). The results are shown in Table 1. The conservation of the GAPDH amino acid sequences of Mycoplasma hyopneumoniae was 99.4% ± 0.6%. The amino acid sequence of the regions with complete identity are 1-19, 21-174, 176-218, 220-307, and 309-331. In addition, the GAPDH amino acid sequences of seven different mycoplasma representative strains were selected for comparison, including the GAPDH sequence of Mycoplasma hyopneumoniae 168-L strain (GenBank accession number: AGM21810.1), the GAPDH sequence of Mycoplasma synoviae B1 strain (GenBank accession number: UTO26250.1), the GAPDH sequence of Mycoplasma hyorhinis 4236J19c strain (GenBank accession number: UVT32234.1), the GAPDH sequence of Mycoplasma pneumoniae NCTC10119 strain (GenBank accession number: VEU57030.1), and the GAPDH sequence of Mycoplasma synovium. The GAPDH sequences of Mycoplasma hyopneumoniae strain 168-L (GenBank Accession No. AGM21810.1) were compared with the GAPDH sequences of Mycoplasma gallisepticum strain VA94-7994-1-7P strain (GenBank Accession No. AFP75911.1), and Mycoplasma suis strain ATCC27399 strain (GenBank Accession No. AJC49610.1). The GAPDH sequences of these seven mycoplasmas shared a 74.5% ± 15.7% identity, using the GAPDH sequence of Mycoplasma hyopneumoniae strain 168-L (GenBank Accession No. AGM21810.1) as a reference sequence. The amino acid sequence identity of the GAPDHs of the first six of these seven mycoplasmas was 66.65% ± 7.85%. The amino acid sequence of GAPDH of Mycoplasma hyopneumoniae 168-L strain (GenBank accession number: AGM21810.1) is 44.2% identical to the amino acid sequence of GAPDH of European wild boar (Sus scrofa) (GenBank accession number: NP001193288).The GAPDH amino acid sequence of Mycoplasma hyopneumoniae strain 168-L (GenBank accession number: AGM21810.1) is 90.2% identical to the GAPDH amino acid sequence of Mycoplasma suis strain ATCC 27399 (GenBank accession number: AJC49610.1). Further analysis determined that the two GAPDH amino acid sequences differ at positions 29, 40, 59, 60, 64, 73, 75, 80, 87, 91, 92, 113, 145, 146, 147, 197, 253-267, 277, 289, 301, 302, 314, 332, and 335. To ensure the specificity of the selected B cell epitope, the M. hyopneumoniae GAPDH-specific B cell epitope should contain the amino acids at these variant positions and be different from those of other Mycoplasma species.

[0039] Table 1. Conservative analysis results of different GAPDH amino acid sequences

[0040]

[0041]

[0042] Example 2 Prediction of Conserved B Cell Epitopes of Mycoplasma hyopneumoniae GAPDH

[0043] The B cell epitope prediction tool (Bepipred Linear Epitope Prediction 2.0, http: / / tools.iedb.org / bcell / ) of the Immunological Epitope Database was used to predict the B cell linear epitopes contained in GAPDH of Mycoplasma hyopneumoniae. The eight different GAPDH amino acid sequences were compared and analyzed using MEGA 11 software. The results of the two software analyses were combined, as shown in Figure 2. Figure 1 As shown, a conserved and specific B cell epitope LKDNGKN (LN7) of Mycoplasma hyopneumoniae could be identified.

[0044] Example 3 Construction of Peg pili expression vector carrying the GAPDH conserved B cell epitope LN7 and verification of its functional expression

[0045] The DNA sequence TT21 of the conserved B cell epitope LN7 of GAPDH of Mycoplasma hyopneumoniae was inserted into the Peg fimbriae gene sequence of Salmonella pullorum to construct the recombinant vector pBR-Peg-GAPDH-TT21, which was introduced into Escherichia coli for amplification and expression, and the functional display of Peg-GAPDH-TT21 on the surface of the vector bacteria was verified.

[0046] The specific implementation procedure is as follows: Nanjing Qingke Biotechnology Co., Ltd. synthesized a chimeric gene of peg (reference sequence: Salmonella enterica SP strain, GenBank accession numbers CP077668.1, 1831920-1827125) and GAPDH-TT21. The site AATTACACTCTGAATTCAAGT in the peg operon gene sequence was replaced by GAPDH-TT21. The resulting chimeric gene was named peg-GAPDH-TT21. The peg-GAPDH-TT21 gene sequence is as follows: (SEQ ID NO. 5)

[0047]

[0048] The primer information for peg operon amplification is as follows: upstream primer SP Peg Up: 5'-CGC GCTAGC ATGAAACGTTCACTTATTGCTGCT-3' downstream primer SP Peg Down: 5'-CGT GGATCC TTAATTATAAGATACCACGATTAATGC-3', the underlined sequences represent Nhe I and BamH I restriction enzyme sites, respectively. The above primers were synthesized by Nanjing Qingke Biotechnology Co., Ltd. The chimeric gene was used as a template (SEQ ID NO. 5, 1 μL, containing 1 ng of the chimeric gene), the genome of the avian pathogenic Escherichia coli isolate APEC-XM (Liu Jiaqi, Wu Hucong, Yin Yi, Zhang Dong, Xia Pengpeng, Ren Wenkai, Zhu Guoqiang. Construction of a mouse model of neonatal Escherichia coli meningitis caused by avian Escherichia coli [J]. China Poultry, 2019, 41(10): 26-30.) was used as a negative control, and the genome of the Salmonella pullorum standard strain CVCC 526 (purchased from China Veterinary Drug Administration, China Veterinary Microbial Culture Collection Center) was used as a positive control. PCR amplification was performed using the upstream and downstream primers SP Peg Up / Down. The amplification system was: pfu high-fidelity DNA Polymerase (Beijing Quanshijin Biotechnology Co., Ltd., 2.5 U / μL) 2 μL, 5×pfu DNA polymerase buffer 10 μL, dNTPs 5μL, 2μL of upstream and downstream primers (10mM), 2μL of chimeric gene, APEC-XM genome or CVCC 526 genome (250ng / μL), 27μL of ultrapure water. After mixing the above system evenly, PCR amplification was performed using a thermal cycler (Bio-Red). The program was as follows: pre-denaturation at 94℃ for 5min, amplification stage for 30 cycles, including denaturation at 94℃ for 30s; annealing at 52℃ for 30s and extension at 72℃ for 5min, further amplification at 72℃ for 10min, and the temperature was lowered to 12℃ after the amplification was completed. A 1.5% agarose gel was prepared, electrophoresed at 110V for 45min, stained with ethidium bromide, and imaged under a UV imager. The PCR results were as follows. Figure 2 As shown, the amplified product size of the positive control is 4850 bp; the PCR product of peg-GAPDH-TT21 is 4868 bp; and no amplified band was found in the negative control. The PCR amplified product of peg-GAPDH-TT21 (4868 bp) was recovered using a universal DNA purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0049] The PCR amplification product of Peg-GAPDH-TT21 and the pBR322 plasmid were double-digested using Nhe I and BamH I restriction endonucleases (NEB), and then the linear DNA fragments were ligated using T4 DNA ligase (NEB) in a 16°C metal bath overnight. The next day, the ligation product was transformed into S9 competent cells (Zhu Guoqiang, Yang Bin, Yang Yang, Meng Xia, Xia Pengpeng, Duan Qiangde, Zhu Xiaofang, An inert carrier Salmonella and its potential application, national invention patent, patent number: ZL201910424369.8) to construct the recombinant engineered strain S9-pBR-Peg-GAPDH-TT21, and resistance screening was performed by coating solid culture medium containing 100 μg / mL ampicillin. A single colony was picked from the plate and inoculated into LB liquid medium containing 100 μg / mL ampicillin and grown to the stationary phase. The plasmid was recovered and double-digested with two restriction endonucleases, Nhe I and BamH I. A 1.5% agarose gel was prepared and electrophoresed at 110V for 45 minutes. After staining with ethidium bromide, the image was taken under a UV imager. The results are as follows: Figure 3 As shown, the Nhe I and BamH I double enzyme digestion product of the recombinant plasmid pBR-Peg-GAPDH-TT21 contains a 4215 bp linear vector and a 4856 bp Peg-GAPDH-TT21 linear DNA fragment of the PCR amplification product, which is consistent with the expected size. The schematic diagram of the expression vector pBR-Peg-GAPDH-TT21 plasmid is shown in Figure 4 shown.

[0050] The engineered S9 bacteria S9-pBR-Peg-GAPDH-TT21 carrying the recombinant plasmid pBR-Peg-GAPDH-TT21 were grown in LB liquid medium containing 100 μg / mL ampicillin to the stationary phase, centrifuged at 4000 rpm for 5 min, and the supernatant was discarded. The suspension was resuspended with an equal volume of sterile saline, and centrifuged and washed twice in this manner to prepare a bacterial suspension (final concentration 1×10 10CFU / mL). Agglutination tests were performed on a recombinant S9 engineered bacteria carrying the recombinant plasmid described above with serum positive for Peg pili (10 samples, stored in our laboratory), serum negative for Mycoplasma hyopneumoniae antibodies (10 samples of SPF pig serum, provided by Zhejiang University Animal Hospital), and serum positive for Mycoplasma hyopneumoniae antibodies (10 samples of Mycoplasma hyopneumoniae vaccine-immune serum, provided by Taizhou Huawei Biopharmaceutical Co., Ltd.). A bacterial suspension containing pBR-Peg-containing S9 engineered bacteria, S9-pBR-Peg (Zhu Guoqiang, Yang Bin, Yang Yang, Meng Xia, Xia Pengpeng, Duan Qiangde, Zhu Xiaofang, "An Inert Carrier Salmonella and Its Potential Applications, National Invention Patent, Patent No.: ZL201910424369.8"), was used as a control system. The results are shown in Table 2. Both bacterial suspensions exhibited significant agglutination reactions with the serum positive for Peg pili, indicating that the S9 engineered bacteria successfully functionally displayed Peg pili on their surfaces. Bacterial suspensions of all strains did not react with serum negative for Mycoplasma hyopneumoniae antibodies. Suspensions of recombinant S9 bacteria carrying the recombinant plasmid pBR-Peg-GAPDH-TT21 showed clear agglutination with serum positive for Mycoplasma hyopneumoniae antibodies, with large agglutinated particles and a clear background. Suspensions of S9 bacteria containing only pBR-Peg showed no agglutination with serum positive for Mycoplasma hyopneumoniae antibodies, with no agglutinated particles and a turbid background. These results indicate that the B-cell epitope LN7 from the Mycoplasma hyopneumoniae GAPDH protein can be functionally displayed on the bacterial surface by Peg pili and can specifically detect antibodies against the B-cell epitope LN7 of the Mycoplasma hyopneumoniae GAPDH protein.

[0051] In this antibody detection system, the S9-pBR-Peg bacterial suspension is used as a control system. The antibody detection system only adds the B cell epitope LN7, specifically identifying and binding to specific antibodies and eliminating nonspecific reactions, thereby ensuring accurate individual diagnosis; the S9-pBR-Peg-GAPDH-TT21 bacterial suspension is used as a Mycoplasma hyopneumoniae-specific antibody detection system, which can specifically recognize and bind to antibodies targeting the consistent conserved B cell epitopes in Mycoplasma hyopneumoniae GAPDH.

[0052] Table 2. Functional verification results of Peg-GAPDH-TT21 expressed on the surface of vector bacteria S9

[0053]

[0054] Note: “-” indicates negative agglutination reaction; “+” indicates positive agglutination reaction.

[0055] Example 4 Specificity and Sensitivity Test of Mycoplasma hyopneumoniae Specific Antibody Detection System

[0056] Based on the functional verification of Peg-GAPDH-TT21 expressed on the surface of the vector bacteria S9, the specificity and sensitivity of the Mycoplasma hyopneumoniae-specific antibody detection system were tested. The specific implementation procedures are as follows:

[0057] The control system S9-pBR-Peg bacterial suspension and the detection system S9-pBR-Peg-GAPDH-TT21 bacterial suspension were prepared according to the method described in Example 3. The above two bacterial suspensions were subjected to agglutination tests with sera from different background information to verify the specificity of the Mycoplasma hyopneumoniae antibody detection system. The sera involved in the test and their sources included: 10 sera from pigs immunized with the roundworm bivalent vaccine (provided by Taizhou Huawei Biopharmaceutical Co., Ltd.), 5 sera from 7-day-old piglets that were not immunized and had no clinical symptoms (provided by Taizhou Huawei Biopharmaceutical Co., Ltd.), 7 sera from ducks infected with Escherichia coli (obtained by our laboratory using SPF ducks infected with Escherichia coli F418), 1 Escherichia coli F4 monoclonal antibody (prepared and stored in our laboratory), 7 sera positive for Salmonella enterica (stored in our laboratory), 6 sera positive for mouse Escherichia coli (obtained by our laboratory using SPF mice infected with Escherichia coli F418), 20 clinical bovine sera (stored in our laboratory), 52 SPF pig sera (provided by Zhejiang University Animal Hospital), 5 sera positive for porcine reproductive and respiratory syndrome virus antibody (provided by Zhejiang Meibaolong Biotechnology Co., Ltd.), and 5 sera positive for pseudorabies virus antibody (provided by Zhejiang Meibaolong Biotechnology Co., Ltd.). The test results are shown in Table 3. The S9-pBR-Peg control system did not agglutinate with all the tested sera. The S9-pBR-Peg-GAPDH-TT21 test system agglutinated only with serum positive for Mycoplasma hyopneumoniae antibodies and did not agglutinate with serum positive for antibodies to other pathogens. Figure 5 .

[0058] Table 3. Specificity validation test results of the Mycoplasma hyopneumoniae specific antibody detection system

[0059]

[0060] Note: “-” indicates negative agglutination reaction; “+” indicates positive agglutination reaction;

[0061] The sensitivity test of the present invention is to determine the earliest detection time of Mycoplasma hyopneumoniae antibodies by testing the sera of pigs at different days after immunization with Mycoplasma hyopneumoniae vaccine. The specific implementation procedure is as follows: the present invention is used to perform an agglutination test on sera collected before immunization (0 day) and 14 days, 21 days, and 28 days after immunization, with 10 samples collected each time, for a total of 40 sera. The sera judged to be positive are further diluted in multiples, that is, 20 μL of sterile saline is added to each well of a 96-well plate, and then 20 μL of Mycoplasma hyopneumoniae antibody-positive serum is drawn and added to the first well of each row. After being fully mixed with sterile saline, 20 μL of the diluted serum is drawn and added to the next well, and diluted to 2 5 The serum at each dilution was subjected to agglutination tests with the control system S9-pBR-Peg bacterial suspension and the Mycoplasma hyopneumoniae antibody detection system S9-pBR-Peg-GAPDH-TT21 bacterial suspension. The last dilution at which agglutinated particles appeared was used as the agglutination antibody titer of the serum. The positive rates of the agglutination tests are shown in Table 4.

[0062] Table 4. Results of sensitivity validation test of Mycoplasma hyopneumoniae specific antibody detection system

[0063]

[0064] As can be seen from Table 4, 80% (8 / 10) of the immunized pig sera reacted positively with the S9-pBR-Peg-GAPDH-TT21 antibody detection system 14 days after immunization, indicating that specific antibodies can be detected 14 days after immunization, and the positive rate of agglutination test increases with the passage of immunization time. Antibody titer detection showed that the antibody titer also increased over time within 28 days. In summary, the Mycoplasma hyopneumoniae S9-pBR-Peg-GAPDH-TT21 antibody detection system of the present invention has good specificity and sensitivity. Compared with the results reported by current commercial antibody detection kits, the sensitivity of the present invention is significantly improved and can quantitatively detect specific antibody titers.

Claims

1. A recombinant gene segment, characterized in that: The recombinant gene fragment is a chimeric gene fragment obtained by inserting a nucleic acid molecule encoding a B cell epitope on the surface of the glyceraldehyde-3-phosphate dehydrogenase protein into a vector containing the Peg pilus gene sequence. The sequence of the recombinant gene fragment is shown in SEQ ID NO.5, the amino acid sequence of the B cell epitope on the surface of the glyceraldehyde-3-phosphate dehydrogenase protein is LKDNGKN, and the DNA sequence of the nucleic acid molecule is TTAAAAGATAACGGGAAAAAT.

2. An expression cassette, a recombinant vector, a recombinant cell or a recombinant strain, characterized in that: It comprises the recombinant gene segment according to claim 1.

3. The recombinant strain according to claim 2, characterized in that The recombinant strain is obtained by introducing the recombinant vector into a carrier bacterium.

4. An anti-LN7 Mycoplasma hyopneumoniae specific antibody detection system, characterized in that: The anti-LN7 Mycoplasma hyopneumoniae-specific antibody detection system comprises the expression cassette, recombinant vector, recombinant cell or recombinant strain according to claim 2.

5. The method for constructing the recombinant vector according to claim 2, characterized in that: The following steps are involved: (1) Obtaining a B cell epitope DNA sequence of Mycoplasma hyopneumoniae GAPDH; the DNA sequence is TTAAAAGATAACGGGAAAAAT; (2) Inserting the DNA sequence obtained in step (1) into the Peg pilus gene sequence to obtain the recombinant gene fragment according to claim 1, and then constructing a recombinant vector.

6. The method for constructing the recombinant strain according to claim 2, characterized in that: The construction method comprises introducing the recombinant vector according to claim 2 into a carrier bacterium by electrotransformation.

7. Use of the recombinant gene segment according to claim 1, the expression cassette, recombinant vector, recombinant cell or recombinant strain according to claim 2, and the anti-LN7 Mycoplasma hyopneumoniae-specific antibody detection system according to claim 4 in the preparation of a reagent or kit for detecting anti-LN7 Mycoplasma hyopneumoniae-specific antibodies.

8. A reagent or kit for detecting anti-LN7 Mycoplasma hyopneumoniae-specific antibodies, characterized in that: The reagent or kit comprises the recombinant gene segment according to claim 1, the expression cassette, recombinant vector, recombinant cell or recombinant strain according to claim 2 or the anti-LN7 Mycoplasma hyopneumoniae specific antibody detection system according to claim 4.

Images