Recombinant microorganism with high yield of leucine and construction method and application thereof

Abstract

The application provides a recombinant microorganism with high leucine yield and a construction method and application thereof, wherein two key exogenous enzymes, acetyl-hydroxy acid synthase not subjected to leucine feedback inhibition and NADH-dependent acetyl-hydroxy acid isomerization reductase mutant, are introduced to remove the leucine feedback inhibition and improve the coenzyme NAD(P)H balance, so that the leucine yield of escherichia coli is improved.

Description

Technical Field

[0001] This invention relates to the field of amino acid fermentation, and more specifically, to a recombinant microorganism that produces high levels of leucine, its construction method, and its application. Background Technology

[0002] Leucine is an essential amino acid in mammals and has wide applications in biomedicine, food, and feed. Microbial fermentation is the main method for producing leucine, with commonly used chassis cells including Corynebacterium glutamicum and Escherichia coli. However, the enzymes in the leucine synthesis pathway are subject to complex metabolic regulation, and the multi-step reactions in the pathway highly overlap with the synthesis pathways of other members of the branched-chain amino acid family, resulting in low leucine yield, numerous byproducts, low conversion rate, and high production costs. Therefore, developing high-yield leucine-producing strains has become an urgent problem to be solved.

[0003] Leucine synthesis in *E. coli* is subject to a series of complex metabolic regulations. The first key enzyme in the leucine synthesis pathway, acetylhydroxyl synthase, is subject to feedback inhibition by leucine, making it a critical metabolic target limiting high leucine production. Currently, overcoming the feedback inhibition of acetylhydroxyl synthase mainly involves random mutagenesis or site-directed mutagenesis of endogenous *E. coli* or *Corynebacterium glutamicum* acetylhydroxyl synthase to obtain mutant acetylhydroxyl synthases. While these mutants reduce sensitivity to leucine, they usually also lead to a decrease in catalytic activity. Therefore, obtaining an acetylhydroxyl synthase with high catalytic activity and unaffected by leucine inhibition is crucial for leucine production.

[0004] The second step in the leucine synthesis pathway is catalyzed by acetylhydroxy acid isomer reductase. Currently known acetylhydroxy acid isomer reductases are all NADPH-dependent, requiring a large amount of NADPH to be consumed during leucine synthesis. Since cells primarily produce NADH through central metabolism (glycolysis and the citric acid cycle), there is a coenzyme imbalance between leucine synthesis and cellular carbon metabolism, which is one of the key factors limiting leucine synthesis. Screening or designing acetylhydroxy acid isomer reductases that can directly utilize NADH is of great significance for balancing cellular coenzyme utilization and increasing leucine production. Summary of the Invention

[0005] The purpose of this invention is to provide a recombinant microorganism that produces high levels of leucine, its construction method, and its application.

[0006] The concept of this invention is as follows: Through scientific analysis, suitable exogenous acetylhydroxyl synthase and acetylhydroxyl isomer reductase mutants are identified to alleviate feedback inhibition and improve NADPH deficiency, thereby increasing leucine production. This invention uses molecular docking to screen for exogenous acetylhydroxyl synthases that do not readily bind to leucine molecules, and combines sequence alignment with site-directed mutagenesis of NADPH-dependent exogenous acetylhydroxyl isomer reductase. Finally, these two key exogenous enzyme genes are integrated into the high-copy-count plasmid pTrc99a and expressed in *E. coli*.

[0007] To achieve the objectives of this invention, in a first aspect, this invention provides an acetylhydroxy acid isomer reductase mutant, said acetylhydroxy acid isomer reductase mutant comprising Neurospora crassa (… Neurospora crassa The mutations at amino acid position 113 (V to D) and amino acid position 114 (R to F) in acetylhydroxy acid isomer reductase derived from this source.

[0008] The amino acid sequence of the acetylhydroxy acid isomer reductase mutant of the present invention is shown in SEQ ID NO:4.

[0009] In a second aspect, the present invention provides a gene encoding the acetylhydroxy acid isomer reductase mutant, the nucleotide sequence of which is shown in SEQ ID NO:3.

[0010] Thirdly, the present invention provides biological materials containing the said gene.

[0011] The biomaterials include, but are not limited to, recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, or engineered bacteria.

[0012] Fourthly, the present invention provides an engineered bacterium that produces leucine, wherein the engineered bacterium is an overexpression of a foreign gene. budB Escherichia coli ( Escherichia coli ).

[0013] The exogenous gene budB Enterobacter aerogenes ( Enterobacter aerogenes acetylhydroxy acid synthase gene budB (The nucleotide sequence is shown in SEQ ID NO:1), and the amino acid sequence of the acetylhydroxy acid synthase it encodes is shown in SEQ ID NO:2.

[0014] Preferably, the *E. coli* is SIJ488 CP, which is a leucine-producing strain modified metabolically from *E. coli* SIJ488. Specifically, an additional leuABCD gene, including α-isopropylmalate synthase gene leuA, α-isopropylmalate isomerase gene leuB, and β-isopropylmalate dehydrogenase gene leuCD, is inserted into the *E. coli* SIJ488 genome using the CRISPR-transposon system (Programming Cells by Multicopy Chromosomal Integration Using CRISPR-Associated Transposases. Zhang Y, Yang J, Yang S, Zhang J, Chen J, Tao R, Jiang Y, Yang J, Yang S. CRISPR J. 2021Jun;4(3):350-359.). Their NCBI ID numbers are 947465, 944798, 945076, and 945042, respectively.

[0015] Preferably, the exogenous gene is transmitted via a high-copy pTrc99a plasmid. budB It was introduced into the Escherichia coli.

[0016] Fifthly, the present invention provides a recombinant microorganism that produces high levels of leucine, characterized in that the recombinant microorganism is an *Escherichia coli* that overexpresses the gene encoding the acetylhydroxy acid isomer reductase mutant;

[0017] The *Escherichia coli* mentioned above is an engineered bacterium that produces leucine.

[0018] Sixthly, the present invention provides a method for constructing a recombinant microorganism that produces high levels of leucine, by incorporating the acetylhydroxyl synthase gene of *Enterobacter aerogenes*. budB After codon optimization, the acetylhydroxy acid isomer reductase mutant gene is introduced into E. coli via plasmid or integrated into the E. coli chromosome through genetic engineering.

[0019] Preferably, the plasmid is pTrc99a.

[0020] Preferably, the Escherichia coli is SIJ488 CP.

[0021] In a seventh aspect, the present invention provides the application of the engineered bacteria, the recombinant microorganism, or the recombinant microorganism constructed according to the above method in the fermentation production of leucine.

[0022] Eighthly, the present invention provides a method for increasing the fermentation yield of leucine, comprising the following steps:

[0023] a) Cultivate the engineered bacteria, the recombinant microorganism, or the recombinant microorganism constructed according to the above method to obtain a culture;

[0024] b) Collect the leucine produced from the culture obtained in step a).

[0025] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0026] The method of this invention can significantly increase the yield of leucine in Escherichia coli. By introducing acetylhydroxy acid synthase from Enterobacter aerogenes, the feedback inhibition of leucine is relieved, and the metabolic flux of pyruvate to leucine synthesis is increased. By introducing a mutant from Neurospora crassa, it can effectively utilize NADH, achieving a balance in coenzyme utilization, thereby increasing the yield of leucine in Escherichia coli. Detailed Implementation

[0027] This invention provides a method for improving leucine production in *Escherichia coli*. The method primarily utilizes bioinformatics analysis to screen for novel acetylhydroxyl synthase mutants unaffected by leucine feedback inhibition and NADH-dependent acetylhydroxyl isomerase mutants. Overexpression of these two enzymes in *E. coli* significantly increases the yield and productivity of leucine.

[0028] The present invention adopts the following technical solution:

[0029] (1) Use molecular docking method to screen acetylhydroxyl synthases that are not inhibited by leucine feedback;

[0030] (2) Overexpression of Enterobacter aerogenes in Escherichia coli (E. coli) Enterobacter aerogenes acetylhydroxy acid synthase gene budB (The sequence is shown in SEQ ID NO:1);

[0031] (3) Site-directed mutation of Neurospora crassa ( Neurospora crassa The acetylhydroxy acid isomerase derived from ) was used to obtain the NADH-dependent acetylhydroxy acid isomerase gene (sequence shown in SEQ ID NO:3), and it was overexpressed in Escherichia coli;

[0032] (4) The above strains were fermented and cultured, and the growth status of the cells, the intracellular NADPH content and the yield of leucine were detected.

[0033] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0034] The leucine-producing strain SIJ488 CP used in the following examples is constructed using the following method:

[0035] Transformation, induction, and elimination of plasmids including pRE57-Ter, pTet-tns, pTetQCas-8+IS186, and pCutmap (see Programming Cells by Multicopy Chromosomal Integration Using CRISPR-Associated Transposases. Zhang Y, Yang J, Yang S, Zhang J, Chen J, Tao R, Jiang Y, Yang J, Yang S. CRISPR J. 2021 Jun;4(3):350-359. Plasmids pRE57-Ter, pTet-tns, pTetQCas-8+IS186, and pCutmap were purchased from Addgene). Using the Escherichia coli SIJ488 genome as a template, PCR was performed using leu-F (GGGAATTCCATGGTCGACATGCATATTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCAGTGTAATTC) and leu-R (TCTTAAAGTTAAACAAAATTATTCCTAGGaTTAATTCATAAACGCAGGTTGTTTTGCTTC) as primers to obtain gene fragments. leuABCD Approximately 5kb was extracted and the PCR product was purified. The CRISPR-transposon system DNA donor plasmid pRE57-Ter was digested with KpnI, and the pRE57-Ter plasmid backbone and transposable DNA were assembled using the Gibson Assembly kit (NEB). leuABCD The gene fragment was ligated in one step, and the resulting recombinant plasmid was named pRE57-leuABCD. pRE57-leuABCD was electroporated into *E. coli* using an electroporator (Bio-Rad). The electroporation conditions were 2.5 kV, 200 Ω, and 25 μF (electroporation cuvette width 2 mm). Selection was performed on LB agar plates containing 100 mg / L ampicillin. The plasmids pTet-tns and pTetQCas-8+IS186 were then co-transformed and screened on LB agar plates containing 100 mg / L ampicillin, 50 mg / L kanamycin, and 50 mg / L streptomycin, yielding recombinant strains containing all three plasmids. The positive transformant was then inoculated into LB liquid medium containing 50 ng / mL acyclovir and three antibiotics. After induction, it was plated onto plates containing the three antibiotics. Colonies growing on the plates were randomly selected, and strains with an additional copy of the leuABCD gene inserted into their genome were screened by colony PCR. Finally, the bacterial culture was transformed with the pCutmap plasmid, and after recovery in SOC medium at 37 °C for 1 h, the culture was transferred to medium containing 50 μg / mL apramycin and 10 mM rhamnose, incubated at 37 °C for 3 h, and then concentrated and plated onto LB plates containing apramycin. The colonies grown above were streaked onto plates with different resistance and sucrose low-salt conditions to screen for the elimination of pRE57-leuABCD, pTetQCas-8+IS186, and pTet-tns plasmids, while simultaneously eliminating the pCutmap plasmid. The strain that successfully eliminated all four plasmids and inserted an additional copy of the leuABCD gene into its genome was named SIJ488 CP.

[0036] Example 1: Screening for acetylhydroxyl synthases unaffected by leucine feedback inhibition using molecular docking method

[0037] Approximately 1000 acetylhydroxyl synthases from different sources were screened from the Uniprot protein database, and their three-dimensional structures were predicted using Alphafold2. Then, the molecular docking software Autodock was used to perform docking experiments between L-leucine small molecules and the protein structures of acetylhydroxyl synthases from different sources, and the results were ranked according to their binding free energy. The binding free energy reflects the binding affinity between acetylhydroxyl synthase and L-leucine: a higher binding free energy indicates a relatively weaker binding affinity to L-leucine, possibly unaffected by feedback inhibition from L-leucine. The results showed that the acetylhydroxyl synthase from *Enterobacter aerogenes* (…) was the most effective acetylhydroxyl synthase. Enterobacter aerogenes The acetylhydroxy acid synthase has the highest binding free energy to L-leucine molecules. This enzyme is composed of... budB The enzyme is encoded by a gene, therefore it was selected for further verification.

[0038] Example 2: Expression of acetylhydroxyl synthase derived from Enterobacter aerogenes in Escherichia coli

[0039] In this embodiment, Escherichia coli SIJ488 CP was used as the starting strain. SIJ488 CP is a leucine-producing strain that has been metabolically engineered based on Escherichia coli SIJ488.

[0040] Artificially synthesized, codon-optimized strains derived from Enterobacter aerogenes ( Enterobacter aerogenes )of budB The gene, sequenced as shown in SEQ ID NO:1, was used as a template. PCR was performed using budB-F (CGAAGGCGAAGCGGCATGCATTTACGTTTTGACAATTAATCATCCGGCTCGTATAATGTG) and budB-R (TCAGACCGCTTCTGCGTTCTGATTTAATCTTTACAGAATCTGGCTCAGGTGCAG) as primers to obtain a budB gene fragment of approximately 1.5 kb. The PCR product was purified. Using the high-copy pTrc99a plasmid as a template, PCR was performed using pTrc-F (AGATTAAATCAGAACGCAGAAGCGGTC) and pTrc-R (AACGTAAATGCATGCCGCTTCG) as primers to obtain a plasmid backbone of approximately 2.5 kb. The PCR product was then purified. The pTrc99a plasmid backbone and... budB The gene fragment was ligated in one step, and the resulting recombinant plasmid was named pTrc99a-budB. Using an electroporator (Bio-Rad Laboratories), pTrc99a-budB was transformed into *E. coli* SIJ488 CP via point transformation. The electroporation conditions were 2.5 kV, 200 Ω, and 25 μF (electroporation cuvette width 2 mm). Recombinant bacteria were screened on LB agar plates containing 100 mg / L ampicillin and named pTrc99a-budB. E .coli / pTrc-budB.

[0041] As a control, this embodiment also constructed control strains overexpressing *E. coli* endogenous acetylhydroxyl synthase (NCBI ID: 948182 and 948183) under the same expression vector and promoter. Using the *E. coli* SIJ488 genome as a template, PCR was performed using primers ilvBN-F (TCACACAGGAAACAGACCATGGAATTCATGAATGTGGCAGCTTCTCAACAGCCCAC) and ilvBN-R (TCCGCCAAAACAGCCAAGCTTGCATATTAATTGCTGTTTAGATCTTGGCCGGAGCCATG) to obtain the gene fragment. ilvBN Approximately 2kb in size, and the PCR product was purified. Using the high-copy pTrc99a plasmid as a template, PCR was performed using pTrc-F (AGATTAAATCAGAACGCAGAAGCGGTC) and pTrc-R (AACGTAAATGCATGCCGCTTCG) primers to obtain a plasmid backbone of approximately 2.5kb, which was then purified. The pTrc99a plasmid backbone and... ilvBN The gene fragment was ligated in one step, and the resulting recombinant plasmid was named pTrc99a-ilvBN. pTrc99a-ilvBN was then electroporated into *E. coli* using an electroporator (Bio-Rad Laboratories). The electroporation conditions were 2.5 kV, 200 Ω, and 25 μF (electroporation cuvette width 2 mm). Recombinant bacteria were screened on LB agar plates containing 100 mg / L ampicillin and named pTrc99a-ilvBN. E .coli / pTrc-ilvBN.

[0042] Example 3: Site-directed mutagenesis of acetylhydroxy acid isomer reductase derived from Neurospora crassa and its expression in Escherichia coli.

[0043] against Neurospora crassa ( Neurospora crassa Conserved sequence alignment was performed on acetylhydroxy acid isomer reductase from [source name], and [the sequence was determined]. β -α- β Replacing positively charged amino acid residues in a motif with negatively charged amino acids yields a mutant. ilvC Ncr (Including the point mutations V113D / R114F), the encoding gene was artificially synthesized after codon optimization, and its sequence is shown in Seq ID2. Then, using this gene fragment as a template, PCR was performed with primers Ncr-F (GAGGAATCACCATGGCTGCTCGTAACTGCAC) and Ncr-R (TCAGACCGCTTCTGCGTTCTGATTTAATCTTTATTTCTGGTTTTCCGGACGCAG) to obtain... ilvC Ncr The gene fragment was approximately 1 kb, and the PCR product was purified. Using the pTrc99a-budB plasmid constructed in Example 2 as a template, and pTrc-budB-F (AGATTAAATCAGAACGCAGAAGCGGTC) and pTrc-budB-R (TGCAGTTACGAGCAGCCATGGTGATTCCTCTTACAGAATCTGGCTCAGGTGCAG) as primers, PCR was performed to obtain a plasmid backbone of approximately 4.5 kb, which was then purified by PCR. The pTrc99a-budB plasmid backbone and... ilvC Ncr The gene fragments were ligated in one step, and the resulting recombinant plasmid was named pTrc99a-budB-ilvC. Ncr Using an electroporator (Bio-Rayet), pTrc99a-budB-ilvC was... Ncr The bacteria were transferred into *E. coli* via electroporation under the following conditions: voltage 2.5 kV, resistance 200 Ω, capacitance 25 μF (electroporation cuvette width 2 mm). Recombinant bacteria were obtained by screening on LB agar plates containing 100 mg / L ampicillin and named […]. E .coli / pTrc-budB-ilvC Ncr .

[0044] Example 4: Production of leucine by fermentation culture of recombinant Escherichia coli

[0045] Escherichia coli SIJ488 CP and recombinant strains E.coli / pTrc-budB、 E.coli / pTrc-ilvBN、 E.coli / pTrc-budB- ilvC Ncr Incubate overnight on LB agar plates. Inoculate a single colony from this fresh plate into a 250 mL baffled shake flask containing 30 mL of seed culture medium and incubate at 37°C. o C, incubate at 200 rpm for 12 hours.

[0046] The seed culture medium formula includes (g / L): yeast extract 5g, peptone 10g, sodium chloride 10g.

[0047] Inoculate the seed culture at a rate of 10% into a 500ml baffled shake flask containing 30ml of fermentation medium, and incubate for 30 minutes. o C, incubate at 200 rpm for 36 hours.

[0048] The fermentation medium formula includes (g / L): glucose 20, yeast extract 2.5, citric acid 0.8, sodium borate decahydrate 0.02, sodium molybdate dihydrate 0.137, manganese sulfate monohydrate 0.379, calcium chloride dihydrate 2, copper sulfate pentahydrate 1, zinc sulfate heptahydrate 2.2, ferrous sulfate heptahydrate 10, magnesium sulfate heptahydrate 0.8, diammonium hydrogen phosphate 1, potassium dihydrogen phosphate 6.67, and 3-morpholine propanesulfonic acid 20.9.

[0049] The OD of the strain was measured using a visible light spectrophotometer during fermentation. 600 The concentration of leucine at 36 h was determined using high-performance liquid chromatography (HPLC) and NADPH / NADP was used. + The intracellular NADPH level was measured using a detection kit, and the results are shown in Tables 1, 2, and 3. Table 2 shows that overexpression of the *Enterobacter aerogenes* acetylhydroxyl synthase gene... budB It can significantly increase leucine production, while overexpression of E. coli's own acetylhydroxy acid synthase gene can significantly increase leucine production. ilvBN It did not increase leucine production. Furthermore, further overexpression of mutants derived from Neurospora crassa... ilvC Ncr This can also further increase leucine production. Meanwhile, as shown in Table 3, overexpression... ilvC Ncr Following the mutation, intracellular NADPH / NADP + The increased ratio indicates that the high production of leucine did not consume more intracellular NADPH, thus improving the balance of intracellular coenzymes.

[0050] Table 1. Growth of different strains (OD) 600 )

[0051]

[0052] Table 2. Leucine production (g / L) of different strains

[0053]

[0054] Table 3. Intracellular NADPH content (NADPH / NADP) of different strains + )

[0055]

[0056] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. An acetylhydroxy acid isomer reductase mutant, characterized in that, The amino acid sequence is shown in SEQ ID NO:

4.

2. A gene encoding the acetylhydroxy acid isomer reductase mutant of claim 1, or biological material containing said gene; The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, or engineered bacteria.

3. A recombinant microorganism producing high levels of leucine, characterized in that, The recombinant microorganism is *Escherichia coli* that overexpresses the gene described in claim 2; The *E. coli* strain is an engineered bacterium that produces leucine; the engineered bacterium overexpresses a foreign gene. budB Escherichia coli ( Escherichia coli ); The exogenous gene budB Enterobacter aerogenes ( Enterobacter aerogenes acetylhydroxy acid synthase gene budB The amino acid sequence of the acetylhydroxy acid synthase it encodes is shown in SEQ ID NO:

2.

4. The recombinant microorganism according to claim 3, characterized in that, The Escherichia coli was SIJ488 CP; The construction method of strain SIJ488 CP includes inserting an additional leuABCD gene into the genome of Escherichia coli SIJ488 using the CRISPR-transposon system. This gene includes the α-isopropylmalate synthase gene leuA, the α-isopropylmalate isomerase gene leuB, and the β-isopropylmalate dehydrogenase gene leuCD, whose NCBI ID numbers are 947465, 944798, 945076, and 945042, respectively.

5. The recombinant microorganism according to claim 3 or 4, characterized in that, The exogenous gene was transmitted via a high-copy pTrc99a plasmid. budB It was introduced into the Escherichia coli.

6. A method for constructing recombinant microorganisms that produce high levels of leucine, characterized in that, The acetylhydroxyl synthase gene of Enterobacter aerogenes budB The gene described in claim 2, after codon optimization, is introduced into E. coli via plasmid or integrated into the E. coli chromosome via genetic engineering. Among them, genes budB The amino acid sequence encoding acetylhydroxy acid synthase is shown in SEQ ID NO:2; The plasmid is pTrc99a; The Escherichia coli was SIJ488 CP.

7. The application of the recombinant microorganism according to any one of claims 3-5 or the recombinant microorganism constructed according to the method of claim 6 in the fermentation production of leucine.

8. A method for increasing leucine fermentation yield, characterized in that, Includes the following steps: a) Cultivate the recombinant microorganism according to any one of claims 3-5 or the recombinant microorganism constructed according to the method of claim 6 to obtain a culture; b) Collect the leucine produced from the culture obtained in step a).

Images