Indel molecular markers for identifying drought resistance in upland cotton and their applications

By developing Indel molecular markers for identifying drought resistance in upland cotton and using PCR amplification technology and specific primers, the difficulties in identifying drought resistance in cotton in existing technologies have been solved, and efficient and accurate germplasm identification and breeding selection have been achieved.

CN119372361BActive Publication Date: 2025-09-09HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411656553.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-19
Publication Date
2025-09-09
Estimated Expiration
2044-11-19

AI Technical Summary

Technical Problem

The existing technology lacks effective molecular markers for identifying cotton drought resistance, which limits the progress of molecular marker-assisted selection breeding and makes it difficult to quickly and accurately distinguish between drought-resistant and drought-sensitive cotton germplasm.

Method used

Indel molecular markers have been developed for identifying drought resistance in upland cotton. By detecting primers and kits, PCR amplification technology is used to detect the genotype of the Indel molecular marker. Combined with whole-genome association analysis, Indel variants closely linked to drought resistance are screened out, and specific primers are designed for PCR amplification and electrophoresis detection.

Benefits of technology

It has achieved efficient and accurate identification of cotton drought resistance, can distinguish drought-resistant and drought-sensitive germplasm, improved breeding selection efficiency, and promoted the selection and breeding of cotton drought-resistant materials and the improvement of germplasm resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119372361B_ABST
    Figure CN119372361B_ABST
Patent Text Reader

Abstract

The present invention belongs to the technical field of molecular markers and germplasm resource identification, and in particular to Indel molecular markers for identifying drought resistance of upland cotton and their applications. The Indel molecular marker is located at the 737th base of the nucleotide sequence shown in SEQ ID NO.1. In drought-resistant cotton germplasm, the genotype of the Indel molecular marker is G, and in drought-sensitive cotton germplasm, the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGC CTAATAAAAGGA. The Indel molecular marker provided by the present invention is closely linked to the drought-resistant phenotype of upland cotton, can be used for efficient and accurate identification or auxiliary identification of the drought resistance of the cotton to be tested, effectively distinguish between drought-resistant and drought-sensitive cotton germplasm, and provide effective means and approaches for the assisted selection of drought-resistant cotton and the cultivation of new cotton germplasm resources through molecular markers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers and germplasm resource identification, and in particular to Indel molecular markers for identifying drought resistance of upland cotton and applications thereof. Background Art

[0002] Cotton is one of the world's major cash crops, cultivated on a large scale in over 30 countries. However, extreme environmental conditions, such as drought, can affect cotton growth, yield, and fiber quality. Cotton is particularly sensitive to water shortages during the seedling, flowering, and boll development stages. Therefore, breeding drought-resistant cotton varieties to mitigate the damage caused by drought stress to the cotton industry is particularly important.

[0003] Traditional cotton breeding relies on phenotypic selection, and the impact of the natural environment on phenotypes significantly limits the efficiency of selecting superior varieties. Compared to conventional breeding techniques, molecular marker-assisted selection (MAS) is not restricted by time and geographical factors, and the selection process is rapid and accurate. It has become the preferred method for identifying drought-resistant varieties and is playing an increasingly prominent role in cotton breeding. The development of molecular markers closely linked to genes regulating cotton drought resistance is a crucial prerequisite for achieving efficient MAS breeding.

[0004] Insertion-deletion markers (InDel) refer to the insertion or deletion of nucleotide fragments of different sizes at the same site in the genome between closely related species or different individuals of the same species. That is, a site on a sequence has one or more bases inserted or deleted compared to another homologous sequence. InDel polymorphic molecular markers have the characteristics of wide distribution, high density, large number, good polymorphism, and strong stability in the genome, and are applicable to multiple species. Moreover, by using InDel polymorphic molecular markers to design primers for PCR amplification, based on the difference in the size of the amplified products, a large number of samples can be quickly tested, their genotypes can be accurately determined, and then the sample phenotypes can be distinguished, making them very suitable for molecular marker-assisted selection breeding.

[0005] Currently, molecular markers for key cotton traits primarily focus on screening for markers of yield, fiber quality, and disease resistance. Research on molecular markers for abiotic stress resistance is limited, and there are few molecular markers closely linked to genes for drought resistance. This has limited the ability to use markers to assist in the breeding of new drought-resistant varieties. Therefore, identifying key genes associated with drought resistance and developing specific indel molecular markers are of great scientific significance and practical value for establishing assisted selection breeding systems and enabling the rapid identification and genetic improvement of drought-resistant cotton varieties. Summary of the Invention

[0006] In response to the problems of the prior art, the present invention provides an Indel molecular marker for identifying drought resistance in upland cotton. The Indel molecular marker is closely linked to the drought resistance phenotype of upland cotton and can be used to efficiently and accurately identify or assist in identifying the drought resistance of the cotton to be tested, effectively distinguishing between drought-resistant and drought-sensitive cotton germplasm, and providing an effective means and approach for molecular marker-assisted selection of drought-resistant cotton materials and cultivation of new cotton germplasm resources. The present invention thus provides detection primers and a kit for detecting the Indel molecular marker, as well as the use of the aforementioned detection primers and kit in identifying drought resistance in cotton. The present invention is specifically implemented through the following technical solutions:

[0007] The first aspect of the present invention provides a detection primer, which is used to detect an Indel molecular marker for drought resistance in upland cotton. The Indel molecular marker is located at the 737th base of the nucleotide sequence shown in SEQ ID NO.1. In drought-resistant cotton germplasm, the genotype of the Indel molecular marker is G. In drought-sensitive cotton germplasm, the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA.

[0008] Furthermore, the detection primers include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2 or SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3 or SEQ ID NO.5.

[0009] Furthermore, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3.

[0010] A second aspect of the present invention provides a kit comprising the detection primers described above.

[0011] Furthermore, the kit also includes TaqDNA polymerase, dNTPmix and buffer.

[0012] The third aspect of the present invention provides the use of the above-mentioned detection primers or the above-mentioned kit in identifying drought resistance of upland cotton.

[0013] A fourth aspect of the present invention provides a method for identifying drought resistance of upland cotton, comprising the following steps:

[0014] Using the detection primers or the kit described above, PCR amplification is performed on the genomic DNA of the upland cotton to be tested to obtain a PCR amplification product; the genotype of the Indel molecular marker in the PCR amplification product is detected, and the drought resistance of the upland cotton to be tested is determined based on the genotype; wherein the Indel molecular marker is located at base 737 of the nucleotide sequence shown in SEQ ID NO.1, and has two genotypes: G and GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA;

[0015] Judging the drought resistance of the upland cotton to be tested according to the genotype includes: when the genotype of the Indel molecular marker is G, the upland cotton to be tested is a drought-resistant cotton germplasm; when the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA, the upland cotton to be tested is a drought-sensitive cotton germplasm.

[0016] Furthermore, the detection primers include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2 or SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3 or SEQ ID NO.5.

[0017] Furthermore, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.5; detecting the genotype of the Indel molecular marker in the PCR amplification product includes: detecting the sequence information of the PCR amplification product by sequencing, and analyzing the genotype of the Indel molecular marker based on the sequence information.

[0018] Furthermore, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3; detecting the genotype of the Indel molecular marker in the PCR amplification product includes: when the PCR amplification product cannot specifically amplify a band or the amplified band pattern does not contain a 177 bp band pattern, the genotype of the Indel molecular marker is G; when the PCR amplification product can specifically amplify a band and contains a 177 bp band pattern, the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA.

[0019] The advantages and positive effects of the present invention are:

[0020] Based on genome-wide association analysis, the present invention discovered an indel variant in the upstream regulatory region of the GhMJ1156 gene that is tightly linked to a drought-resistance phenotype. The CIDT values ​​of the drought-resistance phenotype corresponding to different haplotypes (or genotypes) at the indel variant site differ significantly, and the genotypes are significantly correlated and highly consistent with the drought-resistance phenotype. Molecular markers for drought resistance developed using this indel variant can efficiently and accurately identify or assist in identifying the drought resistance of tested cotton, effectively distinguishing between drought-resistant and drought-sensitive cotton germplasm, and providing an effective means and approach for molecular marker-assisted selection breeding of drought-resistant cotton materials and cultivating new cotton germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0022] Figure 1 This is the correlation between the variant sites at the GhMJ1156 locus and the drought resistance phenotype in Upland cotton in Example 1 of the present invention; wherein Figure a is a Manhattan plot and linkage disequilibrium block diagram between the variant sites at different physical locations and the drought resistance phenotype, and Figure b is the distribution position of the Indel variant at the GhMJ1156 locus;

[0023] Figure 2 This is a statistical graph of the comprehensive drought resistance index corresponding to different haplotypes of the Indel mutation at the GhMJ1156 locus in the natural population of upland cotton in Example 1 of the present invention;

[0024] Figure 3 The genotypes and sequencing peaks of the Indel mutation at the GhMJ1156 locus of drought-resistant and drought-sensitive cotton germplasms in Example 2 of the present invention are shown; wherein, Figure a is the drought-sensitive cotton germplasm Junmian 1, and Figure b is the drought-resistant cotton germplasm Wankangmian 9;

[0025] Figure 4 Figure 2 shows the results of amplifying the Indel mutation at the GhMJ1156 locus using different primers in Example 2 of the present invention; Figure a is a sequencing peak diagram of the product amplified using the primers shown in SEQ ID NOs. 4-5, and Figure b is an electrophoresis diagram of the product amplified using the primers shown in SEQ ID NOs. 2-3;

[0026] Figure 5 This is an electrophoresis diagram of the product of amplifying a natural cotton population using the primers shown in SEQ ID NO. 2-3 in Example 3 of the present invention; wherein, Figure a is a drought-sensitive cotton material, and Figure b is a drought-resistant cotton material. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the examples. Unless otherwise specified, the equipment and reagents used in each example and test example can be obtained from commercial sources. The specific examples described herein are only used to illustrate the present invention and are not intended to limit the present invention.

[0028] Based on the information contained in this application, it will be readily apparent to those skilled in the art that various changes can be made to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are provided merely to illustrate specific aspects of the present invention. In fact, various changes that a person skilled in the art or related fields would clearly be able to make to the embodiments of the present invention are encompassed within the scope of the appended claims.

[0029] For a better understanding of the present invention and not to limit the scope of the present invention, all numbers used in this application to express amounts, percentages, and other numerical values ​​should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may vary depending on the desired properties to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant figures and by conventional rounding methods.

[0030] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0031] The present invention studied candidate genes for drought resistance in 517 natural cotton germplasm populations. Using the Comprehensive Index of Drought Tolerance (CIDT) as phenotypic data for evaluating drought resistance, combined with the aforementioned germplasm resequencing data, a genome-wide association study (GWAS) was performed. The GhMJ1156 gene in upland cotton was screened and identified. This gene is located within the drought quantitative trait locus (QTL) interval identified in the 517 natural cotton populations. An indel variant was found in the upstream regulatory region of the GhMJ1156 gene (located 922 bp upstream of the gene start codon) that is tightly linked to the drought resistance phenotype. The CIDT values ​​corresponding to different haplotypes (or genotypes) at this locus differed significantly (p=0.0083). Cotton germplasm carrying haplotype G had significantly higher CIDT values ​​than cotton germplasm carrying haplotype GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA (47 bp).

[0032] The indel mutation in the upstream regulatory region of the GhMJ1156 gene is located at position 113705237bp (based on the position of haplotype "G") on chromosome A06 of the upland cotton TM-1 reference genome "Ghirsutum_genome_HAU_v1.0". Compared with the reference genome, a genotype variation of G->GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA occurs, more specifically at base 737 of the GhMJ1156 locus (sequence shown in SEQ ID NO.1). In drought-resistant cotton germplasm, the genotype of the indel molecular marker is G, and in drought-sensitive cotton germplasm, the genotype of the indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA.

[0033] Further molecular marker authenticity and reliability verification was performed using known drought-resistant materials and natural populations of upland cotton, showing that the genotype of the Indel variant had a significant correlation and high consistency with the drought-resistant phenotype. Therefore, the Indel variant in the upstream regulatory region of the GhMJ1156 gene of the present invention can be independently developed as a drought-resistant molecular marker. By detecting the sequence information of the Indel molecular marker, the resistance or tolerance of upland cotton germplasm resources to drought environments can be efficiently and accurately predicted based on its genotype, laying a theoretical foundation and scientific basis for cotton drought-resistant molecular marker-assisted breeding, and also providing effective means and approaches for the accurate selection of cotton drought-resistant materials and the efficient improvement of target traits; and molecular marker genotype detection is not limited by environmental factors and breeding time, which is conducive to greatly improving selection efficiency and promoting breeding speed, and has far-reaching and significant significance for improving cotton drought resistance and promoting sustainable development of the industry.

[0034] One embodiment of the present invention provides a detection primer, which is used to detect an Indel molecular marker for drought resistance in upland cotton. The Indel molecular marker is located at base 737 of the nucleotide sequence shown in SEQ ID NO.1. In drought-resistant cotton germplasm, the genotype of the Indel molecular marker is G. In drought-sensitive cotton germplasm, the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA.

[0035] The present invention utilizes detection primers to amplify a sequence containing a drought-resistant Indel molecular marker upstream of the GhMJ1156 gene, and then obtains the genotype of the molecular marker by analyzing the sequence information of the amplified product. This allows for efficient and accurate identification or auxiliary identification of the drought resistance of the cotton to be tested, effectively distinguishing drought-resistant cotton germplasm from drought-sensitive cotton germplasm, and providing an effective means and approach for molecular marker-assisted selection breeding of drought-resistant cotton materials and cultivating new cotton germplasm resources.

[0036] Optionally, the detection primers include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2 or SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3 or SEQ ID NO.5. Specifically as follows:

[0037] F1: GGGGATATCAAAATTTTAATCCGTA (see SEQ ID NO. 2);

[0038] R1: CAAAGACAAGGAGCCAAAGAA (see SEQ ID NO. 3);

[0039] F2: GGCATTTGTTTCTTGAAAACC (see SEQ ID NO.4);

[0040] R2: CAAAGACAAGGAGCCAAAG (see SEQ ID NO. 5).

[0041] Preferably, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3; or, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.5.

[0042] More preferably, the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3. In the present invention, a partial sequence of the Indel molecular marker is designed into the upstream primer. When the sequence "GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA" is deleted, the binding ability of the upstream primer to the target sequence in the genome is weakened, thereby causing a significant decrease in amplification efficiency or inability to perform specific amplification. Therefore, after obtaining the PCR amplification product, electrophoresis detection is performed. When the PCR amplification product can specifically amplify a band and contains a 177bp band pattern, it can be determined that the cotton germplasm to be tested is drought-sensitive cotton germplasm; when the PCR amplification product cannot specifically amplify a band or the amplified band pattern does not contain a 177bp band pattern, the cotton germplasm to be tested is drought-resistant cotton germplasm.

[0043] The sequence corresponding to the 177 bp banding pattern of the present invention is preferably as shown in SEQ ID NO. 6, specifically:

[0044] GGGGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGAGATATCAAA ATTTGAACCCAAATAATTTTTGGTGTAGAACTTTAACCATTGCTTCAAATAAAATGTTGACA ATAACATGTAATTATTAAGAAGCTTAAATGTTCAATTTTCTTTGGCTCCTTGTCTTTG.

[0045] Yet another embodiment of the present invention provides a kit comprising the detection primers described above.

[0046] The advantages of the kit over the prior art are the same as those of the detection primers described above, and will not be repeated here.

[0047] Optionally, the kit further comprises a PCR amplification reagent. The present invention has no particular limitation on the source of the PCR amplification reagent, and conventional commercial products in the art may be used.

[0048] In a typical embodiment, the PCR amplification reagents include Taq DNA polymerase, dNTP mix and buffer.

[0049] The present invention does not specifically limit the total amount of PCR amplification reagents and primers in the kit; the total amount can be set according to the conventional requirements of the kit. Generally speaking, the concentration of the upstream and downstream primers in the kit is preferably 10-20 mM, more preferably 10 mM, which is usually the concentration of the stock solution. The buffer reagent is preferably 10× Buffer.

[0050] Another embodiment of the present invention provides a use of the above-mentioned detection primers for detecting the Indel molecular marker for detecting drought resistance of upland cotton or the above-mentioned kit in identifying drought resistance of upland cotton.

[0051] Based on the same inventive concept as above, an embodiment of the present invention further provides a method for identifying drought resistance of upland cotton, comprising the following steps:

[0052] Using the detection primers or the kit described above to perform PCR amplification on the genomic DNA of the upland cotton to be tested, to obtain a PCR amplification product;

[0053] Detecting the genotype of the Indel molecular marker in the PCR amplification product, and judging the drought resistance of the tested upland cotton according to the genotype; wherein the Indel molecular marker is located at the 737th base of the nucleotide sequence shown in SEQ ID NO.1, and has two genotypes: G and GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA;

[0054] Judging the drought resistance of the upland cotton to be tested according to the genotype includes: when the genotype of the Indel molecular marker is G, the upland cotton to be tested is a drought-resistant cotton germplasm; when the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA, the upland cotton to be tested is a drought-sensitive cotton germplasm.

[0055] Optionally, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2 or SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3 or SEQ ID NO.5.

[0056] Preferably, the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 5; and detecting the genotype of the Indel molecular marker in the PCR amplification product includes: detecting sequence information of the PCR amplification product by sequencing, and analyzing the genotype of the Indel molecular marker based on the sequence information.

[0057] Preferably, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3. At this time, detecting the genotype of the Indel molecular marker in the PCR amplification product includes: when the PCR amplification product cannot specifically amplify a band or the amplified band pattern does not contain a 177bp band pattern, the genotype of the Indel molecular marker is G; when the PCR amplification product can specifically amplify a band and contains a 177bp band pattern, the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA. Based on this method, only two steps, PCR amplification and electrophoresis band pattern detection, are required to achieve efficient differentiation of drought-resistant cotton germplasm and drought-sensitive cotton germplasm at the genotype level, which has the advantages of low cost, convenience, efficiency, and strong specificity.

[0058] The present invention does not specifically limit the method for extracting genomic DNA from the cotton germplasm to be tested, and any commonly used genomic DNA extraction method or genomic DNA extraction kit in the art may be used, such as the CTAB extraction method used in the examples of the present invention.

[0059] Optionally, the PCR amplification reaction system, measured in 20 μL, includes: 2.0 μL of 10× buffer, 0.4 μL of dNTP mix, 0.2 μL of Taq DNA polymerase, 1 μL of genomic DNA, 0.2 μL of upstream primer, 0.2 μL of downstream primer and 16 μL of sterile water; wherein, in the reaction system, the concentrations of the upstream primer and the downstream primer are 1-2 mM, and the concentration of the genomic DNA is 3.75-5 ng / μL.

[0060] Optionally, the PCR amplification reaction procedure includes: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 52-53°C for 30 s, extension at 70-72°C for 30 s, 30 cycles; extension at 72°C for 5 min; preferably, the annealing temperature is 53°C.

[0061] The present invention will be further described below with reference to specific examples. Experimental methods in the following examples where specific conditions are not specified were generally performed under conventional conditions, such as those described in the Molecular Cloning Laboratory Manual (4th Edition) published by Cold Spring Harbor Laboratory, or under conditions recommended by the manufacturer.

[0062] The cotton germplasm resources used in the following examples were selected from 517 natural populations of upland cotton, including Xinjiang bred varieties. The aforementioned 517 natural population materials of upland cotton mainly come from different ecological cotton areas in my country, and a small part is foreign upland cotton varieties. They were planted in 2016 and 2017 at the experimental base of the Cotton Research Institute of the Xinjiang Academy of Agricultural Sciences in Shihezi, northern Xinjiang, and water irrigation restriction experiments were carried out. Eight traits including agronomic traits, fiber quality, and yield indicators were investigated throughout the growth period. The heritability of each trait was evaluated based on two-year and two-point experimental data, the effect of reducing water irrigation by 50% on cotton production was analyzed, and the correlation network between the traits was depicted through correlation analysis. 517 studies on natural populations of upland cotton were published in the literature [1] "Li B, Tian Q, Wang X, Han B, Liu L, Kong X, Si A, Wang J, Lin Z, Zhang X, Yu Y, Yang X. Phenotypic plasticity and genetic variation of cotton yield and its related traits underwater-limited conditions. Crop J, 2020, 8(6): 966-976" and the literature [2] "Li Baoqi, Analyzing the genetic basis of cotton response to drought based on field phenotypes and phenotypic platform image indicators, 2020".

[0063] Table 1 shows the information of upland cotton germplasm resources used in the present invention. The public can obtain relevant germplasm resources materials from the applicant, which can only be used to repeat the experiments of the present invention and cannot be used for other purposes.

[0064] Table 1 Information on upland cotton germplasm resources used in the present invention

[0065]

[0066]

[0067] Example 1 Candidate gene association analysis based on natural variation of GhMJ1156 gene

[0068] A natural variation map of upland cotton was constructed using publicly available resequencing data from 517 accessions (the raw resequencing data were released into the SRA database at NCBI under the project number PRJNA556955). Drought resistance phenotypes were assessed using a comprehensive drought resistance index (CDI) across all 517 accessions. Genome-wide association analysis, combined with the resequencing data, identified drought quantitative trait loci (QTLs) associated with the CDI. Differentially expressed genes within these QTLs were identified and further functionally annotated. The candidate gene, GhMJ1156 (CottonFGD database gene number Ghir_A06G016360), encoding a cell division cycle protein, was identified. Multiple variants within the GhMJ1156 locus (including the sequence upstream of the GhMJ1156 gene start codon) were found to be significantly associated with the CDI. Among them, the insertion / deletion of 47bp bases located in the upstream regulatory region of the candidate gene GhMJ1156 (922bp away from the start codon ATG) was significantly correlated with drought-resistance-related phenotypes. At the same time, the 47bp Indel molecular marker was verified, and it was found that the drought-sensitive material did have the 47bp base insertion, while the drought-resistant material did not have this variation.

[0069] The comprehensive index of drought tolerance (CIDT) is calculated as follows:

[0070] CIDT = DRC(LP+LW+YPH+MV+FSBN+EFSBN) / (GP+SW+FL+FS+FE+PH+FFSH+FFSBN+EBN+PBN). The DRC value is the ratio of the drought-treated phenotypic value to the control phenotypic value. There are 16 traits, each corresponding to a corresponding DRC value. Among them, the population means of lint percentage (LP), lint index (LW), seed cotton yield per hectare (YPH), micronaire value (MV), fruiting branch number (FSBN), and empty fruiting branch number (EFSBN) increased significantly under water restriction (p < 0.001). The population means of growth period (GP), seed index (SW), fiber length (FL), fiber strength (FS), fiber elongation (FE), plant height (PH), fruiting branch first node height (FFSH), fruiting branch first node number (FFSBN), effective boll number per plant (EBN), and peripheral boll number (PBN) decreased significantly under water restriction (p < 0.001).

[0071] The specific analysis steps of this embodiment are as follows:

[0072] (1) The variation information between bp 113702474 and bp 113705928 on chromosome A06, i.e., the variation information of the GhMJ1156 locus (including the 2000 bp before the start codon of the GhMJ1156 gene) was obtained from the natural variation map and is summarized in Table 2. There are 27 variations in the GhMJ1156 locus, of which 23 are in the upstream regulatory region, including 11 indel variations and 12 single-nucleotide polymorphisms; 3 single-nucleotide polymorphisms and 1 indel variation are in the 5'UTR region of the gene.

[0073] Table 2 Variation sites at the GhMJ1156 locus in upland cotton

[0074]

[0075]

[0076] Note: The meanings of the categories in the table are as follows: Type: variant type; Pos: physical position in the genome; Ref: reference genotype; Alt: variant genotype; DisttoATG: physical distance from the start codon, negative values ​​indicate upstream of the start codon.

[0077] Reference genome: The upland cotton TM-1 genome was used as the reference genome. Its version is 'Ghirsutum_genome_HAU_v1.0', which can be obtained from the CottonFGD database at http: / / cotton.hzau.edu.cn / EN / Download.htm.

[0078] (2) The cotton materials were grouped according to different genotypes based on the variation information. For example, the SNP variation located at the 113702474bp position of chromosome A06 in the reference genome had two haplotypes, C and G, and its allele genotypes had three types, CC, GG, and CG. The comprehensive drought resistance index was used as the drought resistance phenotypic value for association analysis. The grouped t-test of drought resistance-related phenotypic values ​​was calculated. The p-value reflected the correlation between the variation and the phenotype after the t-test, and a significance threshold of less than 0.05 was used.

[0079] Figure 1 The correlation between the variation in different physical locations and the phenotypic value of the integrated index of drought tolerance (CIDT) is shown; Figure 1Figure (a) shows, from top to bottom, the Manhattan plot and linkage disequilibrium block (LDBlock) plots between variants at different physical locations and drought resistance phenotypes. In the Manhattan plot, the horizontal axis represents the physical position of the variant on the reference genome, and the vertical axis represents -log(p), where p represents the t-test result. In the LDblock plot, the upper bar shows the relative physical position of the variant on the reference genome, and the lower red squares represent the LD values ​​for different variants. Darker squares indicate higher LD values. Typically, a group of highly linked genetic variants form a linkage disequilibrium block, and variants within these blocks are often inherited together. The results showed that 23 variants were significantly associated with drought resistance-related phenotypic values, including one indel variant. Figure 1 Figure b shows the distribution of the aforementioned Indel mutation at the GhMJ1156 locus, located at position 113705237bp on chromosome A06 of the upland cotton TM-1 reference genome. Compared with the reference genome, there is a G->G GATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA The underlined part is the insertion sequence.

[0080] (3) Since the regulatory region plays an important role in gene expression changes, and linkage disequilibrium analysis also shows that there is a significant correlation between the Indel variation in the regulatory region of the GhMJ1156 gene and the drought resistance phenotype, the present invention selects this Indel variation to develop a functional molecular marker. 517 natural cotton populations were grouped according to the two haplotypes G and GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA. The comprehensive drought resistance index corresponding to the plants of different haplotypes was statistically calculated and used as the phenotypic value for a group t-test. Since the heterozygotes of these two haplotypes account for a very small proportion in natural samples, the heterozygous genotype was not included in the analysis.

[0081] Figure 2 The phenotypic data for 517 natural cotton populations, grouped by haplotype of the indel mutation at position 113705237bp on chromosome A06, are shown. The horizontal axis represents haplotype, and the vertical axis represents the integrated drought tolerance index (CITD). The figure shows that the different haplotypes of this indel mutation are highly correlated with the cotton drought resistance phenotype (p=0.0083). The CITD values ​​of the different haplotypes vary significantly. Cotton germplasm carrying haplotype G has significantly higher CITD values ​​than cotton germplasm carrying haplotype GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA (47bp), indicating that the presence of this 47bp base insertion weakens cotton's tolerance to drought.

[0082] In summary, this example develops a drought-resistant molecular marker for the Indel mutation "G->GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA" in the upstream regulatory region of the GhMJ1156 gene of upland cotton. The Indel molecular marker is located at the 113705237bp position of chromosome A06 of the upland cotton TM-1 "Ghirsutum_genome_HAU_v1.0" reference genome based on the position of the haplotype "G". The genotype in the drought-resistant cotton germplasm is G, and the genotype in the drought-sensitive cotton germplasm is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA.

[0083] Specifically, the nucleotide sequence containing the Indel variation is shown in SEQ ID NO. 1. This sequence is excerpted from the regulatory sequence 1500 bp upstream of the GhMJ1156 gene. The haplotype "G" is located at the 737th base (shown in bold shaded area). The nucleotide sequence of the haplotype "GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA" is obtained by replacing the 737th base "G" with "GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA".

[0084] Table 3 CDS sequence of GhMJ1156 gene in upland cotton and its upstream Indel molecular marker information

[0085]

[0086]

[0087] Example 2 Development of Molecular Marker Detection Primers Based on Indel Mutations in the Downstream Regulatory Region of the Upland Cotton GhMJ1156 Gene

[0088] 1. Molecular marker authenticity verification

[0089] Based on the material information and corresponding genotype information in the variation map of Example 1, one sample of extreme drought-resistant materials with genotypes of G and GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA at position 113705237bp was selected. In this example, molecular marker amplification was performed using natural populations Wankangmian9 and Junmian1. Wankangmian9 is a typical drought-resistant variety with a genotype of haplotype G, and Junmian1 is a drought-sensitive germplasm with a genotype of haplotype GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA. The main steps are as follows:

[0090] Primer design: Based on the upstream regulatory sequence and marker position of GhMJ1156 in SEQ ID NO.1, PCR primers were designed. The nucleotide sequences (5'-3') of the upstream primer and downstream primer are as follows:

[0091] F2: GGCATTTGTTTCTTGAAAACC (see SEQ ID NO.4);

[0092] R2: CAAAGACAAGGAGCCAAAG (see SEQ ID NO. 5).

[0093] Genomic DNA extraction: The CTAB method was used to extract the genomic DNA of Wankangmian9 and Junmian1 materials. Specifically, 100 mg of fresh cotton leaves were added to 200 μL of extraction buffer, ground, and then 800 μL of CTAB lysis buffer was added. The samples were lysed in a 65°C water bath for 30 minutes. 800 μL of chloroform was added to the lysed samples, and the samples were inverted and mixed for 5 minutes to remove impurities such as pigments. After centrifugation at 12000 rpm for 10 minutes, the supernatant was transferred and mixed with an equal volume of -20°C pre-cooled isopropanol, placed at -20°C for precipitation for 2 hours, centrifuged at 12000 rpm for 1 minute, and the supernatant was discarded. The precipitate was rinsed with 1 mL of 75% ethanol for a total of two rinses, each for 10 minutes, centrifuged and the supernatant was discarded, the precipitate was placed at room temperature to dry naturally, and the DNA was dissolved with ddH2O. The extraction buffer consists of 0.35 M glucose, 0.1 M Tris-HCl, 5 mmol / L Na₂EDTA, 2% (w / v) PVP-30, and 0.1% (w / v) DIECA, pH 7.5. 0.2% β-mercaptoethanol was added before use. The CTAB lysis buffer consists of 0.1 M Tris-HCl, 1.4 M NaCl, 0.02 M Na₂EDTA, 2% CTAB, 2% (w / v) PVP-30, and 0.1% (w / v) DIECA, pH 8.0.

[0094] PCR amplification: 75-100 ng of genomic DNA was used as a template for PCR amplification. The 20 μL PCR amplification reaction system included: 1 μL genomic DNA, 2.0 μL 10× buffer, 0.2 μL upstream primer, 0.2 μL downstream primer, 0.4 μL dNTP mix, 0.2 μL Taq DNA polymerase, and 16 μL sterile water. The concentrations of the upstream and downstream primers in the reaction system were 1-2 mM, and the concentration of the genomic DNA was 3.75-5 ng / μL. Optionally, the PCR amplification reaction procedure included: pre-denaturation at 95°C for 5 min; 30 cycles of denaturation at 95°C for 30 s, annealing at 53°C for 30 s, and extension at 72°C for 30 s; and extension at 72°C for 5 min.

[0095] Result detection: After PCR amplification using the upstream primers and downstream primers shown in SEQ ID NO.4 and SEQ ID NO.5, the PCR amplification product was sent to the company for Sanger sequencing to confirm the authenticity of the marked Indel in the sequence.

[0096] The results are as follows Figure 3 As shown, Figures a and b are the genotype information and sequencing peak diagrams of Junmian 1 and Wankangmian 9 respectively. Figure 3 It can be seen that the genotype of Wankangmian 9 at the physical position of 113705237bp is G (drought-resistant genotype); the genotype of Junmian 1 at the physical position of 113705237bp is (drought-sensitive genotype), thereby confirming the existence of Indel mutation and can be used as a drought-resistance molecular marker to distinguish drought-resistant and drought-sensitive cotton germplasm.

[0097] 2. PCR detection primer sequence design

[0098] After confirming the authenticity of the marker, the marker primer sequence was designed. The upstream primer contained the Indel mutation at the physical position of 113705237bp ( GGATATCAAAATTTTAATCCGTA The underlined portion of the sequence (TTATCTAATTGCCTAATAAAAGGA) is located downstream of the mutation site, and the target sequence amplification size is 177 bp. The detection principle is that cotton materials containing the indel molecular marker can amplify the target sequence, while cotton materials without the indel molecular marker lack specific binding with the upstream primer, and their genomes have little or no amplification of the target size. Therefore, the presence of the indel molecular marker can be easily determined by the presence of the PCR amplification product and the size of the band, thereby identifying the cotton germplasm genotype. The nucleotide sequence (5'-3') of the marker primer is shown below:

[0099] F1: GG GGATATCAAAATTTTAATCCGTA (see SEQ ID NO. 2);

[0100] R1: CAAAGACAAGGAGCCAAAGAA (see SEQ ID NO. 3);

[0101] Five cotton accessions of each of the two genotypes were selected for molecular marker amplification using the same PCR amplification system and procedure as described above. The drought-sensitive accessions were Chuanmian 30, Xinluzao 9, Xinluzao 32, Sumian 4, and Zhongmiansuo14, while the drought-resistant accessions were Jihan 3, Emian 1, Xuzhou 142, Shanmian 401, and Xiaomian 1. PCR amplification and sequencing were performed simultaneously using the upstream and downstream primers shown in SEQ ID NO. 4 and SEQ ID NO. 5 to confirm that the PCR molecular marker primer amplification results were consistent with the sequencing results.

[0102] The results are as follows Figure 4 Figure a shows the sequencing results of the product amplified by PCR using SEQ ID NO. 4 and SEQ ID NO. 5, and Figure b shows the electrophoresis results of the product amplified by PCR using SEQ ID NO. 2 and SEQ ID NO. 3. The results of Figures a and b match, demonstrating that the PCR molecular marker primers of the present invention are useful. The presence of the indel molecular marker can be determined by the presence of the PCR amplification product, thereby identifying or assisting in the identification of cotton drought resistance.

[0103] The judgment rules for using molecular marker primers to identify the drought resistance of cotton germplasm are as follows: when the target product of 177bp band type can be specifically amplified, the cotton to be tested is drought-sensitive cotton germplasm; when the band cannot be specifically amplified or the amplified band type does not contain 177bp band type, the cotton to be tested is drought-resistant cotton germplasm.

[0104] The sequence (5'-3') corresponding to the 177 bp banding product amplified by the PCR primer pair consisting of upstream primer-2 and downstream primer in this example is as follows:

[0105] GGGGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGAGATATCAAA ATTTGAACCCAAATAATTTTTGGTGTAGAACTTTAACCATTGCTTCAAATAAATGTTGACA ATAACATGTAATTATTAAGAAGCTTAAATGTTCAATTTTCTTTGGCTCCTTGTCTTTG (see SEQ ID NO. 6), the shaded portion is a 47 bp Indel variation.

[0106] Example 3 Molecular marker validation at the natural population level

[0107] In this example, the molecular marker primers identified in Example 2 were used to select 44 drought-resistant and drought-sensitive accessions based on the CITD phenotypic data from natural populations. Genomic DNA was extracted. PCR amplification was performed using SEQ ID NO. 2 and SEQ ID NO. 3 as upstream and downstream primers, respectively. The PCR amplification system and procedure were the same as in Example 2.

[0108] The electrophoresis diagram of PCR amplification products is as follows Figure 5 Figure a shows drought-sensitive accessions, and Figure b shows drought-resistant accessions. * indicates accessions with unclear or nonspecific amplification. Results showed that 39 accessions of drought-sensitive accessions produced amplified bands, while 5 failed to produce amplified specific bands. Meanwhile, 39 accessions of drought-resistant accessions failed to produce amplified specific bands, while 5 produced amplified target bands. A chi-square test revealed a significant difference in amplification efficiency between drought-resistant and drought-sensitive accessions, with a p-value of 4.20E-13, confirming a significant correlation between the genotype of indel variants and phenotypic drought resistance traits in cotton in natural populations.

[0109] In summary, the Indel mutation provided by the present invention and the molecular marker primers developed based on the Indel mutation can be used to detect drought resistance in cotton. The drought-resistant and sensitive cotton germplasms can be distinguished based on the electrophoretic band distribution of the amplified products with high accuracy. The genotype and phenotype have high consistency, providing a convenient method for high-throughput screening of drought-resistant cotton varieties.

[0110] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A detection primer, characterized in that The detection primer is used to detect an Indel molecular marker for drought resistance in upland cotton. The Indel molecular marker is located at base 737 of the nucleotide sequence shown in SEQ ID NO.

1. In drought-resistant cotton germplasm, the genotype of the Indel molecular marker is G. In drought-sensitive cotton germplasm, the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA. Wherein, the detection primer includes an upstream primer and a downstream primer, and the nucleotide sequences of the upstream primer and the downstream primer are respectively shown as SEQ ID NO.2-3, or the nucleotide sequences of the upstream primer and the downstream primer are respectively shown as SEQ ID NO.4-5.

2. The detection primer according to claim 1, wherein The nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

3. A kit, characterized in that The kit comprises the detection primer according to any one of claims 1 to 2.

4. The kit according to claim 3, wherein The kit also includes Taq DNA polymerase, dNTP mix and buffer.

5. Use of the detection primer according to any one of claims 1 to 2 or the kit according to any one of claims 3 to 4 in auxiliary identification of drought resistance of upland cotton.

6. An auxiliary identification method for drought resistance of upland cotton, characterized in that: The following steps are involved: PCR amplification is performed on genomic DNA of a target upland cotton using the detection primers or a kit containing the detection primers to obtain a PCR amplification product; wherein the detection primers include an upstream primer and a downstream primer, and the nucleotide sequences of the upstream primer and the downstream primer are respectively shown in SEQ ID NOs. 2-3, or the nucleotide sequences of the upstream primer and the downstream primer are respectively shown in SEQ ID NOs. 4-5; Detecting the genotype of the Indel molecular marker in the PCR amplification product, and judging the drought resistance of the tested upland cotton according to the genotype; wherein the Indel molecular marker is located at the 737th base of the nucleotide sequence shown in SEQ ID NO.1, and has two genotypes: G and GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA; Judging the drought resistance of the upland cotton to be tested according to the genotype includes: when the genotype of the Indel molecular marker is G, the upland cotton to be tested is a drought-resistant cotton germplasm; when the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA, the upland cotton to be tested is a drought-sensitive cotton germplasm.

7. The auxiliary identification method for drought resistance of upland cotton according to claim 6, characterized in that The nucleotide sequence of the upstream primer is shown in SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.5; Detecting the genotype of the Indel molecular marker in the PCR amplification product includes: detecting sequence information of the PCR amplification product by sequencing, and analyzing the genotype of the Indel molecular marker according to the sequence information.

8. The auxiliary identification method for drought resistance of upland cotton according to claim 6, characterized in that The nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3; Detecting the genotype of the Indel molecular marker in the PCR amplification product includes: when the PCR amplification product cannot specifically amplify a band or the amplified band pattern does not contain a 177bp band pattern, the genotype of the Indel molecular marker is G; when the PCR amplification product can specifically amplify a band and contains a 177bp band pattern, the genotype of the Indel molecular marker is GGATATCAAAATTTTAATCCGTATTATCTAATTGCCTAATAAAAGGA.

Citation Information

Patent Citations

  • Indel variation located in upstream regulation region of GhPME26 gene of upland cotton, detection primer and kit and application of Indel variation and detection primer

    CN118109629A

  • Indel drought-resistant molecular marker located in downstream regulation region of GhHD16 gene and application of Indel drought-resistant molecular marker

    CN118813857A