InDel molecular marker primer pairs closely linked to the gene for green stripes on eggplant pericarp and their applications
By developing InDel molecular marker primer pairs that are closely linked to the green stripe gene in eggplant peel, and using PCR amplification and gel electrophoresis detection, the problem of uneven pigment distribution in eggplant peel was solved, achieving high efficiency and accuracy in eggplant breeding.
Patent Information
- Application Number
- CN202411740271.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-29
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2044-11-29
AI Technical Summary
Existing technologies have limited research on the formation of stripes caused by uneven pigment distribution in eggplant peel, making it difficult to effectively utilize molecular marker technology to improve breeding efficiency and accuracy.
InDel molecular marker primer pairs closely linked to the green stripe gene in eggplant pericarp were developed. PCR amplification was performed using primer pairs SEQ ID NO.1 and SEQ ID NO.2, and the green stripes in eggplant pericarp were detected by gel electrophoresis. An InDel molecular marker kit was designed for eggplant breeding.
It enables rapid and accurate identification of green stripes on eggplant peel, improving breeding efficiency and success rate, and effectively screening eggplant varieties with green stripe characteristics.
Smart Images

Figure CN119372366B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to an InDel molecular marker primer pair closely linked to the gene for green stripes on eggplant pericarp and its application. Background Technology
[0002] Eggplant (Solanum melongena L.), also known as 'luosu', 'kunlun gua', and 'diaocaizi', belongs to the genus Solanum in the family Solanaceae (2n=2x=24). It is generally believed that eggplant originated in Myanmar in Southeast Asia, India in South Asia, and surrounding tropical countries. Eggplant is widely cultivated in Africa, Asia, Central America, and the Mediterranean region. In contrast, its cultivation scale is relatively small in Europe and America due to lower latitudes and a limited number of varieties. China ranks first in both total eggplant production and cultivated area, and eggplant occupies a major vegetable position in many parts of the country, accumulating diverse eggplant germplasm resources.
[0003] As a diverse vegetable in the Solanaceae family, eggplant not only boasts excellent taste and texture but also possesses significant medicinal value. It contains antioxidants such as anthocyanins, lutein, and zeaxanthin, which help reduce cell damage and prevent various chronic diseases. Different consumer regions have varying demands regarding the appearance of eggplant fruits, therefore, varietal selection must consider whether these varieties can adapt to different market areas and ecological conditions. For example, striped eggplants are quite popular in South Asia and South America. In recent years, striped eggplants have also begun to appear in East Asia, commanding higher market prices than ordinary eggplants, and consumer demand is rising. Although numerous studies have reported on the mechanisms by which chlorophyll affects the uniform coloring of eggplant peels, research on the formation of stripes due to uneven pigment distribution remains limited. Therefore, identifying key regulatory genes for eggplant peel stripes is of great significance for breeding varieties that improve eggplant appearance quality.
[0004] Choosing appropriate molecular marker technologies is crucial for improving the efficiency and accuracy of breeding efforts. Molecular marker-assisted breeding (MMR) technology, by developing molecular markers closely related to target traits, enables targeted detection and screening of plants at the gene level, achieving precise plant selection. Therefore, cloning genes regulating green fruit markings in eggplant and developing functional markers that efficiently match fruit marking traits have significant theoretical and practical value for breeding new eggplant varieties and achieving targeted molecular design breeding for green fruit markings.
[0005] The information disclosed in this background section is intended only to enhance the understanding of the overall background of the invention and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention
[0006] The purpose of this invention is to provide an InDel molecular marker primer pair that is closely linked to the gene for green stripes on eggplant peel and its application. This primer pair can be used to quickly and accurately identify green stripes on eggplant peel.
[0007] To achieve the above objectives, the present invention provides an InDel molecular marker primer pair that is closely linked to the green stripe gene of eggplant peel. The upstream primer nucleotide sequence of the InDel molecular marker primer is shown in SEQ ID NO.1, and the downstream primer nucleotide sequence is shown in SEQ ID NO.2.
[0008] SEQ ID NO.1, F: 5'-TTCTGGCTCTCTCACTAATCAAAT-3';
[0009] SEQ ID NO. 2, R: 5'-CATAAAGATTAAGTCAATGAGGAGAG-3'.
[0010] An InDel molecular marker closely linked to the gene for green stripes on eggplant pericarp, wherein the InDel molecular marker is amplified using eggplant genomic DNA as a template and InDel molecular marker primer pairs;
[0011] The upstream primer nucleotide sequence of the InDel molecular marker primer pair is shown in SEQ ID NO.1, and the downstream primer nucleotide sequence is shown in SEQ ID NO.2.
[0012] The nucleotide sequences obtained by amplification using InDel molecular marker primers are shown in SEQ ID NO.3 and SEQ ID NO.4.
[0013] Kits containing InDel molecular marker primer pairs or InDel molecular markers.
[0014] Applications of an InDel molecular marker primer pair, molecular marker, or kit include:
[0015] (1) Application in identifying green stripes on eggplant peel;
[0016] (2) Application in molecular marker-assisted breeding of green stripes on eggplant peel.
[0017] A method for identifying green stripes on eggplant peel includes the following steps:
[0018] (1) Using the DNA of the eggplant material to be tested as a template, PCR amplification was performed on SEQ ID NO.1-2 using InDel molecular marker primers to obtain PCR products;
[0019] (2) Perform gel electrophoresis on the amplification products and observe the electrophoresis results.
[0020] Preferably, in the above technical solution, step (1) PCR reaction system: in a 12μL reaction system, 2μL of DNA template solution, 5μL of 2×Taq Mix, 1μL each of forward and reverse primers, with a concentration of 10uM / L, and 3μL of ddH2O to make up the total volume to 12μL;
[0021] PCR amplification reaction program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 5 min.
[0022] Step (2) The gel is an 8% non-denaturing polyacrylamide gel.
[0023] Preferably, in the above technical solution, the method for judging the electrophoresis detection result in step (2) is as follows:
[0024] The InDel molecular marker primers amplified a 104bp fragment, indicating that the eggplant sample to be tested was a variety with green striped peel.
[0025] The InDel molecular marker primers amplified a 94bp fragment, indicating that the eggplant sample to be tested was a variety with pure green peel and no variegation.
[0026] The InDel molecular marker primers simultaneously amplified fragments of 104bp and 94bp, indicating that the sample to be tested was heterozygous.
[0027] Compared with existing technologies, this invention has the following beneficial effects: The InDel molecular marker primer pair closely linked to the eggplant green stripe gene and its application utilize parental lines NO211, P13, and F1 to screen for polymorphism of the developed InDel marker. Screening revealed that the molecular marker GS-IDm4.01 exhibits stable polymorphism between parents. Combined with F1 detection results, GS-IDm4.01 was determined to be a dominant marker, and the amplified bands from this marker were clear and showed significant differences between parents. Based on the InDel molecular marker, InDel primer sequences were designed, PCR amplification was performed, and the detection results were observed to identify the green stripes on the eggplant peel. Using the primers of this invention, the green stripe phenotype of eggplant peel can be identified and screened, enabling rapid, accurate, and effective breeding of eggplant varieties with the green stripe characteristic, accelerating the crop breeding process, and improving breeding efficiency and success rate. Attached Figure Description
[0028] Figure 1This is an electrophoresis diagram of the amplification results of the InDel molecular marker primer pair according to the present invention in the green striped inbred line NO211, the pure green unstriped inbred line P13 and their F1 generation; in the figure, P1 is NO211; P2 is P13; F1 is the hybrid generation of NO211 and P13.
[0029] Figure 2 This is an electrophoresis diagram showing the verification results of the InDel molecular marker primer pair according to the present invention in 22 eggplant germplasm materials with known green stripe phenotypes in the pericarp. Detailed Implementation
[0030] The specific embodiments of the present invention will now be described in detail with reference to the accompanying drawings, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments.
[0031] Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "comprises" shall be understood to include the stated elements or components without excluding other elements or other components.
[0032] I. Obtaining Molecular Markers
[0033] 1. Targeting the construction of the target audience
[0034] High-generation inbred lines NO211 and P13 were selected as the maternal parent (P1) and paternal parent (P2), respectively, to construct genetic segregating populations (F1, BC1P1, BC1P2, and F2). NO211 fruits are round with green stripes on the peel, while P13 fruits are elongated with a pure green peel without stripes. Furthermore, we sequenced and assembled the NO211 line, generating the first high-quality eggplant T2T genome, which served as a reference genome for subsequent BSA resequencing. To identify candidate genes for green fruit stripes, an F2 population (6,539 individuals) was constructed through self-pollination of F1 plants. High-quality genomic DNA was isolated from leaves using the CTAB method.
[0035] 2. Molecular marker development
[0036] Based on the eggplant T2T genome assembled by our research group, we precisely located the candidate gene SmGLK, which controls the green stripes on eggplant fruit. According to BSA-seq results, Indel markers were developed at variant sites upstream and downstream of the SmGLK gene. Primers were designed and PCR amplified at several stable sites (generally ≥15bp with ≥3bp differential bases).
[0037] 3. Obtaining the molecular marker GS-IDm4.01
[0038] The developed Indel marker was screened for polymorphism using parental NO211, P13, and F1 cells. Screening revealed that the molecular marker GS-IDm4.01 exhibited stable polymorphism between the parents. Combined with F1 detection results, GS-IDm4.01 was determined to be a dominant marker, and the amplified band from this marker was clear and showed significant differences between the parents. Figure 1 ).
[0039] like Figure 1 The results show that the DNA amplification product of the molecular marker GS-IDm4.01 in the eggplant green striped inbred line NO211 is a 104 bp fragment, while the DNA amplification product in the eggplant pure green unstriped inbred line P13 is a 94 bp fragment. The DNA amplification product of the F1 generation from the NO211 / P13 cross contains both 104 bp and 94 bp fragments. The nucleotide sequences of the primer pairs for the GS-IDm4.01 marker, SEQ ID NO.1 and SEQ ID NO.2, are shown below:
[0040] SEQ ID NO.1, F: 5'-TTCTGGCTCTCTCACTAATCAAAT-3';
[0041] SEQ ID NO. 2, R: 5'-CATAAAGATTAAGTCAATGAGGAGAG-3'.
[0042] The nucleotide sequence of NO211 (104 bp), SEQ ID NO.3, is shown below:
[0043] TTCTGGCTCTCTCACTAATCAAATCCATCCTTAAACTCTATATATAGTGACAACTTTAATATACCTAGACTTTTTTTTCTCTCCTCATTGACTTAATCTTTTAG
[0044] The nucleotide sequence of P13 (94 bp), SEQ ID NO.4, is shown below:
[0045] TTCTGGCTCTCACTAATCAAATCCATCCTTAATAGTGACAACTTTA ATATACCTAGACTTTTTTTTCTCTCCTCATTGACTTAATCTTTTAG
[0046] II. Application of the molecular marker GS-IDm4.01
[0047] 1. Test materials
[0048] This invention utilizes 7 eggplant germplasm samples with green, patterned pericarps and 15 samples with pure green, unpatterned pericarps to validate the molecular marker GS-IDm4.01. The germplasm materials used were obtained from the College of Agriculture, Guangxi University.
[0049] 2. Test Methods
[0050] Genotyping of the above-mentioned test materials was performed using the molecular marker GS-IDm4.01, with the genomic DNA of the test materials serving as the template.
[0051] PCR reaction system (12μL): 2μL DNA template solution, 5μL 2×Taq Mix, 1μL each of forward and reverse primers at a concentration of 10uM / L, and bring the total volume to 12μL with 3μL ddH2O.
[0052] PCR amplification reaction program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 5 min.
[0053] Subsequently, the amplified products were subjected to 8% non-denaturing polyacrylamide gel electrophoresis, stained with 1% silver nitrate for 5 min, and then developed with a mixture of sodium hydroxide and formaldehyde. Finally, the samples were observed and photographed. When reading the electrophoresis gel images, bands identical to 'NO211' were marked as 'b', bands identical to 'P13' were marked as 'a', and bands containing both parental bands were marked as 'h'.
[0054] 3. Test Results
[0055] Electrophoresis results as follows Figure 2 As shown, the molecular marker GS-IDm4.01 contained a 104 bp fragment in the PCR amplification products of the green-striped germplasm (1-7), and a 94 bp fragment in the PCR amplification products of the pure green-striped germplasm (8, 10-22), consistent with the results of the identification of the green stripe (present / absent) phenotype of the tested materials. The PCR amplification product of the pure green-striped germplasm (9) contained a 104 bp fragment. The marker genotype of the tested materials was inconsistent with the green stripe (present / absent) phenotype, possibly because the marker and gene were closely linked but did not reach the degree of co-segregation. The phenotypes and genotypes of the presence / absence of green stripes in the 22 eggplant germplasm resources were statistically analyzed, and the results are shown in Table 1.
[0056] Table 1. Phenotypic and genotypic data of 22 eggplant germplasm resources with / without green stripes on the pericarp.
[0057]
[0058]
[0059] The above results demonstrate that the molecular marker GS-IDm4.01 of this invention has strong specificity and a detection accuracy of 95.5%, and can be used for the identification and screening of eggplant peel with or without green stripes.
[0060] The foregoing description of specific exemplary embodiments of the invention is for illustrative and explanatory purposes. These descriptions are not intended to limit the invention to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application, thereby enabling those skilled in the art to implement and utilize various different exemplary embodiments of the invention, as well as various different choices and variations. The scope of the invention is intended to be defined by the claims and their equivalents.
Claims
1. An InDel molecular marker tightly linked to the gene for green stripes on eggplant pericarp, characterized in that, The InDel molecular marker was obtained by amplifying the sequence using eggplant genomic DNA as a template and InDel molecular marker primer pairs. The upstream primer nucleotide sequence of the InDel molecular marker primer pair is shown in SEQ ID NO. 1, and the downstream primer nucleotide sequence is shown in SEQ ID NO.
2. The nucleotide sequences obtained by amplification using InDel molecular marker primers are shown in SEQ ID NO. 3 and SEQ ID NO.
4.
2. The application of an InDel molecular marker primer pair as described in claim 1, or a molecular marker as described in claim 1, or a kit containing an InDel molecular marker primer pair as described in claim 1, comprising: (1) Application in identifying green stripes on eggplant peel; (2) Application in molecular marker-assisted breeding of green stripes on eggplant peel.
3. A method for producing green stripes on eggplant peel, characterized in that, Includes the following steps: (1) Using the DNA of the eggplant material to be tested as a template, PCR amplification was performed using InDel molecular marker primers to obtain SEQ ID NO. 1-2, and PCR products were obtained; the InDel molecular marker was amplified using eggplant genomic DNA as a template and InDel molecular marker primers; the nucleotide sequences amplified by InDel molecular marker primers are shown in SEQ ID NO. 3 and SEQ ID NO.
4. (2) Perform gel electrophoresis on the amplification products and observe the electrophoresis results.
4. The method according to claim 3, characterized in that, Step (1) PCR reaction system: In a 12μl reaction system, add 2 μL of DNA template solution, 5μL of 2×Taq Mix, 1μL each of forward and reverse primers, with a concentration of 10uM / L, and add 3 μL of ddH2O to bring the total volume to 12μL. PCR amplification reaction program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 5 min. Step (2) The gel is an 8% non-denaturing polyacrylamide gel.
5. The method according to claim 3, characterized in that, The method for judging the electrophoresis detection results in step (2) is as follows: The InDel molecular marker primers amplified a 104bp fragment, indicating that the eggplant sample to be tested was a variety with green stripes on the pericarp. The InDel molecular marker primers amplified a 94bp fragment, indicating that the eggplant sample to be tested was a variety with pure green peel and no variegation. The InDel molecular marker primers simultaneously amplified fragments of 104 bp and 94 bp, indicating that the sample to be tested was heterozygous.
Citation Information
Patent Citations
InDel molecular marker closely linked with color character of eggplant peel and application of InDel molecular marker
CN116426684A
Molecular marker closely linked with eggplant peel color and application thereof
CN117844964A