ShRNA targeting SNORD115 position to restore paternal UBE3A gene expression in happy puppet syndrome

Abstract

Provided herein are compositions and methods for activating expression of paternal genetic alleles of UBE3A in happy puppet syndrome using viral vector delivery of short hairpin RNA. Provided herein are compositions and methods for reducing or eliminating the expression of SNORD115 and UBE3A-ATS in happy puppet syndrome using viral vector delivery of short hairpin RNA.

Description

[0001] Cross-references to related applications

[0002] This application claims the benefit and priority of U.S. Provisional Application No. 63 / 317,155, filed March 7, 2022, which is incorporated herein by reference in its entirety.

[0003] Government Support Statement

[0004] This invention was carried out with government support under Contract No. 1R01HD094953, approved by the National Institutes of Health. The government has certain rights in this invention. Technical Field

[0005] This disclosure relates to compositions and methods for activating the expression of the paternal allele of UBE3A in subjects with Angelman syndrome using short hairpin RNA.

[0006] References to sequence lists

[0007] A sequence list corresponding to the sequences described in this paper will be submitted.

[0008] background

[0009] Happy Puppet Syndrome (AS) is a neurodevelopmental disorder affecting approximately 1 in 15,000 individuals. Individuals with AS exhibit developmental delays, severe cognitive impairment, ataxic gait, frequent seizures, short attention span, absent speech, and characteristic happy demeanor. Neurons derived from induced pluripotent stem cells (iPSCs) from AS patients show depolarized resting membrane potentials, delayed action potential development, and reduced spontaneous synaptic activity. (Fink et al., 2017, Nat Commun 8). AS affects a relatively large patient population; a contact registry of >3,000 patients has been established, and approximately 250 new AS diagnoses are made annually. Individuals with AS require lifelong care.

[0010] AS is caused by the loss of function of the maternal copy of UBE3A, a gene encoding an E3 ubiquitin ligase. This loss-of-function mutation can be caused by any type of gene mutation in the maternal allele. UBE3A is exclusively expressed by the maternal allele in neurons. All individuals with AS possess a normal paternal UBE3A allele, which is epigenetically silenced in neurons in a cis-regulatory manner by a long non-coding RNA called the UBE3A antisense transcript (UBE3A-ATS) (Rougeulle et al., 1997, Nat Genet 17, 14-15; Chamberlain and Brannan, 2001, Genomics 73, 316-322). In AS mouse models, reactivation of the paternal allele has shown restoration of UBE3A protein expression and reduction of behavioral deficits. Restoration of UBE3A expression in humans holds promise for disease improvement, particularly in infants.

[0011] Overview

[0012] This article presents a novel approach to treat Happy Puppet Syndrome (AS) by suppressing paternal UBE3A silencing and allowing paternal UBE3A expression from its natural regulatory elements, thereby replacing or increasing the expression of absent maternal UBE3A. Increased UBE3A expression in neurons is achieved by interfering with the transcription of SNORD115 and / or UBE3A-ATS. Since expression is controlled by natural regulatory elements, overexpression of UBE3A is prevented. This approach can improve AS symptoms with a single treatment and eliminates the need for multiple treatments.

[0013] This article provides a polynucleotide sequence comprising:

[0014] (SEQ ID NO:3). An expression vector comprising SEQ ID NO:3 is provided. In an embodiment, the expression vector is an adeno-associated virus (AAV) vector or a lentiviral vector. A pharmaceutical composition comprising the foregoing substances is provided.

[0015] This document provides a polynucleotide encoding shRNA comprising a nucleotide sequence complementary to at least 85%, at least 90%, at least 95%, or 100% of an RNA encoded by any of SEQ ID NO:19-360. In an embodiment, the polynucleotide is SEQ ID NO:3. In an embodiment, the shRNA causes activation or increase in the expression of paternal UBE3A. In an embodiment, the shRNA causes decrease in the expression of paternal SNORD115 and UBE3A-ATS. An expression vector comprising shRNA is provided. In an embodiment, the expression vector is an adeno-associated virus (AAV) vector or a lentiviral vector. A pharmaceutical composition comprising the foregoing substances is provided.

[0016] This article provides a method for treating Happy Puppet syndrome, comprising administering the polynucleotide of SEQ ID NO:3 to a patient in need. In one embodiment, the polynucleotide of SEQ ID NO:3 encodes an shRNA that results in decreased expression of paternal SNORD115 and UBE3A-ATS. In another embodiment, the polynucleotide of SEQ ID NO:3 encodes an shRNA that results in activated or increased expression of the paternal UBE3A gene.

[0017] This article provides a method for treating Happy Puppet syndrome, comprising administering a polynucleotide encoding shRNA to a patient in need, the shRNA comprising a nucleotide sequence complementary to at least 85%, at least 90%, at least 95%, or 100% of an RNA encoded by any of SEQ ID NO:19-360. In an embodiment, the polynucleotide is SEQ ID NO:3. In an embodiment, the shRNA causes activation or increase in the expression of paternal UBE3A. In an embodiment, the shRNA causes decrease in the expression of paternal SNORD115 and UBE3A-ATS.

[0018] In one embodiment, SEQ ID NO:3 encodes an shRNA capable of suppressing silencing of paternal UBE3A. In another embodiment, SEQ ID NO:3 is contained within an expression vector. In yet another embodiment, the expression vector is an adeno-associated virus (AAV) vector or a lentiviral vector. In yet another embodiment, a method is provided for suppressing silencing of the paternal UBE3A gene by an RNA antisense transcript encoded by UBE3A-ATS (SEQ ID NO:1) and SNORD115 (SEQ ID NO:2), comprising administering to a patient in need an effective amount of SEQ ID NO:3 cleaved from the RNA antisense transcript encoded by SEQ ID NO:2.

[0019] In one embodiment, a method is provided to suppress the silencing of the paternal UBE3A gene by an RNA antisense transcript encoded by SEQ ID NO:1, comprising administering shRNA to a patient in need of such administration an amount of RNA antisense transcript encoded by SEQ ID NO:2, the shRNA comprising a nucleotide sequence that is at least 85%, at least 90%, at least 95%, or 100% complementary to an RNA encoded by any one of SEQ ID NO:19-360.

[0020] In embodiments, the shRNA provided herein is encoded by a portion of SEQ ID NO:3, for example, having a bold nucleotide that is shortened by one, two, three, or four nucleotides at either end of the bold nucleotide. Similarly, in embodiments, the shRNA provided herein may contain a portion of SEQ ID NO:3, for example, having an italic nucleotide that is shortened by one, two, or three nucleotides at either end of the italic nucleotide. In embodiments, the shRNA provided herein is encoded by a polynucleotide comprising any one of SEQ ID NO:19-360, which is shortened by one, two, three, or four nucleotides at either end.

[0021] The implementation plan provides the following polynucleotide sequence:

[0022] (SEQ ID NO:361), where nnnnnnnn can be CTCGAG (SEQ ID NO:362), TCAAGAG (SEQ ID NO:363), TTCG (SEQ ID NO:364) or GAAGCTTG (SEQ ID NO:365).

[0023] In the implementation scheme, a polynucleotide sequence is provided, comprising a first part, a second part, and a third part, wherein the first part comprises any one of SEQ ID NO:19-360, the second part comprises any one of SEQ ID NO:362, 363, 364, or 365, and the third part comprises a corresponding nucleotide sequence complementary to the nucleotide sequence in SEQ ID NO:19-360. Brief description of the attached diagram

[0025] Figure 1 The chromosomal mutations in Happy Puppet Syndrome are shown.

[0026] Figure 2 Illustrations of the paternal SNHG14 and UBE3A genes are shown.

[0027] Figure 3The genomic location of the shRNA target is shown (solid line). A UCSC Genome Browser view of the 15q11-q13 region of the imprinted SNHG14 / UBE3A locus (dashed line). The location of the shRNA target within the SNORD115 snoRNA cluster.

[0028] Figure 4 This is a bar graph showing the qRT-PCR analysis of hESC-derived neurons in Happy Puppet syndrome after treatment with shRNAs targeting SNHG14 (SNORD115 shRNA 1, SNORD115 shRNA 2, and SNORD115 shRNA 3) or untargeted control shRNAs (scrambled). SNORD115 shRNA 3 knocked down SNORD115 and UBE3A-ATS and activated paternal UBE3A.

[0029] Detailed Explanation

[0030] UBE3A is a gene encoding an E3 ubiquitin ligase. The genomic coordinates of UBE3A on the negative strand are hg19chr15:25,582,381-25,684,175. There are three normal isotypes of UBE3A: isotype 1 (accession number X98032); isotype 2 (accession number X98031); and isotype 3 (accession number X98033). In neurons, UBE3A is exclusively expressed by the maternal allele. The paternal UBE3A allele is epigenetically silenced by the long non-coding RNA UBE3A antisense transcript (UBE3A-ATS) encoded by SEQ ID NO:1. The genomic coordinates of UBE3A-ATS on the positive strand are hg19chr15:25,223,730-25,664,609. The following genomic coordinates are noteworthy: hg19chr15:25,522,751-25,591,391 on the positive strand.

[0031] UBE3A-ATS / Ube3a-ATS (human / mouse) is an antisense RNA transcribed near the UBE3A locus as part of a larger transcript called SNHG14 (SNORNA host gene 14). In the central nervous system (CNS), human UBE3A-ATS is exclusively expressed from the paternal allele as part of SNHG14. This transcript is approximately 600 kb long, begins with SNURF-SNRPN on the opposite strand, and extends into the first intron of UBE3A. See, for example, Figure 2The promoter of SNURF / SNRPN is the Prader-Willi syndrome imprinting center (PWS-IC). SNHG14 (small nucleolar RNA host gene 14) is an RNA gene and belongs to the lncRNA class. UBE3A-ATS is a part of SNHG14.

[0032] SNHG14 is located within the Prader-Willi critical region and produces a long spliced ​​maternally imprinted RNA, which is initiated at one of several promoters shared by the SNRPN (small nucleoprotein N) and SNURF genes. This transcript acts as the host RNA for the small nucleolar RNA, C / D box clusters 115 and 116. See Runte et al., 2001, Hum Mol Genet 10, 2687-2700. This RNA extends antisense into the region of the UBE3A gene and is thought to regulate the imprinted expression of UBE3A in the brain. The major promoter of SNURF-SNRPN is PWS-IC, and approximately 35 kb upstream of PWS-IC is AS-IC. These two regions are thought to control the expression of the entire SNHG14 transcript. Starting from the promoter, the entire transcript can be transcribed and further processed and spliced ​​posttranscribedly.

[0033] SNURF / SNRPN are bicistronic genes encoding two protein-coding transcripts, SNURF and SNRPN. Both SNURF and SNRPN proteins are located in the cell nucleus. SNRPN is a small nucleoribonucleoprotein, and the function of SNURF is not yet known. Transcriptions initiated at SNRPN / SNURF also pass through these genes sequentially, and within their introns are sequences of several C / D-box snoRNAs. Box C / D small nucleolar RNAs (SNORDs) represent a small, well-defined family of non-coding RNAs that exert their regulatory functions via antisense-based mechanisms. Most C / D-box snoRNAs play a role in non-mRNA methylation.

[0034] Many orphan SNORDs originate from two large imprinted chromosomal domains at 15q11q13 and 14q32 in humans. See, for example, Figure 3 As described above, the imprinted human 15q11q13 region (also known as the Prader-Willi syndrome (PWS) / Happy Puppet syndrome (AS) locus or the SNURF-SNRPN domain) contains several paternally expressed protein-coding genes and many paternally expressed neuron-specific SNORD genes, organized as two major repetitive DNA arrays: the SNORD116 and SNORD115 clusters, containing 29 and 47 copies of the relevant genes, respectively.

[0035] SNORD115 encodes a small nucleolar RNA (snoRNA) that has been found clustered with dozens of other similar snoRNAs on chromosome 15. These genes are found primarily within introns of the SNURF-SNRPN / SNHG14 transcript, which is maternally imprinted and expressed from the PWS / AS region. The genomic coordinates of SNORD115 are >hg38_dnarange=chr15:25159221-25269858.

[0036] The compositions and methods described herein aim to target SNORD115 and UBE3A-ATS to unleash paternal UBE3A allele silencing. Effective inhibition of SNORD115 and UBE3A-ATS by the short hairpin RNAs (shRNAs) described herein results in decreased expression levels of both SNORD115 and UBE3A-ATS and a subsequent increase in paternal UBE3A allele expression levels. The shRNAs described herein are targeted to cleave at a single or more sites within RNA expressed from the SNORD115 locus and tested in H9-AS (hESC)-derived neurons engineered for early imprinting during neurogenesis. SNORD115 shRNA3 (SEQ ID NO:3) is an shRNA that uniquely cleaves RNA transcripts at more than one site, i.e., targeting more than one sequence within the SNORD115 cluster (see [link to shRNA description]). Figure 3This increases the likelihood that shRNA will cleave the transcript and activate paternal UBE3A, thus providing a treatment option for Happy Puppet Syndrome. Among the total cluster of 48 individually annotated snoRNAs, SNORD115 shRNA 3 shared homology with 15 of them: SNORD115-1 (SEQ ID NO:4), SNORD115-5 (SEQ ID NO:5), SNORD115-9 (SEQ ID NO:6), SNORD115-10 (SEQ ID NO:7), SNORD115-12 (SEQ ID NO:8), SNORD115-13 (SEQ ID NO:9), SNORD115-17 (SEQ ID NO:10), SNORD115-18 (SEQ ID NO:11), SNORD115-19 (SEQ ID NO:12), SNORD115-20 (SEQ ID NO:13), SNORD115-21 (SEQ ID NO:14), SNORD115-27 (SEQ ID NO:15), and SNORD115-37 (SEQ ID NO:15). (SEQ ID NO:16), SNORD115-40 (SEQ ID NO:17), and SNORD115-42 (SEQ ID NO:18). The underlined portions of the sequences highlight the target regions.

[0037] In the embodiments described herein, the compositions and methods relate to the treatment or prevention of AS. Patients requiring such treatment or prevention have AS or are at risk of developing AS. As used herein, the term "patient with corresponding need" includes any mammal, including humans, that requires these treatments or preventive methods. Subjects may be male or female. In some respects, patients with AS requiring treatment according to the methods and compositions provided herein may exhibit improvements in anxiety, learning, balance, motor function, and / or seizures, or the method may restore the resting membrane potential of neurons to approximately -70 mV, improve action potential development delay, increase spontaneous synaptic activity, and may improve additional changes in neuronal phenotypes related to base strength, action potential characteristics (e.g., shape), membrane current, synaptic potential, and / or ion channel conductance.

[0038] In one embodiment, the polynucleotide comprises a first nucleotide sequence encoding a short hairpin RNA (shRNA) that interferes with the expression of the SNORD115 sequence (SEQ ID NO:2). In another embodiment, the polynucleotide comprises a first nucleotide sequence encoding a short hairpin RNA (shRNA) that causes a decrease in the expression of the UBE3A-ATS sequence (SEQ ID NO:1). For example, a portion of the shRNA described herein may be complementary to an RNA sequence encoded by SEQ ID NO:2 or a sequence contained therein. For example, a portion of the shRNA described herein may be complementary to an RNA sequence encoded by SEQ ID NO:3 or a sequence contained therein. In another embodiment, the shRNA described herein is an RNA polynucleotide encoded by a first nucleotide sequence. The polynucleotide comprising the first nucleotide sequence may be a DNA polynucleotide suitable for cloning into a suitable vector (e.g., plasmid) for culturing and subsequently generating viral particles. The viral particles may then comprise a DNA polynucleotide having a nucleotide-coding sequence in a form suitable for infection. Thus, the first nucleotide sequence may be a DNA sequence cloned into a plasmid for viral particle generation or encapsulated within a viral particle. Because retroviruses carry nucleotide-coding sequences in the form of RNA polynucleotides, retroviral particles (e.g., lentiviruses) contain RNA polynucleotides that contain a first nucleotide sequence as the corresponding RNA sequence.

[0039] This article discloses a novel shRNA that cleaves SNORD115 to reduce UBE3A-ATS expression and subsequently activates the paternal copy of UBE3A in neurons. This provides the UBE3A gene product in cell types lacking this protein in Puppet Syndrome. A potential search space of approximately ~60 kb exists within the genomic LNCAT sequence, which can provide potential shRNA targets. However, not every predicted sequence actually reduces SNORD115 and / or UBE3A-ATS and restores UBE3A. Therefore, as some examples in this article illustrate, it is difficult to predict which sequences will work or not. See, for example, Figure 4 .

[0040] The first nucleotide sequence encodes shRNA. For example, the first nucleotide sequence could be SEQ ID NO: 3. The first nucleotide sequence may also be modified such that the bold nucleotides in SEQ ID NO:3 are replaced by any of those in SEQ ID NO:19-360, and the italic nucleotides in SEQ ID NO:3 are replaced by those complementary nucleotides in SEQ ID NO:19-360. As used herein, "target" means an effective RNA polynucleotide capable of hybridizing with a nucleotide sequence (such as a nucleotide sequence transcribed from a nucleotide sequence within the larger genomic sequence of SNORD115) via hydrogen bonding. Hybridization of the effective RNA polynucleotide with a nucleotide sequence transcribed from a nucleotide sequence within the larger genomic sequence of SNORD115 can result in a decrease in the expression levels of SNORD115 and / or UBE3A-ATS in the presence of the effective RNA polynucleotide compared to the expression levels of SNORD115 and / or UBE3A-ATS in the absence of the effective RNA polynucleotide. In an embodiment, the effective RNA polynucleotide comprises a nucleotide sequence of shRNA complementary to an RNA sequence encoded within the larger genomic sequence of SNORD115. For example, shRNA contains a nucleotide sequence complementary to the RNA sequence encoded by SEQ ID NO:19-360. Therefore, an effective RNA polynucleotide refers to the effective portion of shRNA after it has been assimilated into the target organism and processed into a functional state.

[0041] "De-expression" refers to a reduction or blockage of the expression or activity of SNORD115 and / or UBE3A-ATS, and does not necessarily mean the complete elimination of expression or activity. Mechanisms of de-expression of targets involve hybridization of effective RNA polynucleotides with one or more target sequences transcribed from one or more sequences within the larger genome's SNORD115 and / or UBE3A-ATS sequences, where the result or effect of hybridization is target degradation or target occupancy, in which cellular mechanisms involving, for example, transcription or splicing are subsequently halted.

[0042] Without being confined to a specific theory, the shRNA described in this paper can inhibit the silencing of paternal UBE3A by: (1) cleaving the RNA transcript encoded by SEQ ID NO:2; (2) reducing the steady-state level of the RNA transcript encoded by SEQ ID NO:2 (i.e., the baseline level at steady state); (3) reducing the steady-state level of the RNA transcript encoded by SEQ ID NO:1 (i.e., the baseline level at steady state); (4) terminating the transcription of SEQ ID NO:2; and (5) terminating the transcription of SEQ ID NO:1. For example, cleaving and reducing the steady-state level of the RNA transcript encoded by SEQ ID NO:2 can occur via a mechanism involving the RNA-induced silencing complex (RISC). shRNA can utilize RISC. After the vector carrying the shRNA genomic material is integrated into the host genome, the shRNA genomic material is transcribed into pri-microRNA in the host. The pri-microRNA is processed into pre-shRNA by ribonucleases such as Drosha and exported from the nucleus. The pre-shRNA is processed by an endonuclease such as Dicer to form small interfering RNA (siRNA). The siRNA is loaded into a RISC, where the sense strand is degraded and the antisense strand acts as a guide to direct the RISC to the complementary sequence in the mRNA. When the sequence is perfectly complementary, the RISC cleaves the mRNA, and when the sequence is imperfectly complementary, the RISC represses mRNA translation. Therefore, the shRNA encoded by the first nucleic acid sequence increases paternal UBE3A expression by reducing the homeostatic levels of SNORD115 and / or UBE3A-ATS RNA.

[0043] As used herein, the term "nucleic acid" refers to a molecule comprising monomeric nucleotides. Examples of nucleic acids include ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering RNA (siRNA), and short hairpin RNA (shRNA). "Nucleotide" refers to a nucleoside having a phosphate group covalently linked to the sugar moiety of the nucleoside. "Oligonucleotide" or "polynucleotide" refers to a polymer of linked nucleotides, each of which may be modified independently of the others.

[0044] As used herein, “short hairpin RNA (shRNA)” includes conventional stem-loop shRNA, which forms precursor microRNA (premiRNA). “shRNA” also includes shRNA that embeds microRNA (miRNA-based shRNA), in which the guide strand and passenger strand of the miRNA duplex are integrated into an existing (or natural) miRNA or into a modified or synthetic (designed) miRNA. During transcription, conventional shRNA (i.e., not a miR-451 shRNA mimic) forms a primary miRNA (pri-miRNA) or a structure very similar to the natural pri-miRNA. The pri-miRNA is then processed into preshRNA by Drosha and its cofactors. Therefore, the term “shRNA” includes both pri-miRNA (shRNA-mir) molecules and preshRNA molecules.

[0045] A “stem-loop structure” refers to a nucleic acid having a secondary structure comprising a region of double-stranded or duplexed nucleotides (stem portion) connected on one side by a region consisting primarily of single-stranded nucleotides (loop portion). It is known in the art that the loop portion is at least 4 nucleotides long, 6 nucleotides long (e.g., the underlined sequence in SEQ ID NO:3), 8 nucleotides long, or longer. The terms “hairpin” and “fold-back” structures are also used herein to refer to stem-loop structures. Such structures are well known in the art, and the use of the term is consistent with its known meaning in the art. For example, CTCGAG (SEQ ID NO:361), TCAAGAG (SEQ ID NO:362), TTCG (SEQ ID NO:363), and GAAGCTTG (SEQ ID NO:364) are suitable stem-loop structures. As is known in the art, the secondary structure does not require precise base pairing. Therefore, the stem may include one or more base mismatches or protrusions. Optionally, base pairing may be precise, i.e., without any mismatches. In embodiments, the following polynucleotide sequences are provided:

[0046] (SEQ ID NO:361), wherein nnnnnnnn can be CTCGAG (SEQ ID NO:362), TCAAGAG (SEQ ID NO:363), TTCG (SEQ ID NO:364), or GAAGCTTG (SEQ ID NO:365). In an embodiment, a polynucleotide sequence is provided comprising a first part, a second part, and a third part, wherein the first part comprises any one of SEQ ID NO:19-360, the second part comprises any one of SEQ ID NO:361, 362, 363, and 364, and the third part comprises a corresponding nucleotide sequence complementary to the nucleotide sequences in SEQ ID NO:19-360.

[0047] In the implementation scheme, shRNA may include, but is not limited to, modified shRNA, including shRNA with enhanced in vivo stability. Modified shRNA includes molecules containing nucleotide analogs, including those with additions, deletions, and / or substitutions in the nucleobases, sugars, or backbone; and cross-linked or otherwise chemically modified molecules. One or more modified nucleotides may be within a portion of the shRNA molecule or throughout the entire shRNA molecule. For example, the shRNA molecule may be modified, or contain modified nucleic acids in a region at its 5' end, its 3' end, or both, and / or within the guide strand, the transfer strand, or both, and / or within nucleotides protruding from the 5' end, 3' end, or both. (See Crooke, U.S. Patents 6,107,094 and 5,898,031; Elmen et al., U.S. Publications 2008 / 0249039 and 2007 / 0191294; Manoharan et al., U.S. Publication 2008 / 0213891; MacLachlan et al., U.S. Publication 2007 / 0135372; and Rana, U.S. Publication 2005 / 0020521; all of which are incorporated herein by reference.)

[0048] The shRNA described herein contains a nucleotide sequence complementary to the RNA nucleotide sequence transcribed from the intact genome SNORD115 sequence (SEQ ID NO:2) and suppresses silencing of paternal UBE3A by UBE3A-ATS. In one embodiment, the shRNA contains a nucleotide sequence complementary to the RNA sequence encoded by SEQ ID NO:19-360. In another embodiment, the shRNA contains a nucleotide sequence complementary to the RNA sequence encoded by SEQ ID NO:21 (5'-TGATGATGAGAACCTTATATT-3'). In yet another embodiment, the shRNA is encoded by the nucleotide sequence of SEQ ID NO:2. In yet another embodiment, the nucleotide sequence contained in the shRNA and complementary to the RNA nucleotide sequence transcribed from the SNORD115 gene is 17-21 nucleotides in length. The complementary nucleotides may be continuous or may be scattered with non-complementary nucleotides. In yet another embodiment, the complementary nucleotide sequence is 21 nucleotides in length, as indicated by the bolded sequence in SEQ ID NO:3. shRNA may contain 17, 18, 19, 20, or 21 nucleotides that are complementary to the nucleotides in SEQ ID NO:19-360. The 17, 18, 19, 20, or 21 complementary nucleotides may be sequential or may be interspersed with non-complementary nucleotides. The total length of the shRNA, including the loop, may be 40-50 nucleotides, for example, 44-48 nucleotides, for example, 48 nucleotides.

[0049] Methods for determining whether a sequence can specifically hybridize with a target nucleic acid are well known in the art. In the embodiments provided herein, the shRNA polynucleotide comprises a nucleic acid sequence that can specifically hybridize with an RNA sequence transcribed from SNORD115 (SEQ ID NO:2).

[0050] The shRNA may comprise an RNA polynucleotide containing a region of 17-21 linked nucleotides complementary to the RNA target sequence, wherein the RNA polynucleotide region is at least 85% complementary to an equal-length region of the SNORD115 RNA nucleic acid sequence throughout its entire length. In embodiments, the 17-21 RNA polynucleotide region is at least 90%, at least 95%, or 100% complementary to an equal-length region of the SNORD115 RNA nucleic acid sequence (e.g., encoded by SEQ ID NO:4-18) throughout its entire length.

[0051] shRNA may contain a nucleotide sequence of at least 85% complement and of equal length to the RNA sequence encoded by any of SEQ ID NO:19-360 (e.g., SEQ ID NO:21). shRNA may contain a nucleotide sequence of at least 90% complement and of equal length to the RNA sequence encoded by any of SEQ ID NO:19-360. shRNA may contain a nucleotide sequence of at least 95% complement and of equal length to the RNA sequence encoded by any of SEQ ID NO:19-360. shRNA or microRNA may contain a nucleotide sequence of 100% complement and of equal length to the RNA sequence encoded by any of SEQ ID NO:19-360.

[0052] In the implementation, shRNA is a single-stranded RNA polynucleotide. In the implementation, the RNA polynucleotide is a modified RNA polynucleotide. The complementarity percentage is used herein in the conventional sense to refer to base pairings between adenine and thymine, adenine and uracil (RNA), and guanine and cytosine.

[0053] If the shRNA retains its ability to specifically hybridize with the SNORD115 nucleotide sequence, then non-complementary nucleobases between the shRNA and the SNORD115 nucleotide sequence can be tolerated. Furthermore, the shRNA can hybridize within one or more segments of the SNORD115 nucleotide sequence, such that intercalated or adjacent segments do not participate in hybridization events (e.g., loop structures, mismatches, or hairpin structures).

[0054] In the implementation scheme, the shRNA or a designated portion thereof provided herein is 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to the SNORD115 RNA nucleotide sequence, the SNORD115 region, the SNORD115 segment, or a designated portion thereof, or at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary. The percentage of complementarity between the shRNA and the SNORD115 nucleotide sequence can be determined using conventional methods.

[0055] For example, an shRNA in which 18 out of 20 nucleotides are complementary to the SNORD115 region and thus specifically hybridizes would represent 90% complementarity. In this example, the remaining non-complementary nucleotides may be clustered or scattered with complementary nucleotides and do not need to be adjacent to each other or adjacent to complementary nucleotides. Thus, an shRNA of 18 nucleotides in length with four non-complementary nucleotides flanked by two regions perfectly complementary to the target nucleotide sequence has 77.8% overall complementarity to the target nucleotide sequence and thus falls within the scope of the subject matter disclosed herein. The percentage of complementarity of the shRNA to the regions of the SNORD115 nucleotide sequence can be routinely determined using the BLAST (Basic Local Alignment Search) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). The percentage of homology, sequence identity, or complementarity can be determined by, for example, the Gap program (Wisconsin sequence analysis package, version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.) using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489).

[0056] In the implementation scheme, the shRNA provided herein, or a designated portion thereof, is completely complementary (i.e., 100% complementary) to the SNORD115 nucleotide sequence or a designated portion thereof, or the transcript of SEQ ID NO:1. For example, the shRNA may be completely complementary to the SNORD115 nucleotide sequence or a region or segment thereof, or the sequence thereof. As used herein, “completely complementary” means that each nucleobase of the shRNA is able to pair precisely with the corresponding nucleobase of the RNA transcribed from the SNORD115 nucleotide sequence.

[0057] In embodiments, the shRNA provided herein may contain a portion of SEQ ID NO:3, for example, having a bold nucleotide that is shortened by one, two, three, or four nucleotides at either end of the bold nucleotide. Similarly, in embodiments, the shRNA provided herein may contain a portion of SEQ ID NO:3, for example, having italic nucleotides that are shortened by one, two, three, or four nucleotides at either end of the italic nucleotide. For example,

[0058]

[0059] Any one of the above SEQ ID NO:374-365 nnnnnnnn It can be CTCGAG (SEQ ID NO:362), TCAAGAG (SEQ ID NO:363), TTCG (SEQ ID NO:364), or GAAGCTTG (SEQ ID NO:365). Similarly, in embodiments, the sequences shown in any of SEQ ID NO:19-360 and / or their complementary sequences can be shortened by one, two, three, or four nucleotides at either end and incorporated into the shRNA, for example, as shown above.

[0060] The effective concentration or dose of shRNA can suppress the silencing of paternal UBE3A by UBE3A-ATS by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.

[0061] An effective concentration or dose of shRNA can terminate transcription of UBE3A-ATS by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.

[0062] Effective concentrations or doses of shRNA can reduce the steady-state level of UBE3A-ATS by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.

[0063] An effective concentration or dose of shRNA cleaves SNORD115 and reduces it by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.

[0064] Effective concentrations or doses of shRNA can reduce UBE3A-ATS expression by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%, and increase paternal UBE3A expression by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.

[0065] As used herein, the terms “UBE3A-ATS” and “Ube3A-ATS” are used interchangeably, and their spelling without capitalization indicates any specific species or interspecific homolog. “UBE3A” and “Ube3A” are used interchangeably, and their spelling without capitalization indicates any specific species or interspecific homolog. Furthermore, “UBE3A”, “UBE3A”, “Ube3A”, and “Ube3A” are used interchangeably, without italics, to indicate nucleic acids or proteins unless otherwise specified. “SNORD115” and “SNORD115” are used interchangeably, and their spelling without capitalization indicates any specific species or interspecific homolog.

[0066] Viral vector

[0067] A "vector" is a replicon, such as a plasmid, bacteriophage, or granule, into which a DNA or RNA segment can be inserted to induce replication of the inserted segment. Typically, a vector is capable of replication when associated with appropriate control elements. Suitable vector backbones include, for example, those conventionally used in the art, such as plasmids, plasmids containing a viral genome, viruses, or artificial chromosomes. The term "vector" includes cloning and expression vectors, as well as viral vectors and integration vectors.

[0068] It will be apparent to those skilled in the art that the term "viral vector" is widely used to refer to nucleic acid molecules (e.g., transfer plasmids) that include viral nucleic acid elements that typically facilitate the transfer of nucleic acid molecules to cells or viral particles, mediating the transfer of nucleic acid sequences and / or the integration of nucleic acid sequences into the cellular genome.

[0069] Viral vectors contain structural and / or functional genetic elements primarily derived from viruses. Desiredly, viral vectors are non-toxic, non-immunogenic, readily produced, and effectively protect and deliver DNA or RNA to target cells. According to the compositions and methods described herein, the viral vector may contain DNA encoding one or more shRNAs described herein. In embodiments, the viral vector is a lentiviral vector or an adeno-associated virus (AAV) vector.

[0070] As used herein, the term "lentivirus" refers to a complex group (or genus) of retroviruses. Illustrative lentiviruses include, but are not limited to: HIV (human immunodeficiency virus; including HIV type 1 and HIV type 2); Vesnamedi virus (VMV); Capillary arthritis-encephalitis virus (CAEV); Equine infectious anemia virus (EIAV); Feline immunodeficiency virus (FIV); Bovine immunodeficiency virus (BIV); and Simian immunodeficiency virus (SIV). As used herein, the term "lentivirus" includes lentivirus particles. Lentivirals transduce dividing and postmitotic cells.

[0071] The term "lentiviral vector" refers to a viral vector (e.g., a viral plasmid) that contains structural and functional genetic elements or portions thereof primarily derived from lentiviruses, including long terminal repeat (LTR) sequences. A lentiviral vector is a hybrid vector (e.g., in the form of a transfer plasmid) having a retroviral (e.g., lentivirus) sequence for reverse transcription, replication, integration, and / or packaging of a nucleic acid sequence (e.g., a coding sequence). The term "retroviral vector" refers to a viral vector (e.g., a transfer plasmid) that contains structural and functional genetic elements or portions thereof primarily derived from retroviruses.

[0072] Adenoviral vectors are designed for direct administration to live subjects. Unlike retroviral vectors, the genome of most adenoviral vectors does not integrate into the host cell's chromosome. Instead, the gene introduced into the cell using the adenoviral vector is maintained in the nucleus as an extrachromosomal element (epistome) for an extended period of time. Adenoviral vectors can transduce dividing and non-dividing cells in many different tissues in vivo, including airway epithelial cells, endothelial cells, hepatocytes, and various tumors (Trapnell, Advanced Drug Delivery, Reviews, 12(1993) 185-199).

[0073] The term “adeno-associated virus” (AAV) refers to a small ssDNA virus that infects humans and some other primate species, is known not to cause disease, and elicits only a very mild immune response. As used herein, the term “AAV” is intended to include AAV particles. AAVs can infect both dividing and non-dividing cells and can integrate their genome into the host cell’s genome. These characteristics make AAVs an attractive candidate for generating viral vectors for gene therapy, although the cloning capacity of the vectors is relatively limited. In the implementation scheme, the vectors used are derived from adeno-associated viruses (i.e., AAV vectors). More than 30 naturally occurring AAV serotypes are available. Numerous natural variants exist in the AAV capsid, allowing the identification and use of AAVs with properties particularly suited to specific target cell types. AAV viruses can be engineered using conventional molecular biology techniques, enabling the optimization of these particles for cell-specific delivery of shRNA DNA sequences, for minimizing immunogenicity, for modulating stability and particle lifespan, for efficient degradation, and for precise delivery to the nucleus, among other things.

[0074] An "expression vector" is a vector containing a regulatory region. Many vectors and expression systems are commercially available from companies such as Novagen (Madison, Wis.), Clontech (Palo Alto, Calif.), Stratagene (La Jolla, Calif.), and Invitrogen / Life Technologies (Carlsbad, Calif.). Expression vectors can be viral expression vectors derived from a specific virus.

[0075] The vectors provided herein may also include, for example, origins of replication, scaffold attachment regions (SARs), and / or markers. Marker genes can confer selectable phenotypes to host cells. For example, markers can confer resistance to biocides, such as resistance to antibiotics (e.g., kanamycin, G418, bleomycin, or hygromycin). Expression vectors may include tag sequences designed to facilitate manipulation or detection (e.g., purification or localization) of the expressed polypeptide. Tag sequences include, for example, green fluorescent protein (GFP), glutathione S-transferase (GST), polyhistidine, c-myc, hemagglutinin, or FIag. TM Tag (Kodak, New Haven, Conn.) sequences are typically expressed as fusions with the encoded polypeptide. Such tags can be inserted at any position within the polypeptide, including the carboxyl or amino terminus.

[0076] Other expression vectors may include, for example, segments of chromosomal, non-chromosomal, and synthetic DNA sequences. Suitable vectors include pLK0.1 puro, derivatives of SV40, and plasmids such as RP4; phage DNA, such as many derivatives of phage 1, such as NM989, and other phage DNAs, such as M13 and filamentous single-stranded phage DNA; vectors that can be used in eukaryotic cells, such as vectors that can be used in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNA, such as plasmids that have been modified to use phage DNA or other expression control sequences.

[0077] Vectors may also include regulatory regions. The term "regulatory region" refers to a nucleotide sequence that affects the initiation and rate of transcription or translation, as well as the stability and / or mobility of the transcribed or translated product. Regulatory regions include, but are not limited to, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, protein-binding sequences, 5' and 3' untranslated regions (UTRs), transcription start sites, termination sequences, polyadenylation sequences, nuclear localization signals, and introns.

[0078] As used herein, the term "operably linked" refers to the localization of regulatory regions and sequences of nucleic acids to be transcribed in order to influence the transcription or translation of such sequences. For example, to place a coding sequence under the control of a promoter, the translation initiation site of a polypeptide's translation reading frame is typically located between one and about 50 nucleotides downstream of the promoter. However, the promoter can be located up to about 5,000 nucleotides upstream of the translation initiation site or up to about 2,000 nucleotides upstream of the transcription initiation site. Promoters typically include at least a core (basic) promoter. Promoters may also include at least one control element, such as an enhancer sequence, an upstream element, or an upstream activation region (UAR). The selection of promoters to be included depends on several factors, including but not limited to efficiency, selectivity, inducibility, desired expression levels, and cellular or tissue-preferred expression. Regulation of coding sequence expression can be achieved by appropriately selecting promoters and other regulatory regions and appropriately localizing them relative to the coding sequence.

[0079] The vector may also contain additional components or functions that further regulate gene delivery and / or gene expression or otherwise provide beneficial properties to the targeted cells. Such additional components include, for example, components that influence binding to or targeting cells (including components mediating cell type or tissue-specific binding); components that influence cellular uptake of the vector nucleic acid; components that influence the localization of intracellular polynucleotides after uptake (such as agents mediating nuclear localization); and components that influence polynucleotide expression. Such components may also include biomarkers, such as detectable and / or selectable biomarkers that can be used to detect or select cells that have taken up the vector and expressed nucleic acids delivered by the vector. Such components may be provided as a natural feature of the vector (e.g., using certain viral vectors with components or functions that mediate binding and uptake), or the vector may be modified to provide such functions. Other vectors include those described in Chen et al., BioTechniques, 34:167-171 (2003). Numerous such vectors are known in the art and are generally available.

[0080] "Recombinant viral vector" refers to a viral vector containing one or more heterologous gene products or sequences. Because many viral vectors exhibit packaging-related size limitations, heterologous gene products or sequences are typically introduced by replacing one or more parts of the viral genome. Such viruses may become replication-deficient, requiring one or more missing functions in a trans-form during viral replication and capsidation (e.g., by using helper viruses or packaging cell lines carrying gene products essential for replication and / or capsidation).

[0081] In the implementation plan, the viral vector used herein will be, for example, at least 10 5Use at a concentration of one viral genome per cell.

[0082] The selection of an appropriate promoter can be easily accomplished. Examples of suitable promoters include RNA polymerase II or III promoters. For example, candidate shRNA sequences can be selected from RNA polymerase III promoters U6 or H1 or neuron-specific RNA polymerase II promoters (including neuron-specific enolase (NSE), synaptic protein I (Syn), or Ca2+ promoters). 2+ The expression is controlled by CaM-activated protein kinase IIα (CaMKIIα).

[0083] Other suitable promoters that can be used for gene expression include, but are not limited to, the 763-base-pair cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) (Davis et al., Hum Gene Ther 4:151 (1993)), the SV40 early promoter region, the herpes simplex kinase promoter, the regulatory sequence of the metallothionein (MMT) gene, the PGK (glycerol phosphate kinase) promoter, the alkaline phosphatase promoter; and animal transcription control regions that exhibit tissue specificity and have been used in transgenic animals; myelin basic protein gene control regions that are active in oligodendrocytes in the brain; and gonadotropin-releasing hormone (GnRH) gene control regions that are active in the hypothalamus. Certain proteins can be expressed using their native promoters. Other elements that enhance expression, such as enhancers or systems leading to high levels of expression, such as the tat gene and the tar element, may also be included. The assembly or cassette can then be inserted into a vector, such as a plasmid vector, like pLK0.1, pUC19, pUC118, pBR322, or other known plasmid vectors. See Sambrook et al., Molecular Cloning: A Laboratory Manual, ColdSpring Harbor Laboratory press, (1989). The plasmid vector may also include a selective marker, such as a β-lactamase gene for ampicillin resistance, provided the marker peptide does not adversely affect the metabolism of the treated organism. The cassette can also be bound to the nucleic acid-binding portion of a synthetic delivery system, such as the system disclosed in WO 95 / 22618.

[0084] The coding sequence of shRNA can be cloned into a viral vector using any suitable genetic engineering technique well known in the art, including but not limited to standard PCR, polynucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing techniques, as described in Sambrook et al. (Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, NY (1989)), Coffin et al. (Retroviruses. Cold Spring Harbor Laboratory Press, NY (1997)), and "RNA Viruses: A Practical Approach" (Alan J. Cann, Ed., Oxford University Press, (2000)). In an embodiment, the shRNA DNA sequence contains flanking sequences at the 5' and 3' ends that are complementary to the sequences on the plasmid and / or vector that are cleaved by restriction endonucleases. As is well known in the art, the flanking sequences depend on the restriction endonuclease used during the restriction digestion of the plasmid and / or vector. Therefore, those skilled in the art can select the flanking sequences at the 5' and 3' ends of the shRNA DNA sequence accordingly. In the implementation scheme, the target site can be cloned into the vector using nucleic acid fusion and exchange technologies known in the art, including Gateway, PCR in fusion, Cre-lox P, and Creator.

[0085] In an embodiment, the expression vector comprises a promoter and a polynucleotide comprising a first nucleotide sequence encoding the shRNA described herein. In an embodiment, the promoter and the polynucleotide comprising the first nucleotide sequence are operatively linked. In an embodiment, the promoter is a U6 promoter. In an embodiment, the first nucleotide sequence contained in the expression vector may be SEQ ID NO:3. In an embodiment, the first nucleotide sequence contained in the expression vector may also be a modified SEQ ID NO:3, wherein the bold nucleotides in SEQ ID NO:3 are replaced by any of SEQ ID NO:19-360, and the italic nucleotides in SEQ ID NO:3 are replaced by nucleotides complementary to those in SEQ ID NO:19-360. In an embodiment, the first nucleotide sequence contained in the expression vector may comprise any of SEQ ID NO:362-365. In an embodiment, the first nucleotide sequence contained in the expression vector may comprise any of SEQ ID NO:361-381. In an embodiment, the polynucleotide containing the first nucleotide sequence in the expression vector is a DNA polynucleotide. In an embodiment, the first nucleotide sequence of the expression vector is a DNA nucleotide sequence. The shRNA encoded by the first nucleotide sequence of the expression vector can be described as any of the variations disclosed herein.

[0086] As discussed below, the recombinant viral vector, along with the components required for packaging the recombinant viral particles, is transfected into packaging cells or cell lines. The recombinant viral particles, collected from the supernatant of the transfected cells, are used to infect target cells or organisms to express shRNA. The transduced cells or organisms are used for transient expression or selected for stable expression.

[0087] Virus / Virus Particle

[0088] Viral particles are used to deliver the encoding nucleotide sequence of shRNA targeting SNORD115 RNA. The terms virus and viral particle are used interchangeably throughout this document. Viral particles typically comprise various viral components and sometimes include host cell components in addition to one or more nucleic acids. Nucleic acid sequences can be packaged into viral particles that are capable of delivering the shRNA nucleic acid sequence to the target cells of patients in need.

[0089] Viral particles can be generated by: (a) introducing a viral expression vector into a suitable cell line; (b) culturing the cell line under suitable conditions to allow the generation of viral particles; (c) recovering the generated viral particles; and (d) optionally purifying the recovered infectious viral particles.

[0090] Expression vectors containing nucleotide sequences encoding one or more shRNAs described herein can be introduced into appropriate cell lines for proliferation or expression using well-known techniques readily available to those skilled in the art. These include, but are not limited to, microinjection of micro-sized amounts of DNA into the cell nucleus (Capechi et al., 1980, Cell 22, 479-488), CaPO4-mediated transfection (Chen and Okayama, 1987, Mol. Cell Biol. 7, 2745-2752), DEAE-glucan-mediated transfection, electroporation (Chu et al., 1987, Nucleic Acid Res. 15, 1311-1326), liposome transfection / liposome fusion (Feigner et al., 1987, Proc. Natl. Acad. Sci. USA 84, 7413-7417), particle bombardment (Yang et al., 1990, Proc. Natl. Acad. Sci. USA 87, 9568-9572), gene gun, transduction, infection (e.g., with infectious viral particles), and other techniques, such as those described in Sambrook et al. (Molecular...). Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001).

[0091] In embodiments where the expression vector is defective, the infectious particles can be generated in complementary cell lines or by using helper viruses that provide nonfunctional viral genes in trans form. Suitable cell lines for complementation with adenovirus vectors include 293 cells (Graham et al., 1997, J. Gen. Virol. 36, 59-72) and PER-C6 cells, commonly used for complementation with E1 function (Fallaux et al., 1998, Human Gene Ther. 9, 1909-1917). Other cell lines have been engineered to complement dual-deficient adenovirus vectors (Yeh et al., 1996, J.Virol. 70, 559-565; Krougliak and Graham, 1995, Human Gene Ther. 6, 1575-1586; Wang et al., 1995, Gene Ther. 2, 775-783; Lusky et al., 1998, J.Virol. 72, 2022-2033; WO94 / 28152 and WO97 / 04119). Infectious viral particles can be recovered from culture supernatant or from cells after lysis, and optionally further purified according to standard techniques (chromatography, ultracentrifugation in a cesium chloride gradient, such as those described in WO 96 / 27677, WO 98 / 00524, WO 98 / 22588, WO 98 / 26048, WO 00 / 40702, EP 1016700 and WO 00 / 50573).

[0092] In the implementation scheme, this document provides host cells that include the nucleic acid molecules, vectors, or infectious viral particles described herein. The term "host cell" should be interpreted broadly without any limitation regarding the tissues, organs, or isolated cells of a specific organism. Such cells can be a unique type of cell or a group of different types of cells, including cultured cell lines, primary cells, and proliferating cells.

[0093] Therefore, host cells include prokaryotic cells, lower eukaryotic cells such as yeast and other eukaryotic cells such as insect cells, plant cells and higher eukaryotic cells such as vertebrate cells, and mammalian (e.g., human or non-human) cells are particularly preferred. Suitable mammalian cells include, but are not limited to, hematopoietic cells (totipotent stem cells, leukocytes, lymphocytes, monocytes, macrophages, APCs, dendritic cells, non-human cells, etc.), lung cells, tracheal cells, hepatocytes, epithelial cells, endothelial cells, muscle (e.g., skeletal muscle, cardiac muscle, or smooth muscle) cells, or fibroblasts. For example, host cells may include *Escherichia coli*, *Bacillus*, *Listeria*, *Saccharomyces*, BHK (young hamster kidney) cells, MDCK (Madin-Darby canine kidney cell line), CRFK (Crandell cat kidney cell line), CV-1 (African monkey kidney cell line), COS (e.g., COS-7) cells, Chinese hamster ovary (CHO) cells, mouse NIH / 3T3 cells, HeLa cells, and Vero cells. Host cells also include complementary cells capable of complementing at least one defective function of a replication-defective vector (e.g., a defective adenovirus vector) available herein, such as those described above.

[0094] In this implementation, the host cell can be encapsulated. Cell encapsulation techniques have been previously described (Tresco et al., 1992, ASAJO J.38, 17-23; Aebischer et al., 1996, Human Gene Ther. 7, 851-860). For example, transfected or infected eukaryotic host cells can be encapsulated with compounds that form microporous membranes, and the encapsulated cells can be further implanted into the body. The capsule containing the cells of interest can be prepared using hollow microporous membranes (e.g., Akzo NobelFaser AG, Wuppertal, Germany; Deglon et al., 1996, Human Gene Ther. 7, 2135-2146) having a molecular weight cutoff value suitable for allowing proteins and nutrients to freely pass between the inside and outside of the capsule, while preventing contact between the implanted cells and the host cells.

[0095] The viral particles used in this study include AAV particles and lentiviral particles. AAV particles carry the coding sequence of the shRNA in this study in the form of genomic DNA. On the other hand, lentiviral particles belong to the retrovirus class and carry the coding sequence of the shRNA in this study in the form of RNA.

[0096] Recombinant engineered viral particles, such as AAV particles, artificial AAV particles, self-complementary AAV particles, and lentiviral particles, containing DNA (or RNA in the case of lentiviral particles) encoding shRNA targeting SNORD115 RNA, can be delivered to target cells to inhibit UBE3A-ATS silencing of UBE3A. The use of AAV is a common DNA delivery method because it is relatively non-toxic, provides efficient gene transfer, and can be easily optimized for specific purposes. In this embodiment, the selected AAV serotype is naturally neurotropic. In this embodiment, the AAV serotype is AAV9 or AAV10.

[0097] Suitable recombinant AAV can be produced by culturing host cells containing: a nucleotide sequence encoding the AAV serotype capsid protein or a fragment thereof, as defined herein; a functional rep gene; a small gene containing at least an AAV inverted terminal repeat (ITR) and encoding a nucleotide sequence; and sufficient helper functions to allow the small gene to be packaged into the AAV capsid protein. The components required for culturing in host cells to package the AAV small gene into the AAV capsid can be provided to the host cells in a trans configuration. Alternatively, any one or more of the desired components (e.g., the small gene, rep sequence, cap sequence, and / or helper functions) can be provided by stable host cells that have been engineered to contain one or more of the desired components using methods known to those skilled in the art.

[0098] Unless otherwise stated, the AAV inverted terminal repeat (ITR) sequences and other selected AAV components described herein can be readily selected from any AAV serotype, including but not limited to AAV1, AAV2, AAV3, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVRec3, or other known and unknown AAV serotypes. These ITRs or other AAV components can be readily isolated from AAV serotypes using techniques available to those skilled in the art. Such AAVs can be isolated or obtained from academic, commercial, or public sources (e.g., the U.S. Center for Type Culture Collection, Manassas, Va.). Alternatively, AAV sequences can be obtained by synthesis or other suitable means by referencing published sequences, such as those available in literature or databases such as GenBank, PubMed, etc.

[0099] The small gene, rep sequence, cap sequence, and accessory function required to generate the rAAV described herein can be delivered to the packaging host cell in the form of any genetic element carrying the sequence thereon. The selected genetic element can be delivered by any suitable method. Methods used to construct the embodiments described herein are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods for generating rAAV virions are well known, and the choice of suitable method is not limiting. See, for example, K. Fisher et al., 1993 J. Viral., 70:520-532 and U.S. Patent No. 5,478,745, etc. All citations herein are incorporated herein by reference.

[0100] The selection of these and other common vectors and regulatory elements is routine, and many such sequences are available. See, for example, Sambrook et al., and the references cited therein, e.g., pp. 3.18–3.26 and 16.17–16.27, and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989). Of course, not all vectors and expression control sequences will function equally well to express all the transgenes described herein. However, those skilled in the art can make selections among these and other expression control sequences.

[0101] Pharmaceutical compositions and therapeutic treatments

[0102] Viruses containing the desired shRNA coding sequence can be formulated for administration to patients or humans in need via any suitable method of administration. Such formulation includes the use of pharmaceutically and / or physiologically acceptable media or vectors, particularly those suitable for administration to the brain (e.g., via subcranial or spinal injection). Furthermore, more than one shRNA described herein can be administered in combination therapy. In combination therapy, different shRNAs can be administered simultaneously, separately, sequentially, and in any order.

[0103] The pharmaceutical compositions described herein comprise a carrier and / or diluent suitable for delivery to human or animal organisms by injection. Such carriers and / or diluents should generally be non-toxic at the dosage and concentration used. They may be selected from those commonly used to formulate compositions for parenteral administration in single or multiple doses or for direct infusion by continuous or periodic administration. In embodiments, it is isotonic, hypotonic, or weakly hypertonic and has a relatively low ionic strength, such as that provided by sugars, polyols, and isotonic saline solutions. Representative examples include sterile water, physiological saline (e.g., sodium chloride), antibacterial water, Ringer's solution, glucose or sucrose solution, Hank's solution, and other physiologically balanced saline solutions (see, for example, the latest edition of Remington: The Science and Practice of Pharmacy, A. Gennaro, Lippincott, Williams & Wilkins). The pH of the composition is appropriately adjusted and buffered to suit human or animal use, for example, at a physiological pH or a slightly alkaline pH (between about pH 8 and about pH 9, with pH 8.5 being particularly preferred). Suitable buffers include phosphate-buffered saline (e.g., PBS), bicarbonate buffer, and / or Tris buffer. In some embodiments, for example, the composition is formulated in 1 M sucrose, 150 mM NaCl, 1 mM MgCl2, 54 mg / L Tween 80, 10 mM Tris at pH 8.5. In other embodiments, for example, the composition is formulated in 10 mg / ml mannitol, 1 mg / ml HSA, 20 mM Tris (pH 7.2), and 150 mM NaCl. These compositions are stable at -70°C for at least 6 months.

[0104] The pharmaceutical compositions described herein can be in various forms, such as solids (e.g., powders, lyophilized forms) or liquids (e.g., aqueous). In the case of solid compositions, preparation methods include, for example, vacuum drying and lyophilization, which produce an active agent plus a powder of any additional desired components from its previously sterile filtered solution. If desired, such solutions can be stored in sterile ampoules, ready for reconstitution by adding sterile water for ready injection.

[0105] Nebulized or aerosolized formulations are also suitable. Methods of intranasal administration are well known in the art, including the application of the composition in drop, spray, or dry powder form from a pressurized container or dispenser (containing a suitable propellant, such as a gas like carbon dioxide) or nebulizer (see, for example, WO 95 / 11664) into the nasopharynx of the individual to be treated. Enteric-coated formulations such as gastric-tolerant capsules and granules for oral administration, and suppositories for rectal or vaginal administration, may also be suitable. For non-parenteral administration, the composition may also include absorption enhancers that increase mucosal pore size. Such absorption enhancers include sodium deoxycholate, sodium glycocholate, dimethyl-β-cyclodextrin, lauroyl-1-lysophosphatidylcholine, and other substances with structural similarity to the phospholipid domains of the mucosa.

[0106] The composition may also contain other pharmaceutically acceptable excipients to provide desired pharmaceutical or pharmacokinetic properties, including, for example, altering or maintaining the pH, osmotic pressure, viscosity, transparency, color, sterility, stability, and dissolution rate of the formulation, and altering or maintaining release or absorption into human or animal organisms. For example, polymers such as polyethylene glycol can be used to obtain desired solubility, stability, half-life, and other pharmaceutically advantageous properties (Davis et al., 1978, Enzyme Eng. 4, 169-173; Burnham et al., 1994, Am. J. Hosp. Pharm. 51, 210-218). Representative examples of stabilizing components include polysorbate 80, L-arginine, polyvinylpyrrolidone, trehalose, and combinations thereof. Other stabilizing components particularly suitable for plasmid-based compositions include hyaluronidase (as described in WO 98 / 53853, which is believed to destabilize the extracellular matrix of host cells), chloroquine, protonated compounds such as propylene glycol, polyethylene glycol, glycerol, ethanol, 1-methyl-L-2-pyrrolidone or their derivatives, aprotonated compounds such as dimethyl sulfoxide (DMSO), diethyl sulfoxide, di-n-propyl sulfoxide, dimethyl sulfone, sulfolane, dimethylformamide, dimethylacetamide, tetramethylurea, acetonitrile (see EP 890362), nuclease inhibitors such as actin G (WO 99 / 56784), and cationic salts such as magnesium (Mg). 2+ (EP 998 945) and lithium (Li +(WO 01 / 47563), and any derivatives thereof. The amount of cationic salt in the compositions herein preferably ranges from about 0.1 mM to about 100 mM, and still more preferably from about 0.1 mM to about 10 mM. Viscosity enhancers include sodium carboxymethyl cellulose, sorbitol, and dextrose. The compositions may also contain substances known in the art that promote permeation or transport across the blood barrier or membrane of a particular organ (e.g., antibodies against transferrin receptors; Friden et al., 1993, Science 259, 373-377). A gel complex of polylysine and lactose (Midoux et al., 1993, Nucleic Acid Res. 21, 871-878) or poloxamer 407 (Pastore, 1994, Circulation 90, 1-517) may be used to promote administration to arterial cells.

[0107] Viral particles and pharmaceutical compositions can be administered to patients in therapeutically effective amounts. As used herein, the term "therapeutically effective amount" refers to an amount sufficient to achieve the desired biological effect. For example, a therapeutically effective amount for treating Happy Puppet syndrome is an amount sufficient to improve one or more symptoms of Happy Puppet syndrome as described herein (e.g., developmental delay, severe cognitive impairment, ataxia gait, frequent seizures, short attention span, speech deficits, and characteristic happy behavior). Furthermore, AS iPSC-derived neurons or AS hESC-derived neurons exhibit depolarized resting membrane potentials, delayed action potential development, and reduced spontaneous synaptic activity. Therefore, a therapeutically effective amount for treating AS can restore the neuronal resting membrane potential to approximately -70 mV, improve delayed action potential development, increase spontaneous synaptic activity, or improve other neuronal phenotypic changes related to base strength, action potential characteristics (e.g., shape), membrane current, synaptic potentials, ion channel conductance, etc.

[0108] Appropriate dosages can vary based on known factors such as the pharmacokinetic characteristics of the specific active agent, the age, health, and weight of the host organism; one or more conditions to be treated, the nature and severity of symptoms, the types of concurrent treatments, the frequency of treatment, the need for prevention or treatment, and / or the desired effect. Dosage is also calculated based on the specific route of administration chosen. Practitioners can further refine the calculations required to determine the appropriate dosage for treatment based on relevant circumstances. As a general guideline, virus-particle-based compositions can be, for example, at least 10 5The composition can be formulated in doses of one viral genome / cell. The titer can be determined using conventional techniques. Vector-based plasmid compositions can be formulated in doses between 1 μg and 100 mg, for example, between 10 μg and 10 mg, or between 100 μg and 1 mg. Administration can be administered as a single dose or as one or more doses repeated at intervals.

[0109] The pharmaceutical compositions described herein may be encapsulated in ampoules, disposable syringes, or multi-dose vials made of glass or plastic. In all cases, the composition shall be sterile and flowable to the extent that it is readily injectable. It shall be stable under the conditions of manufacture and storage and protected against contamination by microorganisms such as bacteria and fungi. Sterile injectable solutions may be prepared by incorporating an active agent (e.g., infectious granules) in the required amount into one or a combination of the ingredients listed above, followed by filtration and sterilization.

[0110] The viral particles and pharmaceutical compositions described herein can be administered via parenteral routes, including intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion, intrathecal, or intracranial (e.g., intracerebral or intraventricular) administration. In some embodiments, the viral particles or pharmaceutical compositions are administered intracerebrally or intraventricularly. In some embodiments, the viral particles or pharmaceutical compositions described herein are administered intrathecally.

[0111] In the implementation scheme, the viral particles and pharmaceutical composition described above are administered to a subject via subcranial injection into the brain or spinal cord of a patient or human in need. In this implementation scheme, subcranial administration to the brain results in the direct delivery of the encoded nucleotide sequences described herein to brain cells, including glial cells and neurons. As used herein, the term "neuron" means any cell in the brain or any cell associated with brain function. The term can refer to any type of neuron, including unipolar, bipolar, multipolar, and pseudounipolar. Example

[0112] shRNA vector production and lentivirus preparation

[0113] Oligonucleotides encoding shRNA were cloned into the pLKO.1-puro vector, which drives small RNA expression via the U6 promoter (Addgene plasmid #8453). Specifically, the polynucleotide generating shRNA contained a specific 21-nucleotide sequence to be targeted and its inverse complementary sequence, separated by a loop sequence CTCGAG, with 5' flanking sequences CCGG and 3' flanking sequences TTTTTG added for cloning into the plasmid vector. The following oligonucleotides encoding shRNA and scrambled shRNA controls were used:

[0114] SNORD115 shRNA 1 (SEQ ID NO:382):

[0115]

[0116] SNORD115 shRNA 2 (SEQ ID NO:383):

[0117]

[0118] SNORD115 shRNA 3 (SEQ ID NO:3):

[0119]

[0120] Clones were validated by Sanger sequencing. Lentiviral particles were generated from cloned shRNA in HEK293T cells using second-generation lentiviral packaging plasmids (psPAX2, Addgene plasmid #12260; pMD2.G, Addgene plasmid #12259) and concentrated using a Lenti-X Concentration Kit (Takara). Lentiviral titers were estimated using a qPCR kit for detecting the 5' LTR (Applied Biological Materials).

[0121] Stem cell culture and neuronal differentiation

[0122] Happy Puppet Syndrome (AS) human embryonic stem cells (hESCs) were maintained on Matrigel-coated substrates (Corning) in mTeSR-plus medium (Stem Cell Technologies) without a feeder layer. hESCs were cultured in a humidified incubator at 37°C and 5% CO2. Cells were fed daily and passaged every 4–5 days with 0.5 mM EDTA. Glutamate neurons were generated from hESCs by doxycycline-induced expression via a human neuron 2 (NGN2) transgene (Fernandopulle et al., 2018, Curr Protoc Cell Biol. 79(1):e51.). Briefly, doxycycline-induced NGN2 constructs were stably integrated into the safe harbor AAVS1 locus of AS hESCs using a pair of TALENs targeting AAVS1, and clonal cell lines were subsequently derived. Neuronal induction was then performed by culturing these hESCs for three days in a neuroinduction medium consisting of DMEM / F12, N2 supplement, non-essential amino acids (NEAA), L-glutamine (all Gibco products), and 2 μg / mL doxycycline. Neurons were then seeded into a cortical neuron medium consisting of DMEM / F12, Neurobasal medium, B27 supplement, penicillin / streptomycin (both Gibco products), BDNF (10 ng / mL), GDNF (10 ng / mL), NT-3 (10 ng / mL), and laminin (1 μg / mL) for terminal maturation. Human hESC-derived NGN2-induced neurons (7–10 days post-induction) were transduced with lentiviral particles at a MOI of 10.

[0123] Quantitative RT-PCR (qRT-PCR) analysis

[0124] Neurons were collected 7 days after viral transduction for RNA isolation and qRT-PCR. Total RNA was isolated from hESC-derived neurons using RNA-STAT60 (AMS Biotechnology) according to the manufacturer's protocol. cDNA was generated using a high-capacity cDNA reverse transcription kit (Life Technologies). Gene expression analysis was performed in at least triplicate. All qPCR assays used were TaqMan gene expression assays (Life Technologies). Ct values ​​for each gene were normalized against the housekeeping gene GAPDH. Relative expression was quantified relative to the calibrator sample at 2^(- ... -ΔΔCt .

[0125] Data summary and results

[0126] AS hESC-derived neurons were transduced with lentiviral particles to express selected shRNA sequences targeting the long non-coding RNA of SNHG14. qRT-PCR was used to determine the expression of UBE3A-ATS, the SNORD115 host gene, and UBE3A in SNHG14-shRNA-treated neurons compared to neurons treated with untargeted control shRNA (scrambled). Figure 4 This study presents qRT-PCR analysis of AS hESC-derived neurons treated with shRNAs targeting SNHG14 (SNORD115 shRNA1, SNORD115 shRNA2, SNORD115 shRNA3) or untargeted control shRNAs (scrambled). Expression of UBE3A-ATS, UBE3A, and SNORD115 was normalized to the housekeeping gene GAPDH and presented relative to neurons treated with scrambled shRNAs. Error bars represent the standard error of the mean, with n = 3 biological replicates. Figure 4 As shown, compared to the scrambled control, SNORD115 shRNA3 effectively reduced the RNA levels of UBE3A-ATS (by 40%) and SNORD115 (by 55%). This reduction in SNHG14 transcript levels was associated with a robust increase in UBE3A RNA (2.8-fold increase compared to the scrambled control). Although SNORD115 shRNA1 and SNORD115 shRNA2 were predicted to reduce the RNA levels of UBE3A-ATS and SNORD115 and increase UBE3A expression, they did not have this effect.

[0127] It should be understood that the foregoing detailed description and appended examples are illustrative only and should not be considered as limiting the scope of the subject matter described herein, which is defined only by the appended claims and their equivalents. Various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications may be made without departing from the spirit and scope of the invention, including, but not limited to, those relating to chemical structure, substituents, derivatives, intermediates, synthesis, compositions, formulations, or methods of use.

[0128] sequence

[0129] SEQ ID NO:1

[0130] Human UBE3A-ATS genome sequence.

[0131]

[0132] SEQ ID NO:2

[0133] Human SNORD115 locus sequence.

[0134]

[0135] TTAGAAGTTTATTTAGAAGTGGATTTTGCCAAGGTTAAGCACATGCTCAGAAGAAATAAACCCAAAATCACAGAAA

[0136] CCGTCTGGGGTCTATGTCTTTCTCCCAAAGATGATTTTGAGGGCTTCAGTGTTTAAAGGGGAAAAGTGGGGCTGGAGG

[0137] GGGAAAAGGGAGGGTATGATAATCCGTATGTTCCAAGACAAAAGGAGCAGGTAGGGGTATAGTCAATAATGTATTC

[0138] ATCTCATGCTCAGTAAATCAGCACTTTACATAAGATAAGGTGAACATAGAGAAGCTACCTGTGGAGATCTTTAACC

[0139] TTTAATCTGTAGCTATCTGCTTAAGATCAAAAGGAAATTCTTGCATGACTCAGCTTTCAGCTTATTTTTTTTTTCT

[0140] CTTGGCGTAGTAAATTGGGGTCCCAAGTTTATTTTCCTTTCACACATGTGACCCCACTATTTTCAGAATAATGAAA

[0141] GCACATGTTAGAAATGATGACACTTATTCCTAATATGGACTTTGAAATGACTGGGTTCACAAATTTAGAATCATGG

[0142] ATCTCATTATAGGTTTTTATTTTCAATGAGTGACTGGCCTACTTGATGGAATTCTTTCAAAAAATGTTCACTTTTT

[0143] ACTGAGATTATATTAAAATAATGTTGGAATGTGTTCAGTCATGTTTACCATCTCTATAGTATGATATATGATAATA

[0144] TCGCAGATTACTCAGTGTCAAAAACCTGGCATACCTTGTCCTTATGATGTTGATGAGTCAATGGTCTAGAGCCTTA

[0145] GTAATATGTCTTTTTGTGGTAGTACGGACCGTATCTGTCCACTAAGAAATAGCCTGTGTAAGCCATATACACATGA

[0146] ACAATTTATGTCTGATTTTGAACTATGGTCCCATTCCTATGCCTGTAGATAAAGACTGCTGAGAAGAGCACCCTCT

[0147] GGTGTTGTCACAGAGGCAAGTGCTACCGCACAGGCATGCTGCAGTGAATTTAACTGATCCTCTTGTCCCTGCAACCG

[0148] TTGTTTAAGGATGCTATTCTGGTAAGGGTTTACAAGACAACGTAAATATATGTATAAAGAGTATCTTCAGGAGACG

[0149] TAATAATGTAAAAATCATGCTCAATAGAATTAAGCTGAGGCTCAAAATAGTGCCAATCCTTGCAAGAAGGTGTGAG

[0150] AAGTCATTAGATTTGGGGGGTATGGGTTTATTCCATTTTGAACTTGGTAGGAAGAAACCCTTGGGGGAATCTTACAT

[0151] CATTTGCCTCTACCTACTTCTAAAGGAACTTTTAAAATTCTTTTATCTTGTCTTTATTCTTAATACTCATACATTA

[0152] TTAGAGAGAATATCTTGGTTTATTTTTTTCCTCATGGTGTGCTTCAGAATGTTCATCCAGCAAGAGGTGTGTCATTA

[0153] CACGGATTATATATATGAGTTCTGTCTTTCGTAATTAAAAAATTTCAAGTGGACCATTTGAATATTAAACATTGGC

[0154] CTTCAAAATGATTACATTTACCTGTTCATACAAAATTAGTGAGCAATGATCTATTCTTTCCAATGAGTGACTGATC

[0155] TAATGAGGTCCTCATTAAAACTCCTTTTTTTTTTTTTTTTTTTTTTTTGCCTGAACGTACTTTGATTTAAAGATGTGA

[0156] CATTTAGTAATTCATTGCAATCAACTCTTTAGTGATTGCACAAATAGACAATCCTTTTCTATTATTTTATTTTTTG

[0157] GTTGCTGTGTATGGTGTTATGATGTTTGTGGATCATTGAGGCACTACTCACAACTGAAAGACTTTGGCAATTTTAG

[0158] GGAATGGCTTGAGATTCAGCTATAGGTTACCCTTGATTGAAATTGAATACAATACAGGTAGTCTGAAATCTCATTT

[0159] CCTTATCCTGAGTCTCACTCAGGTGTCATTAGATTCATTATAAAGAAATGCATACACTATGTATGATGCCAGTTGT

[0160] TACTGATATGAAGACGATAAGAAGCTTTTATTTCTGCAGGGAAATAATCCCTTACCAGGTCATCAAAAGACATGAT

[0161] ACCTATGTGCTTGGCCCTTACTGTACACGGGGAATCAGTGGTCTACCACAGCTTAAGTAACGGGTCATATTTGGAG

[0162] TATCACACATCTCAGTCTTGTAGAAATTAGGAACAGCAATTAGGAGTCATGCACATATAAGAGATGTAATCCCACC

[0163] CTTTGACTATAGCCTACTCTTGTCTTTTACAGAAAAGACTGTGGAGGAAGAAAACCCTTTACCCTGTTGTTCAGGG

[0164] AGAAACTGACACCACTCAACTGCCTGGCACTGAAAATGTGGCATCCAGTCCACTTTACCATCAGTGTTTAAGGAAA

[0165] CCATCTCTGGTAAGCATATTTGATCCAAGTGTGCATATGCACATGAGTGCCATGGGCTGGGTCAATGATGAGATGT

[0166] TACCTTGAAGAGAAATGATGACGTAAAAATTAAGTTCAGTTGGATTACGCTGAGGCCC

[0167] SEQ ID NO:3

[0168] shRNA artificial / synthetic sequence.

[0169]

[0170] SEQ ID NO:4

[0171] SNORD115-1 Human Genome Sequence

[0172] GTGTTGATGAGAACCTTATATTATCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCC

[0173] SEQ ID NO:5

[0174] SNORD115-5 Human Genome Sequence

[0175] GGATCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCC

[0176] SEQ ID NO:6

[0177] SNORD115-9 Human Genome Sequence

[0178] GGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCC

[0179] SEQ ID NO:7

[0180] SNORD115-10 Human Genome Sequence

[0181] GGGTCGATGATGAGAACCTTATATTGTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCC

[0182] SEQ ID NO:8

[0183] SNORD115-12 Human Genome Sequence

[0184] GGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCC

[0185] SEQ ID NO:9

[0186] SNORD115-13 Human Genome Sequence

[0187] GGGTCGATGATGAGAACCTTATATTATCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCC

[0188] SEQ ID NO:10

[0189] SNORD115-17 Human Genome Sequence

[0190] GGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATTCTCAAAAGGATTATGCTGAGGCCC

[0191] SEQ ID NO:11

[0192] SNORD115-18 Human Genome Sequence

[0193] GGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATTCTCAAAAGGATTATGCTGAGGCCC

[0194] SEQ ID NO:12

[0195] SNORD115-19 Human Genome Sequence

[0196] GGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATTCTCAAAAGGATTATGCTGAGGCCC

[0197] SEQ ID NO:13

[0198] SNORD115-20 Human Genome Sequence

[0199] GGGTCGATGATGAGAACCTTATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTATGCTGAGGCCC

[0200] SEQ ID NO:14

[0201] SNORD115-21 Human Genome Sequence

[0202] GGGTCGATGATGAGAACCTTATATTTTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCC

[0203] SEQ ID NO:15

[0204] SNORD115-27 Human Genome Sequence

[0205] GGGCTGATGATGAGAACCTTATATTGTCCTGAAAAGAGGTGATGACTTAACAATCATGCTCAATAGGATTACATTGAAGCCC

[0206] SEQ ID NO:16

[0207] SNORD115-37 Human Genome Sequence

[0208] GGGCTGATGATGAGAACCTTATATTGTCCTGAAAAAAGGTGATGACTTAAACATCATGCTTAATAGTATTATGCTGAAGCCC

[0209] SEQ ID NO:17

[0210] SNORD115-40 Human Genome Sequence

[0211] GGGTCGATGATGAGAACCTTATATTTTTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCC

[0212] SEQ ID NO:18

[0213] SNORD115-42 Human Genome Sequence

[0214] GGGTCGATGATGAGAACCTTATATTGTTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCC

[0215] SEQ ID NO:19-360

[0216] SNORD115 artificial / synthetic sequence

[0217] 19.CAATGATGAGAACCGTATATT

[0218] 20.GGTAACCTGTTCTCCAAATTT

[0219] 21.TGATGATGAGAACCTTATATT

[0220] 22.GCCTTCACCTCTACCTATTAT

[0221] 23.CCTTCACCTCTACCTATTATA

[0222] 24.CTTCACCTCTACCTATTATAA

[0223] 25.TTCACCTCTACCTATTATAAT

[0224] 26.TCACCTCTACCTATTATAATA

[0225] 27.CACCTCTACCTATTATAATAT

[0226] 28.GATACAGCTTCCTTGAATATA

[0227] 29.ATACAGCTTCCTTGAATATAT

[0228] 30.TACAGCTTCCTTGAATATATA

[0229] 31.ACAGCTTCCTTGAATATATAA

[0230] 32.CAGCTTCCTTGAATATATAAA

[0231] 33.CTGTATGATTTGTCCTTATTA

[0232] 34.AGCACCCAGGTGTCCTTTAAT

[0233] 35.TTCTGATTTGGTGAGAAATAA

[0234] 36.TCTGATTTGGTGAGAAATAAT

[0235] 37.CTGTATCAGTGCACCTATAAA

[0236] 38.TGTATCAGTGCACCTATAAAT

[0237] 39.TTTGCTTCAGTGACCTTTAAT

[0238] 40.TTGCTTCAGTGACCTTTAATT

[0239] 41.TGCTTCAGTGACCTTTAATTT

[0240] 42.AGAGATGTGCCATTCTATTAT

[0241] 43.GAGATGTGCCATTCTATTATA

[0242] 44.AGATGTGCCATTCTATTATAA

[0243] 45.GATGTGCCATTCTATTATAAA

[0244] 46.TCCTTTACCGACGTGTATATT

[0245] 47.ACTGTTACCTAGTCCAATATT

[0246] 48.CTGTTACCTAGTCCAATATTT

[0247] 49.TGTTACCTAGTCCAATATTTA

[0248] 50.GTTACCTAGTCCAATATTTAA

[0249] 51.AGTATGTACTTTGCCTATAAA

[0250] 52.GCACATGCTCAGAAGAAATAA

[0251] 53.CACATGCTCAGAAGAAATAAA

[0252] 54.TTGAGGGCTTCAGTGTTTAAA

[0253] 55.TGGAGATCTTTAACCTTTAAT

[0254] 56.GACTCAGCTTTCAGCTTATTT

[0255] 57.TTTCTCTTGGCGTAGTAAATT

[0256] 58.GATGACACTTATTCCTAATAT

[0257] 59.ATGACTGGGTTCACAAATTTA

[0258] 60.AGAATCATGGATCTCATTATA

[0259] 61.GGTCTAGAGCCTTAGTAATAT

[0260] 62.AGGCATGCTGCAGTGAATTTA

[0261] 63.GGCATGCTGCAGTGAATTTAA

[0262] 64.TATCTTCAGGAGACGTAATAA

[0263] 65.ATCTTCAGGAGACGTAATAAT

[0264] 66.GAGAGAATATCTTGGTTTATT

[0265] 67.TGTGTCATTACACGGATTATA

[0266] 68.GTGTCATTACACGGATTATAT

[0267] 69.TGTCATTACACGGATTATATA

[0268] 70.GTCATTACACGGATTATATAT

[0269] 71.GAGTTCTGTCTTTCGTAATTA

[0270] 72.AGTTCTGTCTTTCGTAATTAA

[0271] 73.GTTCTGTCTTTCGTAATTAAA

[0272] 74.CAAGTGGACCATTTGAATATT

[0273] 75.AGTGGACCATTTGAATATTAA

[0274] 76.GTGGACCATTTGAATATTAAA

[0275] 77.CCTGAACGTACTTTGATTTAA

[0276] 78.CTGAACGTACTTTGATTTAAA

[0277] 79.GGTGTCATTAGATTCATTATA

[0278] 80.CTTAAGTAACGGGTCATATTT

[0279] 81.ATCTCAGTCTTGTAGAAATTA

[0280] 82.TTAGGAGTCATGCACATATAA

[0281] 83.CCATCTCTGGTAAGCATATTT

[0282] 84.GTTTCCTACAATTCCTAATTT

[0283] 85.GTGAAGACTGAGCTCTATAAT

[0284] 86.TGAAGACTGAGCTCTATAATA

[0285] 87.GAAGACTGAGCTCTATAATAA

[0286] 88.AGACTGAGCTCTATAATATT

[0287] 89.GACTGAGCTCTATAATTA

[0288] 90.ACAGTTATTCGTGGTCTAAATA

[0289] 91.CAGTTATCGTGGTCTAAATAT

[0290] 92.AGTTATTCGTGGTCTAAATATA

[0291] 93.TGCCCATGAAACTTGAAATTA

[0292] 94.GAATAATGCCAATGGTAAATA

[0293] 95.GACCTTTATGGACACTTATAT

[0294] 96.CTACAAGAGGGAAACTTTATT

[0295] 97.TACAAGAGGGAAACTTTATTT

[0296] 98.GATGCTCATTTGGTCTAAATA

[0297] 99.ATGCTCATTTGGTCTAAATAT

[0298] 100.TGCTCATTTGGTCTAAATATA

[0299] 101.CATATCCCCATCATTCATTAAA

[0300] 102.GGCTCCAGTATGATCATTATA

[0301] 103.GCTCCAGTATGATCATTATAT

[0302] 104.GATCAATTGAAGGTCTTATTT

[0303] 105.AGGTCTTATTTCTGCATTAAA

[0304] 106.CCTGTATAGTTAGTCTTTATT

[0305] 107.CATACATACAGGAGGTAATAT

[0306] 108.ATACATACAGGAGGTAATATT

[0307] 109.TACATACAGGAGGTAATATTT

[0308] 110.GAACTTTCAACCAGGATTAA

[0309] 111.TGGCTGAAACCTCCCATATTT

[0310] 112.AGCAAAGGCATAACATATTAA

[0311] 113.GCAAAGGCATAACATTAAA

[0312] 114.GACTACAGATGGTAGATTAAT

[0313] 115.ACTACAGATGGTAGATTAATA

[0314] 116.CTACAGATGGTAGATTAATAT

[0315] 117.TTGGCTTATAGCATCAATAAA

[0316] 118.TGGCTTATAGCATCAATAAAT

[0317] 119.TTTGGGTGAGTTAAGATATAT

[0318] 120.GAGAAAGAATGACATAATA

[0319] 121.TATCTCATTCACCCATATAT

[0320] 122.ATCTCATTTCACCCATATA

[0321] 123.TCTCATTCACCCATATATAT

[0322] 124.GGGTATGGATGGGACAAATAT

[0323] 125.CCCTGAAATAACAGCATTAAT

[0324] 126.ATTTGACCATTCCCAATTATA

[0325] 127.TGGATGTAAGAACACTATTAA

[0326] 128.ATAGCAGAATGCACATTATAT

[0327] 129.TAGCAGAATGCACATTATATT

[0328] 130.AGTGCTCATAAAGCATTATTT

[0329] 131.AGAGTGCCTATGTAGTTAATA

[0330] 132.GAGTGCCTATGTAGTTAATAT

[0331] 133.AGTGCCTATGTAGTTAATATT

[0332] 134.GTGCCTATGTAGTTAATATTT

[0333] 135.ACCACAGGCTTCTCAATTATT

[0334] 136.CCACAGGCTTCTCAATTATTA

[0335] 137.CACAGGCTTCTCAATTATTAA

[0336] 138.ACAGGCTTCTCAATTATTAAT

[0337] 139.CAGGCTTCTCAATTATTAATT

[0338] 140.TCCTCTAGAACTGCCTTTAAA

[0339] 141.CCTCTAGAACTGCCTTTAAAT

[0340] 142.ACTGCCTTTAAATGCATATTA

[0341] 143.TCAGGAGTTAATAGGATATTT

[0342] 144.ACAACACAGATCTTCTATTAT

[0343] 145.ACGGCACACCAGGAGATTATA

[0344] 146.CGGCACACCAGGAGATTATAT

[0345] 147.AGACAGGCTGCCTCCTTAAAT

[0346] 148.CATTTGCCGTTCTGCAATATT

[0347] 149.ATTTGCCGTTCTGCAATATTT

[0348] 150.GCTTCAGATGATCGCTAATAA

[0349] 151.TGAGTGGCTAACTAGAATAAA

[0350] 152.AGCATAGAGAAGACCTTAAAT

[0351] 153.GTAACTCCAAGACACATAATT

[0352] 154.GCCAAACTAAGCTTCATAATT

[0353] 155.TGGGCTAAATTCTCCAATTAA

[0354] 156.GGGCTAAATTCTCCAATTAAA

[0355] 157.ACACACATAGGCTCCAAATAA

[0356] 158.CACACATAGGCTCCAAATAAA

[0357] 159.TCTGATGAAACAGACTTTAAA

[0358] 160.AGAGCTAACTATCCTAAATAT

[0359] 161.GAGCTAACTATCCTAAATATA

[0360] 162.CTTAGACTCCCACACAATAAT

[0361] 163.TTAGACTCCCACACAATAATA

[0362] 164.TAGACTCCCACACAATAATAA

[0363] 165.AGACTCCCACACAATAATAAT

[0364] 166.ATGAAATGAAGGCAGAATAA

[0365] 167.TGAAATGAAGGCAGAAATAAA

[0366] 168.CAGAATCTCTGGGACATATTT

[0367] 169.AGAATCTCTGGGACATTTA

[0368] 170.GAATCTCTGGGACATATTTAA

[0369] 171.GCAGTGTGTAGAGAGAAATTT

[0370] 172.CAGTGTGTAGAGAGAAATTTA

[0371] 173.AGTGTGTAGAGAGAAATTTAT

[0372] 174.GTGTGTGAGAGAAATTTATA

[0373] 175.ACACCCTAAACTCACAATTAA

[0374] 176.CACCCTAACATCACAATTAA

[0375] 177.CTAGCAGAAGGCAGGAAAAA

[0376] 178.GACCACTAGCAAGACTAATAA

[0377] 179.ACCACTAGCAAGACTAATAAA

[0378] 180.GAATCCAATAGATGCAAATAAA

[0379] 181.ACCATCAGAGAATACTATAAA

[0380] 182.CTCTGAAATTGAGGCAATAAT

[0381] 183.TCTGAAATTGAGGCAATAATT

[0382] 184.CTGAAATTGAGGCAATAATTA

[0383] 185.TCAGGCAGGAGAAAGAAATAA

[0384] 186.CAGGCAGGAGAAAGAAATAAA

[0385] 187.CAGATGACATGATTGTATATT

[0386] 188.ACCACTGCTCAACGAAATAAA

[0387] 189.CCATACTGCCCAAGGTAATTT

[0388] 190.CATACTGCCCAAGGTAATTTA

[0389] 191.ATACTGCCCAAGGTAATTTAT

[0390] 192.TACTGCCCAAGGTAATTTATA

[0391] 193.GGAAAGGATTCCCTATTTAAT

[0392] 194.GAAAGGATTCCCTATTTAATA

[0393] 195.GTTAGAATGGCAATCATTAAA

[0394] 196.GTACATACCCAAAGGATTATA

[0395] 197.TACATACCCAAAGGATTATAT

[0396] 198.ACATACCCAAAGGATTATATA

[0397] 199.CATACCCAAAGGATTATATAT

[0398] 200.CACGAAGTAGGACAGTATAAT

[0399] 201.ACGAAGTAGGACAGTATAATT

[0400] 202.CGAAGTAGGACAGTATAATTT

[0401] 203.ACCACCATGCCTGGCTAATTT

[0402] 204.TTAAGAACAAGACCCAAATAT

[0403] 205.TAGAAACAAGACCCCAAATATA

[0404] 206.CTATGAGAAATGCACTTTAAA

[0405] 207.ATATCCCATGCTAACATTAAT

[0406] 208.GACTTTAGAACAAGGAATATT

[0407] 209.ATGCACCTCAACAAATTTAAA

[0408] 210.CACAGAAGTCTCAAAGATAAAT

[0409] 211.ACAGAAGTCTCAAGATAAATT

[0410] 212.CAGAAGTCTCAAGATAAATTT

[0411] 213.GCAGTGCCTACTGGGAAATTT

[0412] 214.CAGTGCCTACTGGGAAATTTA

[0413] 215.AGTGCCTACTGGGAAATTTAT

[0414] 216.GTGCCTACTGGGAAATTTATA

[0415] 217.TGCTGCACCCAGGGCAATTTA

[0416] 218.GCTGCACCAGGGCAATTTAT

[0417] 219.CTGCACCCAGGGCAATTTATA

[0418] 220.CTCTGATAAGCATGCTAATAT

[0419] 221.GGCAATATGGAGATGTTATAT

[0420] 222.AGATGCAATCATCCCATTAAT

[0421] 223.ATTCTCTCTTAAGGCTATTAT

[0422] 224.TGTTCACTTGGGTACATATAT

[0423] 225.GTTCACTTGGGTACATATATA

[0424] 226.CATGCCAGTGGACACAAATAT

[0425] 227.TATGGCTTCCTCATGATTAAA

[0426] 228.GCTACCATTCCTGGCTAATTT

[0427] 229.TGCTGGCACAAGAACTTTATA

[0428] 230.CCACATACCCTAAAGAATTAT

[0429] 231.CACATACCCTAAAGAATTATT

[0430] 232.CTTACCATCCGTTTCATTTAA

[0431] 233.TTACCATCCGTTTCATTTAAA

[0432] 234.TTTAGGACCTTAAGGATAAAT

[0433] 235.TTAGGACCTTAAGGATAAATT

[0434] 236.CTCACCAACTGGATGATTTAA

[0435] 237.TCACCAACTGGATGATTTAAA

[0436] 238.CACCAACTGGATGATTTAAAT

[0437] 239.ACCAACTGGATGATTTAAATT

[0438] 240.TCCCACTGATTAGTCAATATT

[0439] 241.CCCACTGATTAGTCAATATTA

[0440] 242.GATACTGATGAGAAGAAATTT

[0441] 243.TCCTGAGTAGCTGGGATTATA

[0442] 244.ACCACCATGCCTGGCTAATTT

[0443] 245.GCCCAACTCTAGATCTTAAAT

[0444] 246.CCCAACTCTAGATCTTAAATA

[0445] 247.CATACCTGGCCAGAGATTATT

[0446] 248.ATACCTGGCCAGAGATTATTA

[0447] 249.ACCTGGCCAGAGATTATTAAA

[0448] 250.CCTGGCCAGAGATTATTAAAT

[0449] 251.CTGGCCAGAGATTATTAAATA

[0450] 252.GAATTGGACATCTGGTAATAA

[0451] 253.GTACTGAAGTACAAGATTATA

[0452] 254.ACTGTCTATGTAGAGATTAAA

[0453] 255.CTGTCTATGTAGAGATTAAAT

[0454] 256.TGGCATTGCAGATTGAAATTT

[0455] 257.TCAATTTCTAAGCCCATTATA

[0456] 258.CAATTTCTAAGCCCATTATAT

[0457] 259.TGGTATGACAGTTTCAAATAA

[0458] 260.ACCCACTGAACTAGGAAATAT

[0459] 261.CCCACTGAACTAGGAAATATT

[0460] 262.AGACTAACATCTCTGTAATAT

[0461] 263.GACTAACATCTCTGTAATATA

[0462] 264.TGCGGAAAGGCAACCATAAAT

[0463] 265.GCGGAAAGGCAACCATAAATA

[0464] 266.CGGAAAGGCAACCATAAATAT

[0465] 267.GGAAAGGCAACCATAAATATA

[0466] 268.TTGTATTGCACACCCATTAAA

[0467] 269.TGGTGTGCAGGCAGGTTTATT

[0468] 270.TGGGAGACTAACTACTAATTA

[0469] 271.GGGAGACTAACTACTAATTAA

[0470] 272.TTCAAGTGTCAACTGTATATA

[0471] 273.TCAAGTGTCAACTGTATATAT

[0472] 274.TATGATTAGCAGCTGAATTTA

[0473] 275.ATGATTAGCAGCTGAATTTAA

[0474] 276.TAGAAATGAGCTACGTAATTT

[0475] 277.GCAAAGAATGAGCAGTTAATA

[0476] 278.TTTCATGTACTTCCGTATATT

[0477] 279.TTACTTCTCTGAGGGATTTAT

[0478] 280.TACTTCTCTGAGGGATTTATT

[0479] 281.CTGTCCAGGACATCCATTAAA

[0480] 282.TGTCCAGGACATCCATTAAAT

[0481] 283.GTCCAGGACATCCATTAAATT

[0482] 284.TAAGAGCTGACGCCCAAATTA

[0483] 285.TTGATGATGAGAACCTTATAT

[0484] 286.GATGATGAGAACCTATATTA

[0485] 287.CATGCTTCACAAGGCAATAAA

[0486] 288.TCGGGAGACCAGGGCTTATTT

[0487] 289.TGACGGGGATTAAGAGATTAAA

[0488] 290.AGACAGGCATAGGAAATAATA

[0489] 291.GACAGGCATAGGAAATAATAA

[0490] 292.TTGATTTGGGAAAGTGATAAAT

[0491] 293.TCAATGATGAGAACCTTATAT

[0492] 294.CAATGATGAGAACCTATATT

[0493] 295.GTCGATGATGAGAAACTTTATA

[0494] 296.TCGATGATGAGAACTTTATAT

[0495] 297.CGATGATGAGACTTATATT

[0496] 298.TCGATGATGAGAACCTTATAT

[0497] 299.CGATGATGAGAACCTTATATT

[0498] 300.CCCAGCATGGCCAGTATATTT

[0499] 301.CAAGAATCGCACACGAATTAT

[0500] 302.GGGTCAATGAGAACCTTATAT

[0501] 303.GGTCAATGAGAACCTTATATT

[0502] 304.CAATGGGACCGACCCATTAA

[0503] 305.GAATGGGACCGACCCTATTAA

[0504] 306.AGGGCAGCTTCCTTGTTAATT

[0505] 307.AGTTGAGTTGCAGAGATTTAA

[0506] 308.ATTTCTGGTGTGTGCTTATAA

[0507] 309.TTTCTGGTGTGTGCTTATAAA

[0508] 310.TGCCTGGATGGGTTCATTTAA

[0509] 311.GCCTGGATGGGTTCATTTAAT

[0510] 312.GGAGTTGAGCTGCAGATATTT

[0511] 313.GAGTTGAGCTGCAGATATTTA

[0512] 314.AGTTGAGCTGCAGATATTTAA

[0513] 315.TAAGGATCACACAGGATTTAT

[0514] 316.TCGATGATGAGAAACTTATAT

[0515] 317.CGATGATGAGAAACTTATATT

[0516] 318.GAAGAGGATGCTGGGAATTAT

[0517] 319.GAATGGGACAAACCCTAATAA

[0518] 320.ATTTCTGGTGTGAGCTTATAA

[0519] 321.TTTCTGGTGTGAGCTTATAAA

[0520] 322.TGGTCCTGTCCCAGGAATTTA

[0521] 323.AGTCGAGCTGTGGAGATTTAA

[0522] 324.CCTGGCAGGGCCACTATAATT

[0523] 325.CTGGCAGGGCCACTATAATTT

[0524] 326.GATGATGAGAACCTTATATTT

[0525] 327.CAATGATGAGAACCCTATATT

[0526] 328.CCCAACCTAGGTGAGAAATTT

[0527] 329.TCAGTGTCGAGAACCTTATAT

[0528] 330.CAGTGTCGAGAACCTTATATT

[0529] 331.CCTGGCAGGGCCCTTATATTT

[0530] 332.TCGATTATGAGAACCTTATAT

[0531] 333.CGATTATGAGAACCTTATATT

[0532] 334.TCAGTGATGAGAACCTTATAT

[0533] 335.CAGTGATGAGAACCTTATATT

[0534] 336.CTGATGATGAGAACCTTATAT

[0535] 337.CCAGCTAGACCACACTTATTT

[0536] 338.AGGACGTTGGGATCCTATTAT

[0537] 339.TTCTGAAGAGAGGTGATTATT

[0538] 340.TCTGAAGAGAGGTGATTATTT

[0539] 341.CTGAAGAGAGGTGATTATTTA

[0540] 342.TGAAGAGAGGTGATTATTTAA

[0541] 343.GAAGAGAGGTGATTATTTAAA

[0542] 344.GGTTGGATTGTGGAGATTAAA

[0543] 345.GGCCCAGCCTAGGTGATAATT

[0544] 346.GCCCAGCCTAGGTGATAATTT

[0545] 347.CGTTGGGTCTCAGAGATTTAA

[0546] 348.CCCACCCTAAGTGAGAAATTT

[0547] 349.TCAATGATGAGAACCTTATAA

[0548] 350.CAATGATGAGAACCTTATAAT

[0549] 351.ATGATGAGAACCTTGTATTAT

[0550] 352.CCCAACAGGGCCACCATATTT

[0551] 353.CATTGGTGACAAGTCAATATT

[0552] 354.ATTGGTGACAAGTCAATATTT

[0553] 355.TGCAGTCCCAGAATGTAATTT

[0554] 356.CCAGGCAGGGCCACTATATTT

[0555] 357.CCTGGCAGGGCCACTATATTT

[0556] 358.TTGCGGTCATGGGCCATAAAT

[0557] 359.AGCAGCTCCCAGCTGAAATTT

[0558] 360.AGGGACCTGTCCTGGAAATTT

[0559] SEQ ID NO:361

[0560] shRNA artificial / synthetic sequence

[0561] in nnnnnnnn It can be CTCGAG (SEQ ID NO:362), TCAAGAG (SEQ ID NO:363), TTCG (SEQ ID NO:364), or GAAGCTTG (SEQ ID NO:365).

[0562] SEQ ID NO:362

[0563] Stem-loop artificial / synthetic sequences

[0564] CTCGAG

[0565] SEQ ID NO:363

[0566] Stem-loop artificial / synthetic sequences

[0567] TCAAGAG

[0568] SEQ ID NO:364

[0569] Stem-loop artificial / synthetic sequences

[0570] TTCG

[0571] SEQ ID NO:365

[0572] Stem ring

[0573] GAAGCTTG

[0574] SEQ ID NO:366

[0575] shRNA artificial / synthetic sequence

[0576]

[0577] SEQ ID NO:367

[0578] shRNA artificial / synthetic sequence

[0579]

[0580] SEQ ID NO:368

[0581] shRNA artificial / synthetic sequence

[0582]

[0583] SEQ ID NO:369

[0584] shRNA artificial / synthetic sequence

[0585]

[0586] SEQ ID NO:370

[0587] shRNA artificial / synthetic sequence

[0588]

[0589] SEQ ID NO:371

[0590] shRNA artificial / synthetic sequence

[0591]

[0592] SEQ ID NO:372

[0593] shRNA artificial / synthetic sequence

[0594]

[0595] SEQ ID NO:373

[0596] shRNA artificial / synthetic sequence

[0597]

[0598] SEQ ID NO:374

[0599] shRNA artificial / synthetic sequence

[0600] in nnnnnnnn It can be CTCGAG (SEQ ID NO:362), TCAAGAG (SEQ ID NO:363), TTCG (SEQ ID NO:364), or GAAGCTTG (SEQ ID NO:365).

[0601] SEQ ID NO:375

[0602] shRNA artificial / synthetic sequence

[0603] in nnnnnnnnIt can be CTCGAG (SEQ ID NO:362), TCAAGAG (SEQ ID NO:363), TTCG (SEQ ID NO:364), or GAAGCTTG (SEQ ID NO:365).

[0604] SEQ ID NO:376

[0605] shRNA artificial / synthetic sequence

[0606] in nnnnnnnn It can be CTCGAG (SEQ ID NO:362), TCAAGAG (SEQ ID NO:363), TTCG (SEQ ID NO:364), or GAAGCTTG (SEQ ID NO:365).

[0607] SEQ ID NO:377

[0608] shRNA artificial / synthetic sequence

[0609] in nnnnnnnn It can be CTCGAG (SEQ ID NO:362), TCAAGAG (SEQ ID NO:363), TTCG (SEQ ID NO:364), or GAAGCTTG (SEQ ID NO:365).

[0610] SEQ ID NO:378

[0611] shRNA artificial / synthetic sequence

[0612] in nnnnnnnn It can be CTCGAG (SEQ ID NO:362), TCAAGAG (SEQ ID NO:363), TTCG (SEQ ID NO:364), or GAAGCTTG (SEQ ID NO:365).

[0613] SEQ ID NO:379

[0614] shRNA artificial / synthetic sequence

[0615] in nnnnnnnn It can be CTCGAG (SEQ ID NO:362), TCAAGAG (SEQ ID NO:363), TTCG (SEQ ID NO:364), or GAAGCTTG (SEQ ID NO:365).

[0616] SEQ ID NO:380

[0617] shRNA artificial / synthetic sequence

[0618] in nnnnnnnn It can be CTCGAG (SEQ ID NO:362), TCAAGAG (SEQ ID NO:363), TTCG (SEQ ID NO:364), or GAAGCTTG (SEQ ID NO:365).

[0619] SEQ ID NO:381

[0620] shRNA artificial / synthetic sequence

[0621] in nnnnnnnn It can be CTCGAG (SEQ ID NO:362), TCAAGAG (SEQ ID NO:363), TTCG (SEQ ID NO:364), or GAAGCTTG (SEQ ID NO:365).

[0622] SEQ ID NO:382

[0623] shRNA artificial / synthetic sequence

[0624]

[0625] SEQ ID NO:383

[0626] shRNA artificial / synthetic sequence

[0627]

Claims

1. A polynucleotide sequence comprising: 5’-TGATGATGAGAACCTTATATT CTCGAG AATATAAGGTTCTCATCATCA-3’(SEQ ID NO:3)。 2. An expression vector comprising the polynucleotide sequence according to claim 1.

3. The expression vector according to claim 2, further comprising a promoter. The expression vector according to claim 3 , wherein the promoter is a neuron-specific promoter.

5. The expression vector according to claim 4, wherein the neuron-specific promoter is neuron-specific enolase (NSE), synapsin I (Syn) or Ca 2+ / CaM-activated protein kinase IIα (CaMKIIα). The expression vector according to claim 3 , wherein the promoter is U6 promoter or H1 promoter.

7. The expression vector of claim 2, wherein the expression vector is an adeno-associated virus (AAV) vector or a lentiviral vector.

8. The expression vector of claim 7, wherein the expression vector is AAV1, AAV2, AAV3, AAV5, AAV6, AAV7, AAV8, AAV9 or AAV10.

9. A pharmaceutical composition comprising the polynucleotide sequence according to claim 1 and a pharmaceutically acceptable carrier.

10. The pharmaceutical composition according to claim 9, wherein the polynucleotide sequence is contained in an expression vector.

11. The pharmaceutical composition according to claim 10, wherein the expression vector is an AAV vector or a lentiviral vector.

12. A polynucleotide encoding a shRNA comprising a nucleotide sequence that is at least 85%, at least 90%, at least 95% or 100% complementary to an RNA encoded by any one of SEQ ID NOs: 19-360.

13. The polynucleotide of claim 12, wherein the polynucleotide is SEQ ID NO:

3.

14. The polynucleotide of claim 12, wherein the shRNA results in activation or increase in expression of paternal UBE3A.

15. The polynucleotide of claim 12, wherein the shRNA results in decreased expression of paternal UBE3A-ATS.

16. The polynucleotide of claim 12, wherein the shRNA results in decreased expression of paternal SNORD115.

17. An expression vector comprising the polynucleotide of claim 12 and a promoter. The expression vector according to claim 17 , wherein the promoter is a neuron-specific promoter.

19. The expression vector according to claim 18, wherein the neuron-specific promoter is neuron-specific enolase (NSE), synapsin I (Syn) or Ca 2+ / CaM-activated protein kinase IIα (CaMKIIα).

20. The expression vector according to claim 17, wherein the promoter is a U6 promoter or a H1 promoter.

21. The expression vector of claim 17, wherein the expression vector is an adeno-associated virus (AAV) vector or a lentiviral vector.

22. The expression vector of claim 21, wherein the expression vector is AAV1, AAV2, AAV3, AAV5, AAV6, AAV7, AAV8, AAV9 or AAV10.

23. The expression vector of claim 17, wherein the polynucleotide is a DNA polynucleotide.

24. A pharmaceutical composition comprising the polynucleotide sequence according to claim 12 and a pharmaceutically acceptable carrier.

25. The pharmaceutical composition of claim 24, wherein the polynucleotide sequence is contained in an expression vector.

26. The pharmaceutical composition of claim 25, wherein the expression vector is an AAV vector or a lentiviral vector.

27. A method for treating Happy Puppet Syndrome, the method comprising administering the polynucleotide according to claim 1 to a patient in need thereof.

28. The method for treating Happy Puppet Syndrome according to claim 27, wherein the polynucleotide encodes a shRNA that results in decreased expression of paternal UBE3A-ATS.

29. The method for treating Happy Puppet Syndrome according to claim 27, wherein the polynucleotide encodes a shRNA that results in decreased expression of paternal SNORD115.

30. The method for treating Happy Puppet Syndrome according to claim 27, wherein the polynucleotide encodes a shRNA that results in activation or increase in expression of the paternal UBE3A gene.

31. A method for treating Happy Puppet Syndrome, the method comprising administering the polynucleotide according to claim 12 to a patient in need thereof.

32. The method for treating Happy Puppet Syndrome according to claim 31, wherein the polynucleotide encodes a shRNA that results in decreased expression of paternal UBE3A-ATS.

33. The method for treating Happy Puppet Syndrome according to claim 31, wherein the polynucleotide encodes a shRNA that results in decreased expression of paternal SNORD115.

34. The method for treating Happy Puppet Syndrome according to claim 31, wherein the polynucleotide encodes a shRNA that results in activation or increase in expression of the paternal UBE3A gene.

35. A polynucleotide comprising SEQ ID NO: 3 encoding a shRNA, wherein the shRNA is capable of inhibiting the silencing of paternal UBE3A.

36. A method for inhibiting silencing of a paternal UBE3A gene by an RNA antisense transcript encoded by SEQ ID NO:2, the method comprising administering to a patient in need thereof an amount of the polynucleotide of claim 1 encoding shRNA effective to cleave the RNA antisense transcript encoded by SEQ ID NO:

2.

37. The method of claim 36, wherein the polynucleotide is contained within an expression vector.

38. The method of claim 37, wherein the expression vector is an AAV vector or a lentiviral vector.

39. The method of claim 36, wherein the polynucleotide is administered to the brain of the patient.

40. The method of claim 36, wherein the polynucleotide is administered to neurons of the patient.

41. The method of claim 33, wherein the shRNA reduces or terminates transcription of a polynucleotide comprising the sequence of SEQ ID NO:

1.

42. The method of claim 36, wherein the shRNA reduces the level of the RNA antisense transcript encoded by SEQ ID NO:

1.

43. A method for inhibiting silencing of a paternal UBE3A gene by an RNA antisense transcript encoded by SEQ ID NO: 1, the method comprising administering to a patient in need thereof an amount of the polynucleotide of claim 12 encoding an shRNA effective to cleave an RNA antisense transcript encoded by SEQ ID NO:

2.

44. The method of claim 43, wherein the polynucleotide is contained within an expression vector.

45. The method of claim 44, wherein the expression vector is an AAV vector or a lentiviral vector.

46. ​​The method of claim 43, wherein the polynucleotide is administered to the brain of the patient.

47. The method of claim 43, wherein the polynucleotide is administered to neurons of the patient.

48. The method of claim 43, wherein the shRNA reduces or terminates transcription of a polynucleotide comprising the sequence of SEQ ID NO:

1.

49. The method of claim 43, wherein the shRNA reduces the level of the RNA antisense transcript encoded by SEQ ID NO:

1.

50. The polynucleotide of claim 1 for use in treating Happy Puppet Syndrome, for use in activating paternal UBE3A, or for use in inhibiting silencing of the paternal UBE3A gene by an RNA antisense transcript encoded by SEQ ID NO:

1.

51. The polynucleotide of claim 12, for use in treating Happy Puppet Syndrome, for use in activating paternal UBE3A, or for use in inhibiting silencing of the paternal UBE3A gene by an RNA antisense transcript encoded by SEQ ID NO:

1.

52. Use of the polynucleotide according to claim 1 in the preparation of a medicament for treating Happy Marionette Syndrome, for activating paternal UBE3A, or for inhibiting the silencing of the paternal UBE3A gene by an RNA antisense transcript encoded by SEQ ID NO:

1.

53. Use of the polynucleotide according to claim 12 in the preparation of a medicament for treating Happy Marionette Syndrome, for activating paternal UBE3A, or for inhibiting the silencing of the paternal UBE3A gene by an RNA antisense transcript encoded by SEQ ID NO:

1.

54. An shRNA encoded by a portion of SEQ ID NO:3, wherein the portion of SEQ ID NO:3 defines a first segment and a second segment, the first segment is defined by bold nucleotides, the first segment is shortened by one, two, three or four nucleotides at either end, and the second segment is defined by italic nucleotides, the second segment is shortened by one, two or three nucleotides at either end of the italic nucleotides.

55. The shRNA of claim 54, wherein the shRNA is encoded by SEQ ID NO:366, SEQ ID NO:367, SEQ ID NO:368, SEQ ID NO:369, SEQ ID NO:370, SEQ ID NO:371, SEQ ID NO:372, or SEQ ID NO:

373.

56. A polynucleotide sequence comprising: 5'-TGATGATGAGAACCTTATATT nnnnnnnn AATATAAGGTTCTCATCATCA-3' (SEQ ID NO: 361), wherein nnnnnnnn It can be CTCGAG (SEQ ID NO: 362), TCAAGAG (SEQ ID NO: 363), TTCG (SEQ ID NO: 364) or GAAGCTTG (SEQ ID NO: 365).

57. A polynucleotide sequence, comprising a first part, a second part and a third part, wherein the first part comprises any one of SEQ ID NO:19-360, the second part comprises any one of SEQ ID NO:362, 363, 364 or 365, and the third part comprises a corresponding nucleotide sequence complementary to the nucleotide sequence in SEQ ID NO:19-360.

58. The polynucleotide of claim 57, wherein the first portion is shortened by one, two, three or four nucleotides at either end of the first portion, and the third portion is shortened by one, two or three nucleotides at either end of the third portion.

Images