Cyclocarya paliurus leaf aqueous extract and preparation method and application thereof in improving skin inflammation

Abstract

The invention provides a cyclocarya paliurus leaf water extract as well as a preparation method and application of the cyclocarya paliurus leaf water extract. The cyclocarya paliurus leaf water extract disclosed by the invention is an extract obtained by carrying out water extraction on cyclocarya paliurus leaves, and the cyclocarya paliurus leaf water extract contains quinic acid, neochlorogenic acid, chlorogenic acid, 4-hydroxybenzoic acid, gallic acid, quercetin 3L glucoside, astragaloside, kaempferol, Quadranoside IV, kaempferol-3-O-glucoside, kaempferol-3-O-rhamnoside, quercetin and asiatic acid. The cyclocarya paliurus leaf aqueous extract provided by the invention can be used for preparing products for improving skin inflammation induced by UVB (ultraviolet radiation b), such as skin care cosmetics.

Description

Technical Field

[0001] The invention relates to a Cyclocarya paliurus leaf water extract and a preparation method and application thereof, in particular to the use of the Cyclocarya paliurus leaf water extract for improving UVB (ultraviolet radiation b)-induced skin inflammation. Background Art

[0002] Cyclocarya paliurus (Batalin) Iljinsk) (Juglandaceae) is a notable plant species of great value in traditional Chinese medicine (TCM) and has received much attention in recent years for its potential health benefits. The leaves of this tree have been used for centuries for their many health-promoting properties in various medicinal preparations. Cyclocarya paliurus (CP) leaves are also used to make a unique and delicious tea that is sweet and slightly nutty and popular in the Asian market.

[0003] CP leaves contain many phytochemical components, including flavonoids, phenolic compounds, triterpenes, alkaloids, saponins, and polysaccharides. Among all the bioactive components, one of the main phytochemicals present in CP leaves is flavonoids. The leaves of Cyclocarya paliurus contain a variety of flavonoids, including quercetin, kaempferol, and myricetin. These compounds have shown effective antioxidant activity, thereby helping to neutralize harmful free radicals and protect cells from oxidative damage. In addition, flavonoids have been associated with anti-inflammatory effects, cardiovascular protection, and potential anti-cancer properties. Another important group of phytochemicals found in CP leaves are phenolic compounds. The leaves contain several phenolic compounds, such as gallic acid, ellagic acid, and chlorogenic acid. These compounds contribute to the overall antioxidant capacity of the leaves and can help reduce inflammation in the body. Triterpenes are another group of bioactive compounds present in CP leaves. The leaves contain various triterpenes, including Cyclocarya paliurus A, Cyclocarya paliurus B, and Cyclocarya paliurus C. These compounds have been studied for their potential anti-diabetic effects because they have shown the ability to inhibit enzymes involved in carbohydrate metabolism, such as alpha-amylase and alpha-glucosidase. In addition, CP leaves contain other phytochemical components, such as alkaloids, saponins, and polysaccharides, which are associated with its immunomodulatory effects and regulatory effects on metabolic health. In short, CP leaves are rich in phytochemical components that contribute to its potential health benefits. These compounds exhibit various biological activities, including antioxidant properties, anti-inflammatory properties, anti-diabetic properties, antimicrobial properties, and potential anti-cancer properties.

[0004] Nonetheless, the diverse phytochemical components of CP leaves highlight their potential as a valuable natural resource for developing skin applications as a plant-based edible source. The bioactive compounds present in CP leaves may help protect the skin from oxidative damage, reduce inflammation, and maintain a healthy skin microbiome. However, their potential benefits for skin health have not been studied. Summary of the invention

[0005] An object of the present invention is to provide an aqueous extract of Cyclocarya paliurus (CP) leaves.

[0006] Another object of the present invention is to provide a method for preparing the Cyclocarya paliurus leaf water extract.

[0007] Another object of the present invention is to provide related applications of the Cyclocarya paliurus leaf water extract.

[0008] In one aspect, the present invention provides a Cyclocarya paliurus (CP) leaf water extract, which is an extract obtained by extracting Cyclocarya paliurus leaves with water.

[0009] The present study found that CP leaf aqueous extract treatment significantly improved skin inflammation and restored barrier dysfunction.

[0010] According to a specific embodiment of the present invention, the water extract of Cyclocarya paliurus leaves of the present invention contains quinic acid, neochlorogenic acid, chlorogenic acid, 4-hydroxybenzoic acid, gallic acid, quercetin 3L glucuronide, astragalin, kaempferol, quadranoside IV, kaempferol-3-O-glucuronide, kaempferol-3-O-rhamnoside, quercetin and asiatic acid.

[0011] According to a specific embodiment of the present invention, the Cyclocarya paliurus leaf aqueous extract of the present invention is in liquid or solid state.

[0012] According to a specific embodiment of the present invention, the Cyclocarya paliurus leaf aqueous extract of the present invention is prepared according to the following method:

[0013] Water is used as an extraction solvent to extract the Cyclocarya paliurus leaves, and the obtained extract is used as the Cyclocarya paliurus leaf water extract or is further concentrated and dried to obtain the Cyclocarya paliurus leaf water extract.

[0014] On the other hand, the present invention also provides a method for preparing the Cyclocarya paliurus leaf water extract, the method comprising:

[0015] Water is used as an extraction solvent to extract the Cyclocarya paliurus leaves, and the obtained extract is used as the Cyclocarya paliurus leaf water extract or is further concentrated and dried to obtain the Cyclocarya paliurus leaf water extract.

[0016] According to a specific embodiment of the present invention, in the method for preparing the Cyclocarya paliurus leaf water extract of the present invention, the Cyclocarya paliurus leaf is a dry leaf.

[0017] According to a specific embodiment of the present invention, in the method for preparing the water extract of Cyclocarya paliurus leaves of the present invention, water is used to extract the Cyclocarya paliurus leaves for 1 to 5 times, preferably 2 to 3 times.

[0018] According to a specific embodiment of the present invention, in the method for preparing the water extract of Cyclocarya paliurus leaves of the present invention, during each extraction, the ratio of Cyclocarya paliurus leaves to water is 1:1-50, preferably 1:5-20.

[0019] According to a specific embodiment of the present invention, in the method for preparing the Cyclocarya paliurus leaf water extract of the present invention, each extraction time is 0.5 to 4 hours, preferably 1 to 2 hours.

[0020] According to a specific embodiment of the present invention, in the method for preparing the Cyclocarya paliurus leaf water extract of the present invention, during extraction, the temperature of water is 80-100°C, preferably 90-100°C.

[0021] According to a specific embodiment of the present invention, in the preparation method of the water extract of Cyclocarya paliurus leaves of the present invention, appropriate stirring and / or pressurization may be assisted during extraction. After extraction, the solid or visible impurities in the Cyclocarya paliurus leaves may be removed by filtration or centrifugation as needed.

[0022] In some specific embodiments of the present invention, the present invention is to soak dry cyclocarya paliurus leaves in boiling water (the ratio of cyclocarya paliurus leaves to water is about 1:10 m / v), extract twice, each time for 2 hours. Then, the extracts are combined, concentrated and vacuum freeze-dried to obtain cyclocarya paliurus leaf water extract powder.

[0023] On the other hand, the present invention also provides the use of the Cyclocarya paliurus leaf water extract in the preparation of a product for improving skin barrier function and / or inflammation. The Cyclocarya paliurus leaf water extract of the present invention can significantly improve skin inflammation and restore barrier dysfunction.

[0024] According to a specific embodiment of the present invention, in the present invention, the skin barrier function and / or inflammation is induced by UVB (ultraviolet radiation b).

[0025] According to a specific embodiment of the present invention, in the present invention, the improvement of skin barrier function and / or inflammation includes one or more of the following specific applications:

[0026] Improve the expression levels of skin barrier and / or moisturizing related factors in human epidermal keratinocytes;

[0027] Inhibits UVB-induced oxidative reactions;

[0028] Inhibits the production of ROS stimulated by UVB;

[0029] Inhibit UVB-induced pro-inflammatory response;

[0030] Inhibits IL-1α secretion;

[0031] Inhibit the production of skin inflammatory factors iNOS, TNF-a, and IL-6;

[0032] Regulating the lipid metabolism of the skin under inflammatory conditions; preferably, the regulation of the lipid metabolism of the skin under inflammatory conditions includes one or more of the related metabolic pathways including glycerophospholipid metabolism, sphingolipid metabolism, ether lipid metabolism, glycerolipid metabolism, unsaturated fatty acid biosynthesis, phosphatidylinositol signaling system, phosphoinositide metabolism, fatty acid degradation, glycosylphosphatidylinositol, fatty acid elongation, and fatty acid biosynthesis.

[0033] According to a specific embodiment of the present invention, in the present invention, the product for improving skin barrier function and / or inflammation is a cosmetic, preferably a skin care product.

[0034] On the other hand, the present invention also provides a cosmetic containing the Cyclocarya paliurus leaf water extract of the present invention.

[0035] According to a specific embodiment of the present invention, the cosmetics in the present invention can be gel, cream, lotion, ointment, cream, powder or patch, etc.

[0036] According to a specific embodiment of the present invention, in the present invention, the content of the Cyclocarya paliurus leaf water extract in the cosmetic is 10ppm-400ppm. Preferably, the content of the Cyclocarya paliurus leaf water extract in the cosmetic is 25ppm-300ppm, more preferably 50ppm-200ppm.

[0037] On the other hand, the present invention also provides an application of an aqueous extract of Cyclocarya paliurus leaves or its phytochemical components in constructing a prediction target-signaling pathway database, wherein the aqueous extract of Cyclocarya paliurus leaves is the aqueous extract described in the present invention, and the phytochemical components comprise one or more of quinic acid, neochlorogenic acid, chlorogenic acid, 4-hydroxybenzoic acid, gallic acid, quercetin 3L-glucuronide, astragalin, kaempferol, quadranoside IV, kaempferol-3-O-glucuronide, kaempferol-3-O-rhamnoside, quercetin and asiatic acid.

[0038] On the other hand, the present invention also provides the use of phytochemical components of the water extract of Cyclocarya paliurus leaves and / or their predicted targets in screening and / or preparing drugs for improving skin inflammation, wherein the phytochemical components of the water extract of Cyclocarya paliurus leaves include one or more of flavonoids, triterpenoids, organic acids and polysaccharides.

[0039] Preferably, the phytochemical components of the Cyclocarya paliurus leaf water extract include one or more of quinic acid, neochlorogenic acid, chlorogenic acid, 4-hydroxybenzoic acid, gallic acid, quercetin 3L glucuronide, astragalin, kaempferol, quadranoside IV, kaempferol-3-O-glucuronide, kaempferol-3-O-rhamnoside, quercetin and asiatic acid.

[0040] According to a specific embodiment of the present invention, the target is as shown in Table 3 or Figure 9C shown.

[0041] According to a specific embodiment of the present invention, the present invention evaluates the effect of CP leaf water extract on UVB-induced skin inflammation and barrier function in vitro, and systematically studies the molecular mechanism of CP's anti-inflammatory effect using network pharmacology and lipidomics methods. In human epidermal primary keratinocytes, CP treatment significantly improved UVB-induced cell survival, proinflammatory response and barrier dysfunction. In addition, the present invention discloses the lipid metabolism profile regulated by CP, and uses network pharmacology to solve the pharmacological mechanism network of CP components and bioactive lipids.

[0042] In some embodiments of the present invention, the predicted target-signaling pathways of the CP leaf extract discovered by the present invention include one or more of the following:

[0043] GO:0042327: positive regulation of phosphorylation;

[0044] GO:0009725: Response to hormones;

[0045] GO:0030097: hematopoiesis;

[0046] GO:0007565: Female pregnancy;

[0047] GO:2001233: Regulation of apoptosis signaling pathways;

[0048] GO:0062197: Cellular responses to chemical stress;

[0049] GO:0050727: Regulation of inflammatory response;

[0050] GO:0036293: Response to decreased oxygen levels;

[0051] GO:1901652: response to peptide;

[0052] GO:0071396: Cellular responses to lipids;

[0053] GO:0048660: Regulation of smooth muscle cell proliferation;

[0054] GO:0007167: enzyme-linked receptor protein signaling pathway;

[0055] GO:0048871: Homeostasis at the level of multicellular organisms;

[0056] GO:0035239: Tube morphogenesis;

[0057] GO:0033674: positive regulation of kinase activity;

[0058] GO:0051091: Positive regulation of DNA-binding transcription factor activity;

[0059] GO:0062013: Positive regulation of small molecule metabolic processes;

[0060] GO:0150077: Regulation of neuroinflammatory response;

[0061] GO:0140747: Regulation of ncRNA transcription;

[0062] GO:0071214: Cellular responses to abiotic stimuli.

[0063] In summary, the present data suggest a new topical application of CP leaf aqueous extract for improving skin inflammation and barrier dysfunction and provide a novel network pharmacology-lipidomics approach to investigate the beneficial properties and potential molecular mechanisms of CP leaf against UVB-induced skin inflammation. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 It was shown that CP leaf extract treatment at a concentration of 100 ppm exhibited no cytotoxicity to NHEK cells. Effect of CP leaf extract on cell viability of primary epidermal keratinocytes. Data (n=3) are expressed as mean ± SD. Significant differences were analyzed by one-way analysis of variance (ANOVA). *p<0.05, **p<0.01 and ***, p<0.001, *Comparison between No Treatment (NT) group and different concentrations of CP leaf extract groups.

[0065] Figures 2A to 2H CP leaf extract treatment at different doses is shown to stimulate barrier and moisturizing related gene expression in NHEK cells. Effect of CP leaf extract on the mRNA expression level of skin barrier and moisturizing related genes in NHEK cells. Data (n=3) are expressed as mean ± SD. Significant differences were analyzed by one-way analysis of variance (ANOVA). *, p<0.05, **, p<0.01 and ***, p<0.001, ****, p<0.0001 * Comparison between NT group and different concentrations of CP leaf extract groups.

[0066] Figure 3It was shown that CP leaf extract treatment significantly inhibited ROS production stimulated by UVB irradiation in NHEK cells in a dose-dependent manner. Effect of CP leaf extract on reactive oxygen species (ROS) production in NHEK. Data (n=3) are expressed as mean ± SD. Significant differences were analyzed by one-way analysis of variance (ANOVA). *, #, p<0.05, **, ##, p<0.01 and ***, ###, p<0.001, ****, ####, p<0.0001 * Comparison between NT group and UVB group; # Comparison between UVB group and CP leaf extract group.

[0067] Figure 4 It was shown that CP leaf extract treatment significantly inhibited IL-1α secretion stimulated by UVB irradiation in NHEK cells in a dose-dependent manner. Effect of CP leaf extract on IL-1α secretion in NHEK. Data (n=3) are expressed as mean ± SD. Differences between exposure doses were analyzed by one-way analysis of variance (ANOVA). *, #, p<0.05, **, ##, p<0.01 and ***, ###, p<0.001, ****, ####, p<0.0001*Comparison between NT group and UVB group; #Comparison between UVB group and CP leaf extract group.

[0068] Figure 5 It is shown that CP leaf extract treatment at a concentration of 100 ppm exhibited no cytotoxicity to RAW 264.7 cells. Effect of CP leaf extract on RAW 264.7 cell viability. Data (n=3) are expressed as mean ± SD. Differences between exposure doses were analyzed by one-way analysis of variance (ANOVA). *p<0.05, **p<0.01 and ***, p<0.001, *Comparison between NT group and CP leaf extract group.

[0069] Figures 6A to 6C It was shown that CP leaf extract treatment significantly inhibited the expression of pro-inflammatory genes in RAW 264.7 cells in a dose-dependent manner. Effect of CP leaf extract on pro-inflammatory gene expression. Data (n=3) are expressed as mean ± SD. Differences between exposure doses were analyzed by one-way analysis of variance (ANOVA). *, #, p<0.05, **, ##, p<0.01 and ***, ###, p<0.001, ****, ####, p<0.0001 * Comparison between NT group and LPS group; # Comparison between LPS group and CP leaf extract group.

[0070] Figures 7A to 7D It was shown that CP leaf extract treatment modulates lipid metabolism under inflammatory conditions. Effects of CP leaf extract on pro-inflammatory regulated lipid metabolism.

[0071] Figure 8 It is shown that CP leaf extract treatment modulates various lipid metabolic pathways under inflammatory conditions. Effect of CP leaf extract on pro-inflammatory regulated lipid metabolic pathways. KEGG pathway map of lipid metabolism.

[0072] Figures 9A to 9C The construction of a predicted target-signaling pathway database of CP leaf extract is shown. The construction of a predicted target-signaling pathway database of CP leaf extract is shown. DETAILED DESCRIPTION

[0073] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention.

[0074] When embodiment provides numerical range, it should be understood that, unless the present invention indicates otherwise, the two endpoints of each numerical range and any numerical value between the two endpoints can be selected.Unless otherwise defined, all technical and scientific terms used in the present invention are identical with the meanings commonly understood by those skilled in the art.Except the concrete method, equipment, reagent materials used in the embodiment, according to the grasp of prior art by those skilled in the art and the record of the present invention, any method, equipment and material of the prior art similar or equivalent to the method, equipment, reagent materials in the embodiment of the present invention can also be used to realize the present invention.

[0075] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in the technical field.

[0076] Unless otherwise specified, the Cyclocarya paliurus (CP) leaves in the present invention are leaves of the Cyclocarya paliurus plant of the genus Cyclocarya of the family Juglandaceae. As a raw material in a specific embodiment of the present invention, the Cyclocarya paliurus leaves are dried leaves.

[0077] Furthermore, this application claims priority to US63 / 593,339, the entire contents of which are hereby incorporated by reference.

[0078] For easier understanding of the present invention, some technical and scientific terms are specifically defined below. Unless otherwise specifically defined herein, all other technical and scientific terms used herein have the meanings commonly understood by those skilled in the art.

[0079] In this specification, the references to "some specific / preferred embodiments", "other specific / preferred embodiments", "embodiments", "implementations", etc. refer to specific elements (e.g., features, structures, properties and / or characteristics) related to the embodiments / implementations described herein, which are included in at least one embodiment described herein, and may or may not exist in other embodiments. In addition, it should be understood that the elements may be combined in various embodiments in any suitable manner.

[0080] The common materials and methods in each embodiment are as follows:

[0081] 1. Reagents

[0082] Primary human epidermal keratinocytes (NHEK, catalog number FC-0025) and complete culture medium (catalog number LL-0007) were obtained from Cell Technology. CCK-8 kit purchased from Dojindo Laboratories (catalog number CK04). RNeasy micro kit (catalog number 74106, Qiagen). PrimeScriptRT master mix (Takara, catalog number RR036A), SYBR premix ExTaq II (Takara, catalog number RR802A). CellROX TM Green was purchased from Life Technologies (catalog number C10444). Human IL-1α ELISA kit was purchased from R&D Systems (catalog number DY200). PBS was purchased from Gibco. Vitamin E was purchased from Purchased from LifeSciences (Cat. No. V8010). Dexamethasone was obtained from Merck (Cat. No. D4902).

[0083] 2. Methods

[0084] 2.1 Primary human keratinocyte viability test

[0085] Normal primary human keratinocytes (NHEK) were maintained at 37°C, 5% CO2 in appropriate culture medium. When 80% confluence was reached, cells were plated at 1×10 5 The cells were seeded into 96-well plates at a density of 1:100 / ml. After 48 h, the cells were treated with samples at different concentrations for 24 h. Cell viability was measured by CCK at 450 nm according to the manufacturer's protocol.

[0086] 2.2 RNA extraction and quantitative real-time polymerase chain reaction

[0087] NHEK were treated with different concentrations of CP leaf extract samples for 24 h. At the end of the experiment, the cells were washed once with cold PBS and total RNA was extracted using the RNeasy micro kit. RNA was converted to cDNA using reverse transcriptase, and the relevant genes were amplified and measured. mRNA expression data were analyzed and analyzed by 2 -ΔΔCt Methods Calculate the fold change of related genes. Design specific primers to amplify target genes. Primer information is listed in Table 1 below. Use YWHAZ gene as housekeeping gene for internal control.

[0088] Table 1. Primer information

[0089] Gene name Primer sequence (5' to 3') FLG-F GCTGAAGGAACTTCTGGAAAAGG (SEQ ID NO.1) FLG-R GTTGTGGTCTATATCCAAGTGATC (SEQ ID NO.2) HAS1-F CTGCGATACTGGGTAGCCTTCA (SEQ ID NO.3) HAS1-R CCAGGAACTTCTGGTTGTACCAG (SEQ ID NO.4) HAS3-F AGCACCTTCTCGTGCATCATGC (SEQ ID NO.5) HAS3-R TCCTCCAGGACTCGAAGCATCT (SEQ ID NO.6) TGM1-F GAACGACTGCTGGATGAAGAGG (SEQ ID NO.7) TGM1-R CTTGATGGACTCCACAGAGCAG (SEQ ID NO.8) CLD1-F GTCTTTGACTCCTTGCTGAATCTG (SEQ ID NO.9) CLD1-R CACCTCATCGTCTTCCAAGCAC (SEQ ID NO.10) IVL-F GGTCCAAGACATTCAACCAGCC (SEQ ID NO.11) IVL-R TCTGGACACTGCGGGTGGTTAT (SEQ ID NO.12) LOR-F GTCTGCGGAGGTGGTTCCTCT (SEQ ID NO.13) LOR-R TGCTGGGTCTGGTGGCAGATC (SEQ ID NO.14) AQP3-F CCGTGACCTTTGCCATGTGCTT (SEQ ID NO.15) AQP3-R TTGTCGGCGAAGTGCCAGATTG (SEQ ID NO.16) YWHAZ-F TGATCCCCAATGCTTCACAAG (SEQ ID NO.17) YWHAZ-R GCCAAGTAACGGTAGTAATCTCC (SEQ ID NO.18) IL6-F TAG TCC TTC CTACCC CAA TTT CC (SEQ ID NO.19) IL6-R TTG GTC CTT AGC CAC TCC TTC (SEQ ID NO.20) TNF-α-F AAG CCT GTA GCC CAC GTC GTA (SEQ ID NO.21) TNF-α-R GGC ACC ACT AGT TGG TTG TCT TTG (SEQ ID NO.22) iNOS-F CTCCCCTCTCTCCCTTTCCT(SEQ ID NO.23) iNOS-R TGGAAATTGGGGTAGGAAGG(SEQ ID NO.24) β-actin-F AGT GTG ACG TTG ACA TCC GT(SEQ ID NO.25) β-Actin-R GCA GCT CAG TAA CAG TCC GC(SEQ ID NO.26)

[0090] 2.3 Measurement of ROS generation in UVB-irradiated keratinocytes

[0091] NHEK was added at 2 × 10 4 Cells / well were seeded in 96-well microtiter plates for 48 h. NHEKs were then exposed to a UVB lamp (Spectroline model EB-160C, New York, NY, USA) at a dose of 10 mJ / cm 2 The UVB irradiation peaked at 312 nm. After UVB irradiation, the cells were washed with warm PBS and then replaced with fresh medium containing / without different concentrations of CP leaf extract. After 6 h, the cells were treated with The relative level of ROS was detected by using a reagent. Incubate together for 1 hour and wash twice with PBS. ROS generation was measured by fluorescence intensity, with excitation and emission wavelengths set at 485 nm and 520 nm, respectively. CCK-8 was used to detect the viability of NHEK cells for normalization of ROS levels.

[0092] 2.4 Enzyme-linked immunosorbent assay

[0093] NHEK was added at 2 × 10 4 Cells / well were seeded in 96-well microplates for 48 h. NHEKs were then exposed to a dose of 10 mJ / cm 2 After UVB irradiation, the cells were washed with warm PBS and then fresh medium with and without different concentrations of CP leaf extract was added and further incubated. After 24 h, the cell supernatant was collected and IL-1α was measured according to the manufacturer's protocol. CCK-8 was used to detect cell viability for normalization of IL-1α levels.

[0094] 2.5 MTT assay

[0095] RAW264.7 cell viability was measured using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Cells were seeded in 96-well plates and incubated for 24 hours. RAW 264.7 cells were treated with different concentrations of CP leaf extract and incubated for 24 hours. 200 μL of MTT solution (5 mg / mL in PBS) was added to the cells and incubated for 3 hours. The culture medium was then removed, and 200 μL of dimethyl sulfoxide (DMSO) was added to each well to dissolve the crystalline deposits on the cells. The optical density of the cells at 540 nm was measured using an ELISA plate reader.

[0096] 2.6 Lipidomic profiling of RAW cell lines

[0097] According to the unified protocol from LIPID MAPS, RAW 264.7 cells were extracted using Bligh-Dyer (BD) extraction. In short, after aspirating the culture medium, the cells from the 100mm culture plate were washed twice with 5ml ice-cold 1×PBS. Then 10ml of 1×PBS was added to the plate, and the cells were scraped and transferred to a 15ml conical tube. Then 200 μL of suspension was taken to quantify protein with a protein BCA kit. Cell pellets were collected after centrifugation at 3,500rpm for 10min at 4°C. Then, BD system: 1ml of 80°C pre-cooled 70% MeOH, 350μL of CHCl3, 350μL of H2O, and 350μL of CHCl3 were gradually added, and vortexed in each step to induce phase separation. After centrifugation at 4,000rpm for 30min at 4°C, the lower layer (200μL) was transferred to a 1.5ml test tube. The samples were dried under vacuum within 30 min at room temperature and stored at -80°C until analysis.

[0098] Liquid chromatography was performed on an Agilent 1290UPLC system, and mass spectrometry was performed on an Agilent 6546 quadrupole time-of-flight mass spectrometer. A Waters ACQUITY UPLC HSS C18 column (2.1 mm×100 mm, 1.8 μm particle size) was used for separation at 40° C. Mobile phase A and mobile phase B were prepared as 60:40 water / acetonitrile and 90:10 isopropanol / acetonitrile containing 10 mM ammonium formate and 0.1% formic acid. The linear gradient was set to 0-32% B (0-0.8min), 32-45% B (0.8-2min), 45-52% B (2-2.5min), 52-58% B (2.5-4min), 58-66% B (5-5.5min), 66-70% B (5.5-7min), 70-75% B (7-8.8min), and 75-97% B (8.8-10.5min); then maintained at 97% B from 10.5min to 15min; and reduced to 32% B from 15min to 18min; lipids were detected and identified in both negative and positive ionization modes. For lipid identification, the framework m / z value was used to search for information about LIPID MAPS and the Human Metabolome Database (HMDB). Matching was confirmed by the accurate tandem mass (MS / MS) and retention time of lipids based on standards and databases.

[0099] Construction of a database of predicted targets and signal transduction pathways for 2.7CP leaf extracts

[0100] The construction of the prediction target-signaling pathway database is based on the results from plant chemical analysis and network databases, including the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP) and the Traditional Chinese Medicine Integrated Database (TCMID). These targets are collected and imported into the protein-protein interaction network for enrichment analysis. The protein-protein interactions of the predicted targets are mapped using the STRING database (http: / / string-db.org), and a target-signaling pathway database is constructed for pathway and functional enrichment analysis. Functional enrichment analysis of the signaling pathway is obtained from the KEGG database.

[0101] 2.8 Statistics

[0102] Data were analyzed using GraphPad Prism 9.0, and the results are expressed as mean ± SD. Significant p values ​​were calculated by Student's t-test or one-way ANOVA, and p values ​​less than 0.05 were considered statistically significant. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. #P<0.05, ##P<0.01, ###P<0.001, ####P<0.0001.

[0103] Example 1. Preparation of Cyclocarya paliurus (CP) leaf extract

[0104] This embodiment prepares the water extract of Cyclocarya paliurus leaves (CP leaf extract) of the present invention. The specific preparation method includes: soaking dry Cyclocarya paliurus leaves (5 kg) in boiling water (1:10 m / v) twice, boiling and extracting for 2 hours each time. The two extraction solutions are combined, concentrated and vacuum freeze-dried to obtain a dry powder of the crude extract of Cyclocarya paliurus leaves. The dry powder sample of the crude extract of Cyclocarya paliurus leaves is used for experiments in subsequent embodiments.

[0105] An appropriate amount of the dry crude extract was weighed, methanol was added, and a 1 μg / mL methanol solution was prepared, and the composition of the effective components in the water extract of the leaves of Cyclocarya paliurus of the present invention was identified using Q-TOF MS / MS. The results showed that the water extract of the leaves of Cyclocarya paliurus of the present invention contained, but was not limited to, the phytochemical components shown in Table 2.

[0106] Table 2. Typical SMILES of MOST

[0107]

[0108]

[0109] Example 2: CP leaf extract improves barrier function in vitro

[0110] This example determined the cytotoxicity of CP leaf extract in normal human epidermal keratinocytes (NHEK) to study the safety and non-toxic dose of CP leaf extract necessary for skin care cosmetics.

[0111] Figure 1It was shown that the treatment with CP leaf extract at a concentration of 100 ppm showed no cytotoxicity to NHEK cells. Effect of CP leaf extract on cell viability of primary epidermal keratinocytes. Data (n=3) are expressed as mean ± SD. Significant differences were analyzed by one-way analysis of variance (ANOVA). *p<0.05, **p<0.01 and ***, p<0.001, *Comparison between No Treatment (NT) group and different concentrations of CP leaf extract groups. Figure 1 As shown, CP leaf extract had no obvious cytotoxicity to NHEK in the dosage range of 10 ppm to 400 ppm.

[0112] This example further determined the mRNA expression levels of genes related to skin barrier function, including transglutaminase 1 (TGM1), claudin1 (CLD1) and loricrin (LOR), which are widely regarded as biomarkers of skin barrier function.

[0113] FIG. 2A to FIG. 2H It is shown that different doses of CP leaf extract treatment stimulated barrier and moisturizing related gene expression in NHEK cells. Effect of CP leaf extract on the mRNA expression level of skin barrier and moisturizing related genes in NHEK cells. Data (n=3) are expressed as mean ± SD. Significant differences were analyzed by one-way analysis of variance (ANOVA). *, p<0.05, **, p<0.01 and ***, p<0.001, ****, p<0.0001*Comparison between NT group and different concentrations of CP leaf extract groups. As FIG. 2A to FIG. 2H As shown, CP leaf extract improved the expression of barrier function genes (FLG, HAS1, TGM1, CLD1, LOR, AQP3, etc.) in a dose-dependent manner, indicating that CP leaf extract helps to maintain or enhance the barrier function of NHEK.

[0114] Example 3: CP leaf extract inhibits UVB-induced oxidative reactions in vitro

[0115] Based on the concentration of CP leaf extract determined in NHEK by the present invention, this example studied the antioxidant efficacy of CP leaf extract induced by UVB irradiation by measuring the intracellular reactive oxygen species (ROS) level in NHEK.

[0116] Figure 3It was shown that CP leaf extract treatment significantly inhibited ROS production stimulated by UVB irradiation in NHEK cells in a dose-dependent manner. Effect of CP leaf extract on reactive oxygen species (ROS) production in NHEK. Data (n=3) are expressed as mean ± SD. Significant differences were analyzed by one-way analysis of variance (ANOVA). *, #, p<0.05, **, ##, p<0.01 and ***, ###, p<0.001, ****, ####, p<0.0001 * Comparison between NT group and UVB group; # Comparison between UVB group and CP leaf extract group.

[0117] The results showed that after UVB (10mJ / cm 2 ) irradiated, the intracellular ROS level in NHEK increased significantly after normalization by cell number. In contrast, CP leaf extract significantly inhibited the ROS level in UVB-treated NHEK in a dose-dependent manner and showed a stronger inhibitory effect than the positive control vitamin E (200 μM) at a concentration of 50 ppm. Overall, consistent with the previous results on barrier function in the present invention, the present invention shows that CP leaf extract exhibits antioxidant activity against UVB-treated NHEK in a dose-dependent manner ( Figure 3 ).

[0118] Example 4: CP leaf extract inhibits UVB-induced pro-inflammatory response in vitro

[0119] Following the antioxidant effect of CP leaf extract in NHEK, this example investigated the effect of CP leaf extract on UVB-induced pro-inflammatory response in NHEK.

[0120] Figure 4 It was shown that CP leaf extract treatment significantly inhibited IL-1α secretion stimulated by UVB irradiation in NHEK cells in a dose-dependent manner. Effect of CP leaf extract on IL-1α secretion in NHEK. Data (n=3) are expressed as mean ± SD. The differences between exposure doses were analyzed by one-way analysis of variance (ANOVA). *, #, p<0.05, **, ##, p<0.01 and ***, ###, p<0.001, ****, ####, p<0.0001*Comparison between NT group and UVB group; #Comparison between UVB group and CP leaf extract group. As Figure 4As shown, UVB treatment induced an increase in the proinflammatory factor IL-1α, while CP leaf extract and dexamethasone significantly inhibited the level of IL-1α induced by UVB in NHEK. In addition, CP leaf extract at a concentration of 50 ppm showed a more effective inhibitory effect on IL-1α levels than dexamethasone (200 μM), indicating that CP leaf extract also exhibited an anti-inflammatory effect in a dose-dependent manner in UVB-treated NHEK.

[0121] Example 5: CP leaf extract inhibits LPS-induced pro-inflammatory response in RAW 264.7 cells

[0122] This example further determined the effect of CP leaf extract on the pro-inflammatory response induced by LPS in RAW 264.7 cells.

[0123] Figure 5 It is shown that CP leaf extract treatment at a concentration of 100 ppm exhibited no cytotoxicity to RAW 264.7 cells. Effect of CP leaf extract on RAW 264.7 cell viability. Data (n=3) are expressed as mean ± SD. Differences between exposure doses were analyzed by one-way analysis of variance (ANOVA). *p<0.05, **p<0.01 and ***, p<0.001, *Comparison between NT group and CP leaf extract group.

[0124] FIG. 6A to FIG. 6C It was shown that CP leaf extract treatment significantly inhibited the expression of pro-inflammatory genes in RAW 264.7 cells in a dose-dependent manner. Effect of CP leaf extract on pro-inflammatory gene expression. Data (n=3) are expressed as mean ± SD. Differences between exposure doses were analyzed by one-way analysis of variance (ANOVA). *, #, p<0.05, **, ##, p<0.01 and ***, ###, p<0.001, ****, ####, p<0.0001 * Comparison between NT group and LPS group; # Comparison between LPS group and CP leaf extract group.

[0125] like Figure 5 and FIG. 6A to FIG. 6C As shown, 100 ppm of CP leaf extract showed no obvious toxicity to RAW 264.7 cells. Consistent with the previous findings of the present invention, CP leaf extract treatment showed significant inhibition of LPS-induced iNOS, TNF-a and IL-6 in a dose-dependent manner.

[0126] Example 6: CP leaf extract regulates lipid metabolism in RAW 264.7 cells under inflammatory conditions

[0127] To investigate the effects of CP leaf extract on lipid metabolism under inflammatory conditions, lipidomics studies were performed on RAW 264.7 cells.

[0128] 7A to 7D It was shown that CP leaf extract treatment modulates lipid metabolism under inflammatory conditions. Effects of CP leaf extract on pro-inflammatory regulated lipid metabolism. Fig. 7A , PCA score curves of CP leaf extract treatment based on lipidomic profiling of LPS-treated RAW cells (using negative and positive ionization modes merged, ESI- / ESI+). Figure 7B , Volcano plot of LPS versus control. Figure 7C , Heat map of total lipid profile in LPS-treated RAW cells.

[0129] Fig.7D , Heat map of PC profiles in LPS-treated RAW cells. In RAW 264.7 cells, 7A to 7D The median score curves showed a clear classification between the control group, LPS group, and CP leaf extract treated groups, indicating that the pro-inflammatory stimulation of LPS affected the overall lipid profile. A cutoff of p value < 0.05 and FC > 1.2 was applied, and the significantly changed genes were shown in the volcano plot.

[0130] Figure 8 The results show that CP leaf extract treatment modulates various lipid metabolic pathways under inflammatory conditions. Effects of CP leaf extract on proinflammatory regulated lipid metabolic pathways. KEGG pathway diagram of lipid metabolism. Based on the KEGG database, this example Figure 8 The relevant metabolic pathways including glycerophospholipid metabolism, sphingolipid metabolism, ether lipid metabolism, glycerolipid metabolism, unsaturated fatty acid biosynthesis, phosphatidylinositol signaling system, phosphoinositide metabolism, fatty acid degradation, glycosylphosphatidylinositol, fatty acid elongation, and fatty acid biosynthesis involved in the regulatory function of CP leaf extract metabolism were elucidated.

[0131] Example 7: Construction of a predicted target-signaling pathway database for CP leaf extract

[0132] In this example, a predicted target-signaling pathway database of CP leaf extract was constructed to understand the potential pharmacological mechanisms. After characterizing the phytochemical components of CP leaf extract (see Table 2 above), the relevant targets of these compounds were identified (see Table 3) and submitted for 9A to 9C Gene Set Enrichment Analysis (GSEA) in .

[0133] 9A to 9C The construction of the predicted target-signaling pathway database of CP leaf extract is shown. Fig. 9A , CP leaf extract component database. Fig. 9B , gene-gene interaction analysis of predicted targets of CP leaf extract. Fig. 9C , Enrichment analysis of CP leaf extract targets based on the predicted component-target database.

[0134] Table 3. Gene targets of CP components

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173] Gene Ontology (GO)-based GSEA analysis showed that the predicted targets of phytochemical components of CP leaf extract were closely associated with signaling pathways known to be involved in the pathogenesis and progression of skin inflammation.

[0174] The above embodiments are only used to illustrate the present invention, but not to limit the present invention. Those skilled in the art may make various changes and modifications without departing from the essence and scope of the present invention to achieve the same purpose. Therefore, all equivalent technical solutions also belong to the protection scope of the present invention.

Claims

1. A water extract of Cyclocarya paliurus leaves, which is an extract obtained by water extraction of Cyclocarya paliurus leaves, comprising quinic acid, neochlorogenic acid, chlorogenic acid, 4-hydroxybenzoic acid, gallic acid, quercetin 3'-glucuronide, astragalin, kaempferol, quadranoside IV, kaempferol-3-O-glucuronide, kaempferol-3-O-rhamnoside, quercetin and asiatic acid.

2. The Cyclocarya paliurus leaf aqueous extract according to claim 1, which is in liquid or solid state.

3. The Cyclocarya paliurus leaf aqueous extract according to claim 1 or 2, which is prepared according to the following method: Using water as an extraction solvent to extract the Cyclocarya paliurus leaves, the obtained extract is used as the Cyclocarya paliurus leaf water extract or is further concentrated and dried to obtain the Cyclocarya paliurus leaf water extract; Preferably, the Cyclocarya paliurus leaves are dry leaves; Preferably, the Cyclocarya paliurus leaves are extracted with water 1 to 5 times, preferably 2 to 3 times; Preferably, during each extraction, the ratio of Cyclocarya paliurus leaves to water is 1:1-50, more preferably 1:5-20; Preferably, each extraction time is 0.5 to 4 hours, more preferably 1 to 2 hours; Preferably, during extraction, the temperature of water is 80-100°C, more preferably 90-100°C.

4. A method for preparing the Cyclocarya paliurus leaf aqueous extract according to any one of claims 1 to 3, the method comprising: Using water as an extraction solvent to extract the Cyclocarya paliurus leaves, the obtained extract is used as the Cyclocarya paliurus leaf water extract or is further concentrated and dried to obtain the Cyclocarya paliurus leaf water extract; Preferably, the Cyclocarya paliurus leaves are dry leaves; Preferably, the Cyclocarya paliurus leaves are extracted with water 1 to 5 times, preferably 2 to 3 times; Preferably, during each extraction, the ratio of Cyclocarya paliurus leaves to water is 1:1-50, more preferably 1:5-20; Preferably, each extraction time is 0.5 to 4 hours, more preferably 1 to 2 hours; Preferably, during extraction, the temperature of water is 80-100°C, more preferably 90-100°C.

5. Use of the Cyclocarya paliurus leaf aqueous extract according to any one of claims 1 to 3 in the preparation of a product for improving skin barrier function and / or inflammation.

6. The use according to claim 5, wherein: The skin barrier function and / or inflammation is induced by UVB (ultraviolet radiation b); Preferably, the improvement of skin barrier function and / or inflammation comprises one or more of the following specific applications: Improve the expression levels of skin barrier and / or moisturizing related factors in human epidermal keratinocytes; Inhibits UVB-induced oxidative reactions; Inhibits the production of ROS stimulated by UVB; Inhibit UVB-induced pro-inflammatory response; Inhibits IL-1α secretion; Inhibit the production of skin inflammatory factors iNOS, TNF-a, and IL-6; Regulating the lipid metabolism of the skin under inflammatory conditions; preferably, the regulation of the lipid metabolism of the skin under inflammatory conditions includes one or more of the related metabolic pathways including glycerophospholipid metabolism, sphingolipid metabolism, ether lipid metabolism, glycerolipid metabolism, unsaturated fatty acid biosynthesis, phosphatidylinositol signaling system, phosphoinositide metabolism, fatty acid degradation, glycosylphosphatidylinositol, fatty acid elongation, and fatty acid biosynthesis.

7. The use according to claim 5 or 6, wherein: The product for improving skin barrier function and / or inflammation is a cosmetic, preferably a skin care product.

8. A cosmetic comprising the Cyclocarya paliurus leaf aqueous extract according to any one of claims 1 to 3; Preferably, the cosmetic is a gel, cream, lotion, ointment, cream, powder or patch; Preferably, the content of the Cyclocarya paliurus leaf water extract in the cosmetic is 10ppm-400ppm.

9. Application of Cyclocarya paliurus leaf water extract or its phytochemical components in constructing a prediction target-signaling pathway database, wherein: The Cyclocarya paliurus leaf water extract is the water extract according to any one of claims 1 to 3, and the phytochemical components include one or more of quinic acid, neochlorogenic acid, chlorogenic acid, 4-hydroxybenzoic acid, gallic acid, quercetin 3'-glucuronide, astragalin, kaempferol, quadranoside IV, kaempferol-3-O-glucuronide, kaempferol-3-O-rhamnoside, quercetin and asiatic acid; Preferably, the target is as shown in Table 3 or Figure 9C.

10. Application of phytochemical components of Cyclocarya paliurus leaf aqueous extract and / or their predicted targets in screening and / or preparing drugs for improving skin inflammation, wherein: The phytochemical components of the Cyclocarya paliurus leaf water extract include one or more of flavonoids, triterpenoids, organic acids and polysaccharides; Preferably, the phytochemical components of the Cyclocarya paliurus leaf water extract include one or more of quinic acid, neochlorogenic acid, chlorogenic acid, 4-hydroxybenzoic acid, gallic acid, quercetin 3L glucuronide, astragalin, kaempferol, quadranoside IV, kaempferol-3-O-glucuronide, kaempferol-3-O-rhamnoside, quercetin and asiatic acid; Preferably, the target is as shown in Table 3 or Figure 9C.

Images