Salix matsudana 1-aminocyclopropane-1-carboxylate oxidase gene for regulating plant fast-growing property and application thereof

Abstract

The invention provides salix matsudana 1-aminocyclopropane-1-carboxylate oxidase capable of regulating and controlling the fast-growing property of plants as well as a coding gene and application thereof, and relates to the technical field of gene engineering. The gene is derived from salix matsudana and is named as SmACO17 gene, the sequence of the gene is as shown in SEQ ID NO: 1, and the protein coded by the gene is 1-aminocyclopropane-1-carboxylate oxidase. The gene and the protein coded by the gene provided by the invention have the function of 1-aminocyclopropane-1-carboxylate oxidase, the obtained transgenic arabidopsis thaliana containing the SmACO17 gene causes the arabidopsis thaliana to generate changes such as plant height shortening, growth and development slowing and the like, and the ACO17 gene of the salix matsudana is silenced by utilizing an artificially synthesized Silence-ACO17 sequence. After the expression of SmACO17 is inhibited, the plant is higher, the leaf is widened, and the plant has better fast-growing property.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene for regulating plant rapid growth and an application thereof. Background Art

[0002] Forestry plays a very important role in the protection and restoration of terrestrial ecology. Wood is an important industrial raw material and the most stable and economical fiber raw material. It has vital economic and environmental benefits in addressing the global energy crisis, climate change and other issues. China is the world's largest importer of timber. Since 2014, my country's dependence on foreign timber has exceeded 50%. With the global ban on logging of natural forests, my country's timber supply security faces severe challenges. Timber shortages have seriously restricted my country's economic development. Therefore, studying the fast-growing nature of trees is of great significance to alleviating my country's timber shortage. Breeding fast-growing trees is one of the main goals of forestry breeding.

[0003] Due to the production needs of anti-aging and freshness preservation, great progress has been made in the research on the characteristics and expression of ACO genes in flowers and fruits such as carnations and tomatoes. However, the research on fast-growing genes of forest trees is currently progressing slowly, and there are relatively few research reports on ACO in plants of the arbor family. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene for regulating the rapid growth of plants and its application, which has the function of regulating the lignin content and the high growth rate of plants. The gene can be transformed into Arabidopsis thaliana to promote the reduction of the lignin content of Arabidopsis thaliana, inhibit the high growth of Arabidopsis thaliana, and reduce its rapid growth; the artificial sequence of the gene can be transformed into Salix matsudana to promote the synthesis of lignin, promote the high growth of plants and the size of leaves, promote the high growth of plants, and show good rapid growth.

[0005] To solve the above technical problems, an embodiment of the present invention provides a Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene for regulating plant rapid growth, wherein the base sequence of the Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene is shown in SEQ ID NO: 1.

[0006] The gene fragment of the Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene includes Silence-ACO17, and the artificial nucleic acid sequence of Silence-ACO17 is shown in SEQ ID NO:2.

[0007] The invention also provides an application of the Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene in plant rapid growth.

[0008] Among them, the Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene is used to regulate the lignin content of plants and regulate the high growth rate of plants.

[0009] The invention comprises extracting RNA from Salix matsudana and preparing a fast-growing Salix matsudana cDNA template, and constructing a recombinant plasmid, wherein in the step of constructing the recombinant plasmid, the RNA from Salix matsudana is extracted and reverse transcribed to synthesize cDNA, and the amplified sequence of the DNA fragment of the Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene is obtained by PCR reaction, and the nucleotide sequence of the primer is:

[0010] Forward primer: 5′-ATGGTGATCACAAGCTCAGAT-3′;

[0011] Reverse primer: 5′-TCACAGCTTGAAATGTTCTAA-3′.

[0012] The beneficial effects of the above technical solution of the present invention are as follows:

[0013] The 1-aminocyclopropane-1-carboxylic acid oxidase gene of Salix matsudana provided by the present invention has the function of regulating the lignin content and the high growth rate of the plant. The gene can be transformed into Arabidopsis thaliana to promote the reduction of the lignin content of Arabidopsis thaliana, inhibit the high growth of Arabidopsis thaliana, and reduce its rapid growth; the artificial sequence of the gene can be transformed into Salix matsudana to promote the synthesis of lignin, promote the high growth of the plant and the size of the leaves, promote the high growth of the plant, and show good rapid growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a comparison of the expression levels of the SmACO17 gene in Arabidopsis WT and transgenic lines (OE1, OE2, and OE3);

[0015] Figure 2 This is a comparison of plant heights of Arabidopsis WT and SmACO17 transgenic lines (OE1, OE2, OE3);

[0016] Figure 3 Comparison of lignin content between Arabidopsis WT and SmACO17 transgenic lines (OE1, OE2, OE3);

[0017] Figure 4 This is a comparison chart of the expression levels of the SmACO17 gene in Salix matsudana CK and Silence-ACO17 transgenic lines (Si1, Si2, Si3);

[0018] Figure 5 This is a comparison of plant height and leaf width of Salix matsudana CK and Silence-ACO17 lines (Si1, Si2, Si3). Figure 5 A is the comparison chart of plant height in each group. Figure 5B is a comparison of the widest leaf width of each group;

[0019] Figure 6 This is a comparison of lignin content in Salix matsudana CK and Silence-ACO17 transgenic lines (Si1, Si2, Si3);

[0020] Figure 7 Comparison of the xylem cell morphology of the newly grown stems of Salix matsudana CK and Silence-ACO17 transgenic lines (Si1, Si2, Si3) under 4x, 10x, and 40x optical microscopes;

[0021] Figure 8 This is a comparison of the xylem width and vessel cell size of the new stems in Salix matsudana CK and Silence-ACO17 transgenic lines (Si1, Si2, Si3). Figure 8 A is the comparison chart of xylem width of each group. Figure 8 B is a comparison of the sizes of ductal cells in each group. DETAILED DESCRIPTION

[0022] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0023] The embodiment of the present invention provides a Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene for regulating plant rapid growth and application thereof. The base sequence of the Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene is shown in SEQ ID NO:1.

[0024] The gene fragment of the Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene includes Silence-ACO17, and the artificial nucleic acid sequence of Silence-ACO17 is shown in SEQ ID NO:2.

[0025] The 1-aminocyclopropane-1-carboxylic acid oxidase gene of Salix matsudana provided by the present invention has the function of regulating the lignin content and the high growth rate of the plant. The gene can be transformed into Arabidopsis thaliana to promote the reduction of the lignin content of Arabidopsis thaliana, inhibit the high growth of Arabidopsis thaliana, and reduce its rapid growth; the artificial sequence of the gene can be transformed into Salix matsudana to promote the synthesis of lignin, promote the high growth of the plant and the size of the leaves, promote the high growth of the plant, and show good rapid growth.

[0026] The present invention will be further described below by way of examples, but the present invention is not limited to these examples.

[0027] Example 1. Obtaining the coding sequence of the SmACO17 gene

[0028] The tetraploid Salix matsudana variety "9901" was hybridized with the tetraploid Salix matsudana variety "Yanjiangliu" which is widely distributed in the eastern coastal areas of my country. 200 individuals were randomly selected from 3520 F1 progeny to build an F1 population. The simplified genome sequencing of the F1 population and parents was carried out, and QTL positioning was performed. 29 QTLs related to fast growth were found. Combined with the tree height traits that have been investigated, the transcriptome sequencing was carried out on the 6cm position of the top buds of the two parents, the extremely tall progeny and the extremely short progeny after cuttings, and a total of 323 differentially expressed genes were identified.

[0029] The 323 differentially expressed genes were mapped to the reference genome, and 29 fast-growing QTLs were co-localized in the reference genome. An ACO gene was mapped to the QTL of A15, qTH-A15-1. After nucleic acid sequence Blast alignment on the NCBI website (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), it was determined to be the 1-aminocyclopropane-1-carboxylic acid oxidase gene (ACO) of Salix matsudana, named SmACO17.

[0030] RNA was extracted from leaves of Salix matsudana 9901 and reverse transcribed to synthesize cDNA. PCR amplification was performed using primers 1 and 2 to obtain PCR product 1, namely, the SmACO17 cDNA sequence, whose gene coding sequence is shown in SEQ ID NO:1.

[0031] Primer 1: SmACO17 CDS-F: 5′-ATGGTGATCACAAGCTCAGAT-3′;

[0032] Primer 2: SmACO17 CDS-R: 5′-TCACAGCTTGAAATGTTCTAA-3′;

[0033] PCR reaction conditions: pre-denaturation at 95°C for 3 min, 95°C for 30 sec, 56°C for 30 sec, 72°C for 50 sec, for a total of 30 cycles; extension at 72°C for 5 min.

[0034] The above gene coding sequences can all be obtained through artificial synthesis and in vitro PCR amplification technology.

[0035] Example 2: Expression of SmACO17 gene

[0036] (1) Obtaining the recombinant T vector containing the SmACO17 gene

[0037] The acquisition of the recombinant T vector includes the following steps:

[0038] The PCR product 1 obtained in Example 1 was connected to the pGEM-T vector (Promega), and the obtained ligation product was transformed into Escherichia coli DH5α competent cells (purchased from Tiangen Company), and spread on LB solid culture medium containing 5-bromo-4-chloro-3-indole--D-galactoside, X-gal and 100ug / ml ampicillin and cultured overnight. A single white colony was picked, cultured in LB liquid culture medium overnight, and colony PCR identification and sequence determination were performed.

[0039] The sequencing results of the pGEM-T vector recombinant plasmid showed that the plasmid was a recombinant vector in which the SmACO17 gene shown in SEQ ID NO: 1 or SEQ ID NO: 3 in the sequence list was inserted into the pGEM-T vector, and was named pGEM-T-SmACO17.

[0040] (2) Obtaining a recombinant plant expression vector containing the SmACO17 gene

[0041] The acquisition of the recombinant plant expression vector comprises the following steps:

[0042] Connecting plant expression vector pWM101: Using the pGEM-T-SmACO17 plasmid obtained in step (1) as a template, PCR amplification was performed using primers 3 and 4 to obtain PCR product 2. Primers 3 and 4 are represented as follows:

[0043] Primer 3: pWM101-SmACO17-F

[0044] TCGAGCTTTCGCGAGCTCGGTACCATGGTGATCACAAGCTCAGAT;

[0045] Primer 4: pWM101-SmACO17-R

[0046] GCATGCCTGCAGGTCGACTCTAGATCACAGCTTGAAATGTTCTAA;

[0047] The two ends of PCR product 2 were added with 24 nucleotide sequences of the plant expression vector pWM101, and contained KpnI and XbaI restriction sites, respectively.

[0048] Obtaining the recombinant plant expression vector: The obtained PCR product 2 and the pWM101 vector linearized by KpnI and XbaI were recombined and ligated, the ligation product was transformed with Escherichia coli DH5α competent cells (purchased from Tiangen Company), and spread on LB plates containing 50ug / ml kanamycin and cultured overnight, single colonies were picked, cultured in LB liquid culture medium overnight, and colony PCR identification and sequence determination were performed.

[0049] The sequencing results of the recombinant plasmid showed that the plasmid was a recombinant vector in which the SmACO17 gene shown in SEQ ID NO: 2 in the sequence table was inserted into the vector pWM101, and was named pWM101-SmACO17.

[0050] (3) Obtaining SmACO17 transgenic Arabidopsis

[0051] The recombinant plant expression vector pWM101-SmACO17 obtained in step (2) is transformed into competent cells of Agrobacterium GV3101 to obtain the recombinant bacteria GV3101 / pWM101-SmACO17, and the recombinant bacteria GV3101 / pWM101-SmACO17 are transformed into Columbia ecotype wild-type Arabidopsis thaliana (Col-0) (purchased from ABRC) by the inflorescence dip method, and the positive transgenic strains T1 generation are screened by MS medium containing 50 mg / L Hyg (hygromycin). After two generations of cultivation and screening, the T1 generation transgenic strains are obtained. Homozygous T3 generation SmACO17 gene transgenic Arabidopsis seeds are obtained, and the T3 generation transgenic Arabidopsis seeds are directly sown into culture soil and grow normally under long-day conditions in a greenhouse to obtain transgenic Arabidopsis thaliana.

[0052] (4) Detection and analysis of transgenic Arabidopsis thaliana with SmACO17 gene

[0053] (4-1) RT-PCR detection of SmACO17 gene expression level

[0054] RNA was extracted from the whole plants of T3 transgenic SmACO17 Arabidopsis lines (OE1, OE2, OE3) and wild-type Arabidopsis (WT), and cDNA was obtained by reverse transcription. It was used as a template for PCR amplification using primers 5 and 6. (Wild-type Arabidopsis was used as a control)

[0055] Primer 5: 5′-CCTGGGAGATATGTTACAGTT-3′

[0056] Primer 6: 5′-GCATAGTAGTGAGTCACGAAG-3′.

[0057] The results are as follows Figure 1 As shown, the expression levels of SmACO17 in the two T3 generation SmACO17 transgenic Arabidopsis lines (OE1, OE2, OE3) were significantly higher than that in the wild-type Arabidopsis (WT), indicating that the SmACO17 gene was expressed at a high level in the T3 generation SmACO17 transgenic Arabidopsis.

[0058] (4-2) Analysis of dwarf phenotype of SmACO17-transgenic Arabidopsis

[0059] The phenotypes of T3 transgenic SmACO17 Arabidopsis lines (OE1, OE2, OE3) and wild-type Arabidopsis (WT) were measured at different growth stages.

[0060] The results are as follows Figure 2 As shown, compared with the wild type (WT), the transgenic Arabidopsis plants (OE1, OE2, OE3) overexpressing the transgene were shorter at different growth stages ( Figure 2 A. Figure 2 B. Figure 2 C), the main stem is thinner, and the stem leaves and rosette leaves are smaller ( Figure 2 D), and the flowering time of the transgenic lines was late. Statistical analysis of plant height showed that the plant heights of SmACO17 transgenic lines (OE1, OE2, OE3) were significantly lower than those of wild-type Arabidopsis thaliana (WT).

[0061] (4-3) Determination of lignin content in SmACO17-transgenic Arabidopsis

[0062] The three T3 transgenic SmACO17 (OE1, OE2, OE3) lines and wild-type Arabidopsis thaliana (WT) obtained in step (3) were transplanted into vermiculite and cultured in a greenhouse (16h / 8h light-dark cycle, 20-22°C) for 3 weeks.

[0063] The lignin content of the wild type (WT) and T3 transgenic lines was calculated using the method provided by the plant lignin content determination kit (purchased from Suzhou Gres Biotechnology Co., Ltd.).

[0064] The results are as follows Figure 3 As shown, the lignin content in the three T3 transgenic SmACO17 Arabidopsis lines (OE1, OE2, and OE3) was significantly lower than that in wild-type Arabidopsis (WT).

[0065] In summary, it was shown that the transformation of SmACO17 gene into Arabidopsis thaliana could promote the reduction of lignin content in Arabidopsis thaliana, inhibit the high growth of Arabidopsis thaliana, and reduce its rapid growth.

[0066] Example 3: Transgenic Salix matsudana with Silence-ACO17 sequence inhibits the expression of SmACO17

[0067] (1) Obtaining the Silence-ACO17 sequence by artificial synthesis

[0068] An artificial miRNA precursor sequence containing an ACO17-specific fragment was designed and named Silence-ACO17, and the sequence was synthesized by artificial synthesis (synthesized by Suzhou GeneWeizhi Biotechnology Co., Ltd.).

[0069] (2) Obtaining a recombinant silencing vector containing the Silence-ACO17 sequence

[0070] (2-1) Ligation of plant expression vector pYL156: Using the Silence-ACO17 sequence obtained in step (1) as a template, PCR amplification was performed using primers 9 and 10 to obtain PCR product 4. Primers 9 and 10 are represented as follows:

[0071] Primer 9: pYL156-Silence-ACO17-F:

[0072] TAAGGTTACCGAATTCAAATGGGCAAATTAGT;

[0073] Primer 10: pYL156-Silence-ACO17-R:

[0074] CGAGACGCGTGAGCTCAATGGGCAAATTAG;

[0075] The two ends of PCR product 4 were added with 16 nucleotide sequences of the plant expression vector pYL156, and contained Ecor1 and Sac1 restriction sites, respectively.

[0076] (2-2) Obtaining the recombinant plant expression vector: The obtained PCR product 4 and the pYL156 vector linearized by EcoR1 and Sac1 were recombined and ligated. The ligated product was transformed into Escherichia coli DH5α competent cells (purchased from Tiangen Company) and spread on LB plates containing 50ug / ml kanamycin and cultured overnight. A single colony was picked, cultured in LB liquid culture medium overnight, and colony PCR identification and sequence determination were performed.

[0077] The sequencing results of the recombinant plasmid showed that the plasmid was a recombinant vector in which the Silence-ACO17 sequence shown in SEQ ID NO: 3 in the sequence table was inserted into the vector pYL156, and was named pYL156-Silence-SmACO17.

[0078] (3) Obtaining the Silence-ACO17 sequence of Salix matsudana

[0079] The recombinant silencing vector pYL156-Silence-SmACO17 obtained in step (2) was transformed into competent cells of Agrobacterium GV3101 to obtain recombinant bacteria GV3101 / pYL156-Silence-SmACO17. TRV1 and TRV2 empty vectors were used to transform the recombinant bacteria GV3101 / pYL156-Silence-SmACO17.

[0080] Use a needle to make small holes in the leaves and roots of the cuttings of Salix matsudana that have been cultured in clear water for 14 days, and soak the leaves and roots in a 1:1 Agrobacterium mixture containing TRV1, TRV2-pYL156-Silence-SmACO17 or TRV2 empty vector. Use a vacuum pump to generate negative pressure to infiltrate the Agrobacterium solution into the plant tissue. After infiltration, cover the plants with plastic bags to keep them moist and culture them in the dark at 18°C ​​overnight, then transfer the plants to the greenhouse. They grow normally under long-day conditions in the greenhouse to obtain Salix matsudana with the Silence-ACO17 sequence.

[0081] (4) RT-PCR detection of SmACO17 gene expression level

[0082] 14 days after Agrobacterium infection, RNA was extracted from new leaves of Salix matsudana transfected with Silence-ACO17 sequence and control Salix matsudana transfected with empty vector (CK), and reverse transcribed to obtain cDNA, which was used as a template for PCR amplification using primers 11 and 12. The control Salix matsudana transfected with empty vector was used as a control. The primers are as follows:

[0083] Primer 11: 5'-CCTGGGAGATATGTTACAGTT-3',

[0084] Primer 12: 5′-GCATAGTAGTGAGTCACGAAG-3′.

[0085] The results are as follows Figure 4 As shown, the expression level of SmACO17 gene in the Silence-ACO17 transgenic lines (Si1, Si2, Si3) was significantly reduced compared with the control Salix matsudana plants (CK).

[0086] (5) Comparison of leaf width and plant height of Salix matsudana with Silence-ACO17 sequence

[0087] After Agrobacterium infection, the phenotypes of Salix matsudana plants transformed with the Silence-ACO17 sequence and the control Salix matsudana plants transformed with an empty vector (CK) were measured and statistical analysis was performed.

[0088] The results showed that compared with CK, the Salix matsudana plants (Si1, Si2, and Si3) transgenic with the Silence-ACO17 sequence grew faster at different growth stages, such as Figure 5 A. Figure 5 As shown in B, the leaf width and plant height were measured on the 28th day after Agrobacterium infection. The Silence-ACO17 transgenic lines (Si1, Si2, Si3) had wider leaf width and higher plant height.

[0089] (6) Comparison of lignin content of Salix matsudana in transgenic Silence-ACO17 sequences

[0090] The Salix matsudana plants transformed with the Silence-ACO17 sequence obtained in step (3) and the control Salix matsudana plants transformed with an empty vector (CK) were transplanted into vermiculite and cultured in a greenhouse (16h / 8h light-dark cycle, 20-22°C) for up to 5 weeks.

[0091] The lignin content of the Salix matsudana plants transformed with the Silence-ACO17 sequence and the control Salix matsudana plants transformed with an empty vector was measured using the method provided by the plant lignin content determination kit (purchased from Suzhou Grace Biotechnology Co., Ltd.), and the average value of each group was calculated.

[0092] The results of lignin content determination are as follows Figure 6 As shown, the lignin in the Silence-ACO17 transgenic lines (Si1, Si2, Si3) was significantly higher than that in the empty vector control (CK).

[0093] (7) Comparison of Salix matsudana slices with Silence-ACO17 sequence

[0094] Take the 7-8 internodes of the new stem of the Salix matsudana plant transformed with the Silence-ACO17 sequence obtained in step (6) and cultured for 6 weeks and the control Salix matsudana plant (CK) transformed with the empty vector, cut it into 25um slices using Leica's HistoCore fully automatic rotary slicer, stain it with 1% toluidine blue for 1 minute, and use an optical microscope (Olympus bx43) to observe the morphology of the xylem after sealing. Randomly select the field of view for photography when the eyepiece is 10 times and the objective lens is 4 times, 10 times, and 40 times respectively. Figure 7 As shown, under light microscopy, the transgenic Silence-ACO17 lines (Si1, Si2, Si3) had wider diameters and xylem widths, larger xylem cells, and larger vascular lumen areas than the control Salix matsudana plants (CK).

[0095] The imageJ software was used to measure the xylem width under the random field of view of 10x eyepiece and 10x objective lens; the imageJ software was used to measure the average area of ​​the xylem vessel lumen under the random field of view of 10x eyepiece and 40x objective lens, and SPSS was used for statistical analysis.

[0096] The specific measurement results are as follows: Figure 8 A and Figure 8 As shown in B, compared with the control Salix matsudana plants (CK), the xylem width and xylem vessel area of ​​the transgenic Silence-ACO17 lines (Si1, Si2, Si3) at the same internode were significantly increased.

[0097] The above results show that the transformation of the Silence-ACO17 sequence into Salix matsudana can promote the synthesis of lignin, promote the height growth of the plant and the size of the leaves, promote the height growth of the plant, and show good rapid growth.

[0098] In summary, the Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene provided by the present invention has the function of regulating lignin content and high plant growth rate, which is specifically manifested as follows:

[0099] Transforming this gene into Arabidopsis thaliana can promote the reduction of Arabidopsis thaliana's lignin content, inhibit Arabidopsis thaliana's high growth, and reduce its rapid growth; transforming the artificial sequence of this gene into Salix matsudana can promote the synthesis of lignin, promote plant height growth and leaf size, promote plant height growth, and show good rapid growth.

[0100] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Therefore, any simple modification or equivalent change made to the above embodiment according to the technical essence of the present invention without departing from the content of the technical solution of the present invention shall be deemed as the protection scope of the present invention.

Claims

1. A Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene for regulating plant rapid growth, characterized in that: The base sequence of the Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene is shown in SEQ ID NO:

1.

2. The Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene for regulating plant rapid growth according to claim 1, characterized in that: The gene fragment of the Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene includes Silence-ACO17, and the artificial nucleic acid sequence of Silence-ACO17 is shown in SEQ ID NO:

2.

3. Application of a Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene in plant rapid growth.

4. The use of the Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene in plant rapid growth according to claim 3, characterized in that: The application of the Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene in regulating plant lignin content and regulating plant high growth rate.

5. The use of the Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene in plant fast growth according to claim 3, comprising extracting Salix matsudana RNA and preparing a plant fast growth Salix matsudana cDNA template, and constructing a recombinant plasmid, characterized in that: In the construction step of the recombinant plasmid, RNA from Salix matsudana was extracted and reverse transcribed to synthesize cDNA, and the amplified sequence of the DNA fragment of the Salix matsudana 1-aminocyclopropane-1-carboxylic acid oxidase gene was obtained by PCR reaction. The nucleotide sequence of the primer is: Forward primer: 5′-ATGGTGATCACAAGCTCAGAT-3′; Reverse primer: 5′-TCACAGCTTGAAATGTTCTAA-3′.

Images