Chimeric gene for improving genetic transformation efficiency of potatoes as well as vector and application of chimeric gene

Abstract

The invention discloses a chimeric gene for improving genetic transformation efficiency of potatoes as well as a vector and application of the chimeric gene, and belongs to the technical field of plant genetic engineering. According to the chimeric gene capable of improving the genetic transformation efficiency of the potatoes as well as the vector and the application of the chimeric gene, GRF4 and GIF1 genes are identified from the potatoes, a StGRF4-GIF1 chimeric gene sequence is synthesized, and the potato StGRF4-GIF1 chimeric gene overexpression vector is constructed. Potato 'E109' C9701 'RH' S15 'is taken as a material, a potato tissue culture seedling stem segment is subjected to genetic transformation by an agrobacterium-mediated method, the bud regeneration rate of an obtained transformed potato StGRF4-GIF1 chimeric gene overexpression vector explant is higher than that of a control, the genetic transformation efficiency of potatoes is improved, and it is proved that the StGRF4-GIF1 chimeric gene has a promoting effect on potato regeneration.

Description

Technical Field

[0001] The invention relates to the technical field of plant gene engineering, and more particularly to a chimeric gene for improving potato genetic transformation efficiency, a vector thereof and an application thereof. Background Art

[0002] Potatoes belong to the Solanaceae family, and are an important dual-purpose crop for food and vegetables. They are widely grown around the world due to their high yield, wide adaptability, and rich nutrition, and play an important role in ensuring food security and increasing farmers' income.

[0003] At present, the potatoes widely cultivated in my country are autotetraploid asexually propagated crops with highly heterozygous genetic backgrounds. Traditional vegetative line hybrid breeding takes a long time, occupies a large area of ​​arable land, and is not easy to breed excellent varieties. CRISPR / Cas technology has made it possible to efficiently mine genetic resources and genetically breed potatoes, and has been applied in basic biological research and genetic improvement of potatoes. Although a stable genetic transformation system has been established in a few varieties, due to the serious genotype dependence problem of potato genetic transformation, there are still more potato varieties to improve the efficiency of genetic transformation.

[0004] The use of developmental regulatory factors can improve the efficiency of genetic transformation to a certain extent. The latest research found that, unlike other developmental regulatory factors, GRF-GIF chimeras can promote plant regeneration without obvious developmental defects, and have been verified in a variety of food crops and cash crops.

[0005] Therefore, providing a chimeric gene and its vector and application for improving the genetic transformation efficiency of potato is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0006] In view of this, the present invention provides a chimeric gene for improving potato genetic transformation efficiency and a vector and application thereof, so as to solve the problem of low potato genetic transformation efficiency.

[0007] The present invention overexpresses the StGRF4-StGIF1 chimera in potatoes to solve the problem of genetic transformation receptor preference.

[0008] In order to achieve the above object, the present invention adopts the following technical solution:

[0009] A potato StGRF4-GIF1 chimeric gene, the sequence of the StGRF4-GIF1 chimeric gene is shown as SEQ ID NO.3.

[0010] Furthermore, a plant overexpression vector contains the StGRF4-GIF1 chimeric gene.

[0011] Furthermore, a transgenic Agrobacterium contains the plant overexpression vector.

[0012] Furthermore, the Agrobacterium is GV3101.

[0013] Furthermore, the StGRF4-GIF1 chimeric gene, the plant overexpression vector, or the transgenic Agrobacterium is used to improve the genetic transformation efficiency of potatoes.

[0014] Furthermore, the StGRF4-GIF1 chimeric gene, the plant overexpression vector, or the transgenic Agrobacterium is used to improve the bud regeneration rate.

[0015] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses a chimeric gene and its vector and application for improving the genetic transformation efficiency of potatoes, which have the following beneficial effects:

[0016] (1) The present invention identifies GRF4 and GIF1 genes from potatoes, synthesizes the StGRF4-GIF1 chimeric gene sequence, and constructs a potato StGRF4-GIF1 chimeric gene overexpression vector. Using potato 'E109''C9701''RH''S15' as the material, the potato tissue culture seedling stem segment is genetically transformed by Agrobacterium-mediated method, and the bud regeneration rate of the transformed potato StGRF4-GIF1 chimeric gene overexpression vector explant is higher than that of the control, which improves the potato genetic transformation efficiency and confirms that the StGRF4-GIF1 chimeric gene has a promoting effect on potato regeneration.

[0017] (2) The present invention improves the bud regeneration rate during potato genetic transformation by using the StGRF4-GIF1 chimeric gene, which is of great significance for improving potato genetic transformation efficiency and accelerating potato functional gene research and new variety breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0019] Figure 1 The accompanying drawing is a vector map of the present invention;

[0020] A: Overexpression vector pCAMBIA1300-StGRF4-GIF1-Kan-GFPuv map; B: Empty vector pCAMBIA1300-Kan-GFPuv map;

[0021] Figure 2 The accompanying drawings show the explants of the transformation control vector and the StGRF4-GIF1 chimeric gene overexpression vector of the present invention;

[0022] Figure 3 The accompanying drawings show the bud regeneration rates of the transformation control vector (control) and the StGRF4-GIF1 chimeric gene overexpression vector of the present invention;

[0023] Figure 4 The accompanying drawings show the genetic transformation efficiency of the transformation control vector (control) and the StGRF4-GIF1 chimeric gene overexpression vector of the present invention;

[0024] Figure 5 The accompanying drawings show the phenotypes of the wild-type plants (control) and the StGRF4-GIF1 chimeric gene overexpressing plants grown in a greenhouse for 5 weeks and in a greenhouse for 5 weeks;

[0025] Figure 6 The accompanying drawings are data graphs of plant height and stem diameter of wild-type plants (control) and StGRF4-GIF1 chimeric gene overexpressing plants grown in a greenhouse for 5 weeks and in a greenhouse for 5 weeks;

[0026] Figure 7 The accompanying drawings show the phenotypes of the wild-type plants (control) and the StGRF4-GIF1 chimeric gene overexpressing plants of the present invention grown in a greenhouse for 5 weeks and in a greenhouse for 10 weeks;

[0027] Figure 8 The accompanying drawings are data graphs of plant height and stem diameter of wild-type plants (control) and StGRF4-GIF1 chimeric gene overexpressing plants grown in a greenhouse for 5 weeks and in a greenhouse for 10 weeks;

[0028] Fig. 9 The accompanying drawings show the phenotypes of leaves of wild-type plants (control) and plants overexpressing the StGRF4-GIF1 chimeric gene of the present invention;

[0029] Fig.10 The attached drawings show the phenotypes of flowers of the wild-type plant (control) and the plant overexpressing the StGRF4-GIF1 chimeric gene of the present invention. DETAILED DESCRIPTION

[0030] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0031] The coding region sequence of the StGRF4 gene is shown in SEQ ID NO.1.

[0032]

[0033] The coding region sequence of the StGIF1 gene is shown in SEQ ID NO.2.

[0034] ATGCAGCAGCAGCACCTGATGCAGATGCAGCCCATGATGGCAGCCTATTATCCCAACAATGTCACTACTGATCATATTCAACAGTTCCTGGATGAGAACAAATCACTTATTCTGAAGATTGTTGAGAGCCAGAACTCTGGGAAAATAAGTGAATGTGCAGAGTCCCAAGCTAAACTTCAGAGAAATCTTATGTACCTTGCAGCTATTGCTGATTCACAGCCCCAGCCTCCTAGTATGCATTCACAGTTAGCTTCTGGTGGGATGATGCAGGGAGGGGCACATTATATGCAACAACAACAAGCTCAACAACTAACAACGCAATCGCTTATGGCTGCAGCAAGATCCTCCTCCTCAATGCTCTATGGACAACAACAACAACAACAATTATCATCATTGCAACAACAGCAAGCAGCCTATCATAGCCAGCAACTCGGAATGAGCAGCTCTGGTGGAGGAAGCAGTAGTGGACTTCACATGCTACAAAGCGAAAACACTCATAATGCTAGCATTGGTGGTGGTGGTTTCCCTGACTTTGGCAGAGGATTAGGCAGTGGAAACAAGCATGAAATGGGAAGTTCTATGTCTGATCAAGGACGGGGCGGAAGCTCAAGTGGTCATGGTGGTGATGGAGGTGAGAATCTTTACTTGAAATCTTCTGAAGATGGGAATTAA; SEQ ID NO.2.

[0035] The sequence of the StGRF4-GIF1 chimeric gene is shown in SEQ ID NO.3.

[0036] GCCGCCGCCGCC ATGCAGCAGCAGCACCTGATGCAGATGCAGCCCATGATGGCAGCCTATTATCCCAACAATGTCACTACTGATCATATTCAACAGTTCCTGGATGAGAACAAATCACTTATTCTGAAGATTGTTGAGAGCCAGAACTCTGGGAAAATAAGTGAATGTGCAGAGTCCCAAGCTAAACTTCAGAGAAATCTTATGTACCTTGCAGCTATTGCTGATTCACAGCCCCAGCCTCCTAGTATGCATTCACAGTTAGCTTCTGGTGGGATGATGCAGGGAGGGGCACATTATATGCAACAACAACAAGCTCAACAACTAACAACGCAATCGCTTATGGCTGCAGCAAGATCCTCCTCCTCAATGCTCTATGGACAACAACAACAACAACAATTATCATCATTGCAACAACAGCAAGCAGCCTATCATAGCCAGCAACTCGGAATGAGCAGCTCTGGTGGAGGAAGCAGTAGTGGACTTCACATGCTACAAAGCGAAAACACTCATAATGCTAGCATTGGTGGTGGTGGTTTCCCTGACTTTGGCAGAGGATTAGGCAGTGGAAACAAGCATGAAATGGGAAGTTCTATGTCTGATCAAGGACGGGGCGGAAGCTCAAGTGGTCATGGTGGTGATGGAGGTGAGAATCTTTACTTGAAATCTTCTGAAGATGGGAATTAA; SEQ ID NO.3。

[0037] The GFPuv sequence is shown in SEQ ID NO.9.

[0038]

[0039] Example 1

[0040] 1) Construction of plant overexpression vector pCAMBIA1300-StGRF4-GIF1-Kan-GFPuv

[0041] Primers capable of amplifying potato GRF4 and potato GIF1 were designed based on the CDS sequences of StGRF4 and StGIF1, respectively. Diploid potato (DM) materials were used as the gene amplification materials for StGRF4 and StGIF1. RNA was extracted using AG RNAex ProRNA extraction reagent (Hunan Aikerui Biotechnology Co., Ltd.) according to the instructions, and reverse transcription was performed according to the instructions of the Evo M-MLV RT-PCR kit (Hunan Aikerui Biotechnology Co., Ltd.), and the cDNA products were stored at -20°C. Primers required for amplifying StGRF4 and StGIF1 genes were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the CDS sequence of the StGRF4 gene (as shown in SEQ ID NO.1) and the CDS sequence of the StGIF1 gene (as shown in SEQ ID NO.2) were amplified using a high-fidelity PCR reaction system using KOD-Plus-Neo (Toyobo (Shanghai) Biotechnology Co., Ltd.).

[0042] The StGRF4-GIF1 chimeric gene (shown in SEQ ID NO. 3) is composed of StGRF4 and StGIF1 genes connected by a linker sequence (GCCGCCGCCGCC; SEQ ID NO. 4).

[0043] Among them, the StGRF4 and StGIF1 gene cloning primers are as follows:

[0044] StGRF4-F: 5'-CCGGGTACCGAGCTCGAATTCATGGGGTATGGATATGGTTAC-3'; SEQ IDNO.5;

[0045] StGRF4-R: 5'-GGTGCTGCTGCTGCAT GCCGCCGCCGCC AGTATCATTTGGGGAGCA AGCA-3'; SEQ ID NO.6;

[0046] StGIF1-F: 5'-CCGGGTACCGAGCTCGAATTCATGCAGCAGCAGCACCTGATGC-3'; SEQ IDNO.7;

[0047] StGIF1-R: 5'-CATTATTATGGAGAAACTCGAGCTTGTCGATCGACAGATCCGGTCGGCATCTACTTTAATTCCCATCTTCAGAAGAT-3'; SEQ ID NO. 8.

[0048] The specific steps of vector construction are as follows: pCAMBIA1300 plasmid is digested with EcoR I and Xho I enzymes to obtain a pCAMBIA1300 linear vector with CaMV 35S promoter and HygR removed from the pCAMBIA1300 plasmid.

[0049] StGIF1-F and StGIF1-R were used to amplify the StGIF1 gene fragment, and the pCAMBIA1300 linear vector and the StGIF1 fragment were subjected to homologous recombination reaction using ClonExpress II OneStep Cloning Kit-C112 (Novogene Biotech Co., Ltd.) to obtain the intermediate vector pCAMBIA1300-StGIF1.

[0050] StGRF4-F and StGRF4-R were used to amplify the StGRF4 gene fragment, and the intermediate vector pCAMBIA1300-StGIF1 was digested with EcoR I enzyme; the intermediate vector pCAMBIA1300-StGIF1 digestion product and the StGRF4 fragment were subjected to homologous recombination reaction using ClonExpress IIOne Step Cloning Kit-C112 to obtain the intermediate vector pCAMBIA1300-StGRF4-GIF1.

[0051] The element promoter driving the StGRF4-GIF1 chimeric gene was amplified in potato DM genomic DNA using StUBI10pro-PF and StUBI10pro-PR to obtain the StUBI10pro fragment; the intermediate vector pCAMBIA1300-StGRF4-GIF1 was digested with EcoR I enzyme; the intermediate vector pCAMBIA1300-StGRF4-GIF1 digestion product and the StUBI10pro fragment were subjected to homologous recombination reaction using ClonExpress II One Step Cloning Kit-C112 to obtain the intermediate vector pCAMBIA1300-StGRF4-GIF1-P.

[0052] The expression frame of the kanamycin resistance gene of the pCAMBIA2300 plasmid was amplified using KAN-PF and KAN-PR to obtain the kanamycin resistance gene expression frame fragment; the intermediate vector pCAMBIA1300-StGRF4-GIF1-P was digested with EcoR I enzyme; the digested product of the intermediate vector pCAMBIA1300-StGRF4-GIF1-P and the kanamycin resistance gene expression frame fragment were subjected to homologous recombination reaction using ClonExpress IIOne Step Cloning Kit-C112 to obtain the intermediate vector pCAMBIA1300-StGRF4-GIF1-Kan.

[0053] The GFPuv sequence shown in SEQ ID NO.9 was used as a template, St-GFPuv-F and GFPuv-R were used as primers, and the GFPuv fragment was amplified using the Phanta Max high-fidelity kit (Novogene Biotech Co., Ltd.). The pCAMBIA1300-StGRF4-GIF1-Kan vector was digested with EcoRI, and the intermediate vector pCAMBIA1300-StGRF4-GIF1-Kan digestion product and the GFPuv fragment were homologously recombined using ClonExpress IIOne StepCloning Kit-C112 to complete the pCAMBIA1300-StGRF4-GIF1-Kan-GFPuv vector (see the map) Figure 1 A) construction.

[0054] The primers for StUBI10pro-PF and StUBI10pro-PR, Kan-PF and Kan-PR, St-GFPuv-F and GFPuv-R are as follows:

[0055] StUBI10pro-PF: 5'-ATATCCATACCCCATCTTGAAAGAGAAATTTGAAG-3'; SEQ ID NO.10;

[0056] StUBI10pro-PR: 5'-CCGGGTACCGAGCTCGAATTCCATTTTGAGGAACTACATACCAT-3'; SEQID NO.11;

[0057] Kan-PF: 5'-TAGTTCCTCAAAATGTTGGCGCGCCAATTGGCTAGAGCAGCTTGCCA AC-3'; SEQ ID NO.12;

[0058] Kan-PR: 5'-CCGGGTACCGAGCTCGAATTCGATCTGGATTTTAGTACTGG-3'; SEQ ID NO.13;

[0059] St-GFPuv-F:5'

[0060] -CCAGTACTAAAATCCAGATCGAATTCTGAGACTTTTCAACAAAGGGTA A-3'; SEQ ID NO.14;

[0061] GFPuv-R: 5'-CGGGTACCGAGCTCGAATTCTGTGTACAGATATATGTTGAATT-3'; SEQ ID NO. 15.

[0062] 2) Construction of pCAMBIA1300-Kan-GFPuv empty vector:

[0063] Based on the pCAMBIA1300 vector, the vector was digested with EcoR I and Xho I enzymes to obtain the pCAMBIA1300 linear vector without CaMV35S promoter and HygR. Using pCAMBIA2300 as a template, Kan-1300-F and Kan-1300-R as primers (Beijing Qingke Biotechnology Co., Ltd.), the Kan fragment was amplified using the PhantaMax high-fidelity kit (Novozyme Biotechnology Co., Ltd.). The specific primer sequences are as follows:

[0064] Kan-1300-F: 5'

[0065] -ATTATTATGGAGAAAGGCGCGCCAATTGGCTAGAGCAGCTTGCCAAC-3'; SEQ ID NO. 16;

[0066] Kan-1300-R: 5'-CGGGTACCGAGCTCGAATTCATGTACTGAATTAACGCCGAATT-3'; SEQ ID NO. 17.

[0067] The PCR amplification system was 50 μL: 2×PhantaMax Buffer 25 μL, sterile ddH2O 18 μL, upstream and downstream primers 2 μL each (primer concentration was 10 μM), dNTP Mix 1 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, and template (here pCAMBIA2300) 1 μL.

[0068] PCR amplification program: 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, 34 cycles; 72°C for 5 min; 4°C∞.

[0069] The amplified Kan fragment was homologously recombined with the pCAMBIA1300 linear vector using ClonExpress II One Step Cloning Kit-C112 to complete the construction of the pCAMBIA1300-Kan vector.

[0070] The GFPuv sequence shown in SEQ ID NO.9 was used as a template, GFPuv-F and GFPuv-R were used as primers, and the GFPuv fragment was amplified using the PhantaMax high-fidelity kit. The specific primer sequences are as follows:

[0071] GFPuv-F:5'

[0072] -GCGTTAATTCAGTACATGAATTCTGAGACTTTTCAACAAAGGGTAAT-3'; SEQ ID NO.18;

[0073] GFPuv-R: same as above.

[0074] The PCR amplification system was the same as above.

[0075] PCR amplification program: 95℃5min; 95℃30s, 55℃30s, 72℃1min 10s, 34 cycles; 72℃5min; 4℃∞. The pCAMBIA1300-Kan vector was digested with EcoRI (NEB (Beijing) Co., Ltd.) and homologously recombined with the GFPuv fragment using ClonExpress IIOne Step Cloning Kit-C112 to complete the pCAMBIA1300-Kan-GFPuv vector (see the map) Figure 1 B) construction.

[0076] Example 2 Potato genetic transformation

[0077] The transgenic Agrobacterium was transformed into potato RH, E109, C9701, and S15-65 tissue culture seedling stem segments using the Agrobacterium-mediated method. The specific operations are as follows:

[0078] 1) Obtaining transgenic Agrobacterium

[0079] The StGRF4-GIF1 chimeric gene overexpression vector pCAMBIA1300-StGRF4-GIF1-Kan-GFPuv was transformed into Agrobacterium GV3101 competent cells by electroporation; at the same time, the control vector, i.e., empty pCAMBIA1300-Kan-GFPuv, was transformed into Agrobacterium GV3101 competent cells by electroporation; after electroporation, the corresponding bacterial liquid was spread on LB solid culture medium containing 50 mg / L Kan and 50 mg / L Rif, and a single colony was picked and inoculated into 600 μL LB liquid culture medium containing the same concentration of antibiotics in a 1.5 mL centrifuge tube, and cultured at 28°C and 200 rpm for 16 hours, and the bacterial liquid was PCR and sequenced to obtain transgenic Agrobacterium. The primers used for pCAMBIA1300-Kan-GFPuv bacterial liquid detection are as follows:

[0080] GFPuv-F: 5'-GAGTTGGTTGGAGGTGGAG-3'; SEQ ID NO. 19;

[0081] GFPuv-R: 5'-TCCCTCGCCTCGTTTTACTC-3'; SEQ ID NO. 20.

[0082] The primers used for pCAMBIA1300-StGRF4-GIF1-Kan-GFPuv bacterial liquid detection are as follows:

[0083] GRF-qF: 5'-TCAGAGTTCCcGAATTAGCAACA-3'; SEQ ID NO. 21;

[0084] GRF-qR: 5'-CAAATTACAACTGGGAGCAGCAA-3'; SEQ ID NO. 22.

[0085] 2) Genetic transformation

[0086] Explant preparation:

[0087] Stem segments of sterile test tube seedlings of about three weeks old with robust growth were selected as explants. The sterile test tube seedlings were propagated in MS medium with 3% (w / v) sucrose concentration, cultured under long-day conditions (16h / d) and 20±2°C for 3 weeks, and then stem segments of about 0.5 cm without axillary buds were taken for transformation.

[0088] Pre-breeding:

[0089] Place internode stem segments of about 0.5 cm (be careful not to cut the axillary buds and terminal buds) in pre-culture medium and culture in a 23±2°C incubator with long daylight (16 h / d) for two days.

[0090] The formula of the pre-culture medium is as follows: spread sterile filter paper on R3B [3% MS + 2 mg / L NAA + 1 mg / L Trans-ZT + 2.2 g / L plant gel (Beijing Coolbo Technology Co., Ltd.), pH adjusted to 5.8] medium, add 2 mL PACM liquid [3% MS + 2 g / L Caseine hydrolysate, pH adjusted to 6.5, add 1 mg / L 2,4-D and 0.5 mg / L KT after sterilization].

[0091] Agrobacterium preparation:

[0092] One day in advance, take the Agrobacterium liquid that is positive for bacterial test and streak a single clone, and place it in a 28°C incubator for two days; pick a single clone plaque and put it into 20mL liquid LB containing 50mg / L kanamycin (Kan) and 25mg / L rifampicin (rif) and place it in a 28°C shaker (200r / min) for culture. After 20h, if the shaking is mixed, take 1mL and add it to 50mL liquid LB culture medium containing 50mg / L kanamycin (Kan) and 25mg / L rifampicin (rif), and place it in a 28°C shaker again for culture for about 6h.

[0093] Agrobacterium infection:

[0094] Take 45mL of the above bacterial solution and centrifuge (4000r / min at room temperature, centrifuge for 8min), resuspend the bacterial solution with 3% liquid MS after centrifugation and adjust the OD value of the bacterial solution to about 0.5. Take out the stem segment that has been pre-cultured for two days and place it in the above bacterial solution with adjusted OD value for infection for 10min, shaking the bacterial solution continuously during the period to fully infect the stem segment. After infection, pour out the bacterial solution and place the infected stem segment in a sterilized filter paper dish to completely absorb the attached bacterial solution.

[0095] Co-culture:

[0096] Another layer of filter paper was laid on the R3B medium used in pre-culture, and then the stem segments were spread flat on it and cultured in the dark for two days.

[0097] Differentiation and regeneration:

[0098] After two days of dark culture, the stem segments were transferred to differentiation medium ZCVK medium [3% MS + 1mg / L Trans-ZT + 200mg / L Timentin (TMT) + 200mg / L Cefprozin sodium salt (Cef) + 50mg / L Kanamycin (Kan) + 2.2g / L Geloid, pH adjusted to 5.8] for culture in an incubator with a light intensity of 2000lx, a photoperiod of 16h / d, and a temperature of 23±2°C. The explants were subcultured on the differentiation medium every 14 days or so.

[0099] Rooting culture and identification of positive buds:

[0100] When the transgenic regenerated shoots grow to about 1 cm, they are cut into rooting medium (3% MS + 200mg / L Cef + 200mg / L Tim + 50mg / L Kan) for rooting. After 2-3 weeks, the rooted potatoes are propagated into the rooting medium for secondary screening. The rooted potatoes in the secondary screening can be sampled for DNA extraction and detection to determine the positive seedlings; or a portable ultraviolet lamp is used to detect whether green fluorescence is expressed.

[0101] result:

[0102] Figure 2 This is a partial explant status diagram of RH, E109, C9701 transformation control vector and StGRF4-GIF1 chimeric gene overexpression vector.

[0103] The transformation effect of StGRF4-GIF1 in different varieties was tested, see Tables 1 and Figure 3 , Figure 4 .

[0104] Table 1

[0105]

[0106] Note: CK: transformation without pCAMBIA1300-Kan-GFPuv; StGRF4-GIF1: transformation with pCAMBIA1300-StGRF4-GIF1-Kan-GFPuv. “-” indicates no statistics. Germination rate = number of effective buds / total number of stem segments; genetic transformation efficiency = number of positive buds / total number of stem segments.

[0107] C9701: Li Qiong, Wang Haibo, Cai Xingkui, et al. Identification of potato somatic hybrids resistant to bacterial wilt and low temperature saccharification[J]. Chinese Potato, 2013(6):321-330.

[0108] S15-65: Feng Shuangshuang, Luo Jiayi, Zhu Xijian, et al. Obtaining and functional analysis of StBRC1a loss-of-function mutants in diploid potato[J]. Acta Horticulturae Sinica, 2020, 47(1): 63-72.

[0109] The results in Table 1 show that in the three genotypes of potatoes RH, E109, and C9701, overexpression of StGRF4-GIF1 can improve the germination rate and genetic transformation efficiency of the tested varieties compared with the control vector. Among them, when E109 is the receptor, the germination rate of overexpressing StGRF4-GIF1 is 1.6 times that of the negative control, and the genetic transformation efficiency is 4.6 times that of the negative control; when C9701 is the receptor, the germination rate is 2 times that of the negative control, and the genetic transformation efficiency is 1.8 times that of the negative control; RH is a difficult-to-regenerate material, and the negative control did not regenerate effective buds, but after overexpressing StGRF4-GIF1, 1 regenerated bud was obtained, and the regenerated bud was a positive plant. In summary, the application of overexpressing StGRF4-GIF1 can improve the potato regeneration rate and genetic transformation efficiency.

[0110] After S15-65 overexpressed StGRF4-GIF1, its germination rate was 1.9 times that of the control. Among the positive seedlings obtained, two strains (OE-StGRF4-GIF1-1, OE-StGRF4-GIF1-2) and the wild species S15-65 (S15) were selected, and single segments were taken to propagate in (3% MS + 200mg / L Cef + 200mg / L Tim), grown in the tissue culture room for about a month, then planted in the growth room for five weeks, and finally planted in the plastic greenhouse. After five weeks, the overall phenotype of the plant was photographed and the plant height and stem thickness were measured (see Figure 5 , Figure 6 ); after ten weeks, the individual plants of each strain were photographed and the plant height and stem diameter were measured (see Figure 7 , Figure 8 ), and took photos of the plant's leaf and flower phenotypes. The specific results are as follows:

[0111] 1) Compared with the control, OE-StGRF4-GIF1 has shorter and wider leaves, and the leaf color changes from green to dark green ( Fig. 9 ); In addition, the corolla is also larger than the wild-type control ( Fig.10 ).

[0112] 2) Compared with the control, OE-StGRF4-GIF1 grew slowly. In terms of plant height and stem diameter, the overexpression material and the wild-type material had extremely significant differences in the early stage, but in the later stage of growth, the differences in plant height and stem diameter decreased significantly, and even there was no significant difference in stem diameter between the wild-type and strain OE-11 (see Figure 6 , Figure 8 ).

[0113] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A potato StGRF4-GIF1 chimeric gene, characterized in that: The StGRF4-GIF1 chimeric gene sequence is shown in SEQ ID NO.

3.

2. A plant overexpression vector, characterized in that: Contains the StGRF4-GIF1 chimeric gene according to claim 1.

3. A transgenic Agrobacterium, characterized in that: Contains the plant overexpression vector according to claim 2.

4. The transgenic Agrobacterium according to claim 3, characterized in that: The Agrobacterium is GV3101.

5. Use of the StGRF4-GIF1 chimeric gene according to claim 1, the plant overexpression vector according to claim 2, or the transgenic Agrobacterium according to any one of claims 3 to 4 in improving the genetic transformation efficiency of potato.

6. Use of the StGRF4-GIF1 chimeric gene according to claim 1, the plant overexpression vector according to claim 2, or the transgenic Agrobacterium according to any one of claims 3 to 4 in improving the shoot regeneration rate.

Images