Co-transcription unit gene ABE-CBE system for bidirectional single base editing of rice and application of co-transcription unit gene ABE-CBE system

Abstract

The invention relates to the technical field of biotechnology and plant genetic engineering, in particular to a rice two-way single-base edited co-transcription unit gene ABE-CBE system and application of the rice two-way single-base edited co-transcription unit gene ABE-CBE system. The rice bidirectional single base edited co-transcription unit gene ABE-CBE system provided by the invention comprises a co-transcription unit gene ABE-CBE, and the co-transcription unit gene ABE-CBE comprises an encoding gene ABE8e of adenine deaminase and an encoding gene Sdd7 of cytosine deaminase, and the coding gene ABE8e and the coding gene Sdd7 in the co-transcription gene ABE-CBE are constructed in the same expression vector. Through the designed ABE-CBE system, the two editors can be mediated at the same site to play a role at the same time, generation of unexpected base substitution can be further reduced, the editing efficiency of the base editors is improved, and wide application value is achieved.

Description

Technical Field

[0001] The present invention relates to the technical fields of biotechnology and plant genetic engineering, and in particular to a rice bidirectional single-base editing co-transcription unit gene ABE-CBE system and applications thereof. Background Art

[0002] Base editing technology can precisely achieve base changes in target genes without inducing double-strand breaks, thus playing a very powerful role in the evolution of target genes in vivo. Cytosine base editors (CBE) and adenine base editors (ABE) perform precise editing of single bases at the target site to CT and AG, respectively, and a single CBE or ABE can only produce mutations in a single type of nucleotide base pair. So far, great progress has been made in the performance of CBEs and ABEs, generating new alleles and making artificial evolution of important genes in crops possible. In contrast, dual base editing technology (dualBE) can simultaneously produce precise editing of CT and AG at the target gene site by combining the deaminases and related BE components of CBEs and ABEs. The simultaneous conversion of two types of DNA base pairs at the same target site mediated by dual BEs makes the desired alleles in directed evolution more diverse, and has broad application prospects in agriculture, biomedicine and other fields.

[0003] At present, the exploration of dual base editors in plants is limited. The traditional plant gene base editing system is to introduce the editing system into plant cells through transient or stable genetic transformation. However, the editing efficiency of traditional base editing systems is not high, and the base editing systems with high editing efficiency are very limited. Being able to provide more efficient rice editing systems has great application value. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a co-transcription unit gene ABE-CBE system for bidirectional single-base editing of rice. The present invention designs an efficient adenine base editing system mediated by ABE8e and an efficient cytosine base editing system mediated by Sdd7, and fuses the two together. It can not only mediate the simultaneous action of the two editors at the same site, but also further reduce the occurrence of unexpected base substitutions, thereby improving the editing efficiency of the base editor, and has wide application value.

[0005] To this end, the present invention provides the following technical solutions:

[0006] In the first aspect, the present invention provides, in an optional embodiment, a co-transcription unit gene ABE-CBE system for bidirectional single-base editing of rice, comprising a co-transcription unit gene ABE-CBE, wherein the co-transcription unit gene ABE-CBE comprises an adenine deaminase encoding gene ABE8e and a cytosine deaminase encoding gene Sdd7, and the encoding gene A BE8e and the encoding gene Sdd7 in the co-transcription gene ABE-CBE are constructed in the same expression vector.

[0007] The present invention adopts a new editor fusion strategy to introduce the adenine deaminase encoding gene ABE8e and the cytosine deaminase gene Sdd7 into the receptor, so that sgRNA, ABE8e, nSpCas9 and Sdd7 are expressed in the receptor, thereby performing base editing on the target gene in the receptor genome.

[0008] Preferably, the adenine deaminase in the adenine deaminase encoding gene ABE8e is Tad-8e adenine deaminase evolved from TadA deaminase in Escherichia coli, and the cytosine deaminase in the cytosine deaminase encoding gene Sdd7 is Sdd7 single-chain cytosine deaminase. The nucleotide sequence of the Sdd7 single-chain cytosine deaminase is shown in SEQ ID No. 2.

[0009] In a second aspect, the present invention provides, in an optional embodiment, an expression vector having a rice bidirectional single base editing co-transcription unit gene ABE-CBE system, wherein each gene fragment in the expression vector is inserted into the same expression frame and comprises at least:

[0010] (a) the nucleotide sequence shown in SEQ ID No. 1 in the sequence listing; or

[0011] (b) a nucleotide sequence which replaces one or more nucleotides in the nucleotide sequence shown in SEQ ID No. 1 in the sequence listing and is capable of performing rice genome shearing; or

[0012] (c) a nucleotide sequence capable of performing rice genome shearing by adding one or more nucleotides to the nucleotide sequence shown in SEQ ID No. 1 in the sequence listing; or

[0013] (d) A nucleotide sequence in which one or more nucleotides are deleted from the nucleotide sequence shown in SEQ ID No. 1 in the sequence listing and which is capable of performing rice genome shearing.

[0014] In the present invention, the nucleotide sequence shown in SEQ ID No. 1 is the nucleotide sequence of the ABE8e-Sdd7-nSpCas9 marker gene.

[0015] Preferably, the expression vector further comprises a co-fusion editing tool;

[0016] In the co-fusion editing tool, the cytosine deaminase coding gene Sdd7 is located at the 5' end of the SpCas9 protein coding gene SpCas9n, the adenine deaminase coding gene ABE8e is located at the 5' end of the coding gene Sdd7, and the coding gene Sdd7 and the coding gene SpCas9n are connected in series with a 10-amino acid linker, and a 4×SV40 NLS nuclear localization signal is placed at the 3' end of the SpCas9 protein coding gene SpCas9n.

[0017] In a third aspect, the present invention provides, in an optional embodiment, a method for constructing a fusion editing tool for bidirectional single base editing in rice, comprising the following steps:

[0018] The sgRNA expression frame, Cas9 protein, cytosine deaminase ABE8e gene and adenine deaminase Sdd gene are introduced into the target receptor, so that the sgRNA expression frame, Cas9 protein, cytosine deaminase ABE8e gene and adenine deaminase Sdd7 gene are expressed in the target receptor, thereby performing base editing on the target gene in the receptor genome and producing precise and efficient bidirectional single-base editing.

[0019] Furthermore, the method further comprises:

[0020] S1: synthesizing fragments containing the cytosine deaminase ABE8e gene, the adenine deaminase Sdd7 gene and the nSpCas9 gene respectively;

[0021] S2: PCR amplification and purification of the synthesized ABE8e gene fragment, adenine deaminase Sdd7 gene fragment and nSpCas9 gene fragment were performed to obtain PCR products of ABE8e, Sdd7 and nSpCas9;

[0022] S3: Using a T vector, the PCR products of ABE8e, Sdd7 and nSpCas9 are homologously recombined to obtain a T-ABE 8e-Sdd7-nSpCas9 gene;

[0023] S4: Add PstI / SacI restriction sites at both ends of the T-ABE8e-Sdd7-nSpCas9 gene, digest with PstI / SacI, recover the ABE8e-Sdd7-nSpCas9 gene fragment, digest the plant intermediate vector pHUC400 with PstI / SacI and recover it, connect the gene sequence ABE8e-Sdd7-nSpCas9 to the intermediate vector pHUC400, and obtain the plant intermediate vector pHUC400-ABE8e-Sdd7-nSpCas9;

[0024] S5: Recover the ABE8e-Sdd7-nSpCas9 gene fragment in the plant intermediate vector pHUC400-ABE8e-Sdd7-nSpCas9, then use HindⅢ to cut and recover the plant expression vector pHUC422, and connect the gene fragment ABE8e-Sdd7-nSpCas9 to the expression vector pHUC422 to obtain the plant expression vector pHUC422-ABE8e-Sdd7-nSpCas9;

[0025] S6: Use the enzyme cutting site to connect the promoter and target gene sequence of the plant expression vector to the plant expression vector pHUC422-ABE8e-Sdd7-nSpCas9, and then introduce the plant expression vector pHUC422-ABE8e-Sdd7-nSpCas9 containing the promoter and target gene sequence into the target receptor for expression.

[0026] Preferably, the cytosine dehydrogenase ABE8e gene and the adenine deaminase Sdd7 gene use the same constitutive promoter Ubiqutin and the same 35S terminator. The sgRNA expression frame includes: rice OsU6 promoter, spectinomycin resistance gene S pR, artificially synthesized sgRNA backbone sequence and Poly-T terminator.

[0027] Based on the expression vector, the corresponding gene targeting vector can be constructed according to the actual needs of the experiment.

[0028] Specifically, the present invention provides a method for constructing a targeting vector and introducing it into cells using a pHUC422-ABE8e-Sdd7-nSpCas9 expression vector.

[0029] On the basis of the expression vector, only simple annealing, enzyme digestion and ligation are required to obtain a targeting vector (pHU C422-ABE8e-Sdd7-nSpCas9-SLR1 / PDS / Pikh) of a specific gene, and the targeting vector is introduced into rice cells, including the following steps:

[0030] (1) After rice seeds are hulled, sterilized with alcohol, and then embryos are separated and placed on a callus induction medium for 7-10 days to produce secondary callus;

[0031] (2) transferring the secondary callus in step (1) to a new callus induction medium for pre-culturing for 15-20 days;

[0032] (3) contacting the callus obtained in step (2) with Agrobacterium carrying the targeting vector of ABE8e-Sdd7-nSpCas9 (pHUC422-ABE 8e-Sdd7-nSpCas9-SLR1 / PDS / Pikh) for 15 minutes;

[0033] (4) Transfer the callus tissue from step (3) to a culture dish covered with three sterile filter papers (to which 2.5-3.5 mL of Agrobacterium suspension medium has been added) and culture at 21-23° C. for 48 hours;

[0034] (5) placing the callus tissue of step (4) on a pre-screening medium and culturing for 5-7 days;

[0035] (6) transferring the callus tissue of step (5) to a screening medium to obtain resistant callus tissue;

[0036] (7) transferring the resistant callus from step (6) to a differentiation and regeneration medium to differentiate into seedlings;

[0037] (8) Transfer the seedlings from step (7) to a rooting medium for rooting.

[0038] The seeds in step (1) are mature seeds; the induction medium in steps (1) and (2) is the induction medium listed in Table 1; the contact with Agrobacterium in step (3) is to immerse the callus in the Agrobacterium suspension; the Agrobacterium suspension medium in step (4) is the suspension medium listed in Table 1; the pre-screening medium in step (5) is the pre-screening medium listed in Table 1; the screening medium in step (6) is the screening medium listed in Table 1; the differentiation and regeneration medium in step (7) is the differentiation and regeneration medium listed in Table 1; the rooting medium in step (8) is the rooting medium listed in Table 1. The rice is japonica rice, and more preferably, the rice is japonica rice Nipponbare.

[0039] Table 1 Culture medium formula

[0040]

[0041] In a fourth aspect, the present invention provides, in an optional embodiment, an application of the above-mentioned rice bidirectional single-base editing co-transcription unit gene ABE-CBE system, wherein the application comprises introducing the co-transcription unit gene ABE-CBE into plant callus tissue.

[0042] Preferably, the application also includes infecting, co-culturing, and screening plant callus to obtain edited plant callus, and then differentiating the callus into plants, using the rice bidirectional single-base editing co-transcription unit gene ABE-CBE system to improve the site-specific replacement efficiency of CT and AG on the rice genome, and obtain transgenic plants or plant gene fragments containing mutation sites.

[0043] The nucleotide sequence of SEQ ID No.1 is:

[0044]

[0045] The nucleotide sequence of SEQ ID No.2 is as follows:

[0046] CTGGAGGCCGTCCGTGCACGGCTCATCGGCGAGGGCGGCGGTCCCGGCGCCGTACCTGAAGGAGGGGACGGCCCGCCGGCGGTGCCGGCGGAGGAGGTGGAGAGACTACGAGGAGAACTGCCCCCTCCGGTGGTGCCCGGAACTGGGCAGAAAACACATGGGCGGTGGATTGGTCCTGATGGTCGTGTCCGGGCTATTGTTTCAGGACGCGATGAGGATGCTGCTCTCGTCCACGCCCAATTGGCGGCGAAGGGCATTCCAGATGAACCAACAAGAAACTCTGATGTTGAGCAGAAGCTCGCCGCCCACATGGTTGCAAATGGTATCAGGCATGTGACGTTAGTCATAAACCATAGGCCGTGCCGCGGCTTCGACGACTCCTGTGACACGCTTGTCCCTATCATATTGCCAGAAGGCTGCACCCTTACCGTACACGGCCAAACTGACAAGGGGATGAGGGTGAGGGTTCGCTACACCGGAGGGGCAAGACCATGGTGGAGC。

[0047] The nucleotide sequence of SEQ ID No.3 is as follows:

[0048] ATGAGTAGCGAGACAGGTCCTGTTGCAGTTGACCCGACCCTTCGGAGAAGGATAGAGCCACACGAATTTGAAGTGTTTTTCGACCCTAGAGAACTGAGGAAGGAGACGTGCCTTCTGTACGAGATAAACTGGGGTGGTCGCCACTCTATTTGGAGGCACACTTCGCAAAACACGAACAAGCATGTGGAGGTGAACTTTATAGAAAAATTTACGACTGAGAGATACTTCTGCCCTAATACCCGGTGCTCCATCACCTGGTTCCTTAGCTGGAGCCCTTGTGGCGAATGCTCGAGGGCAATCACCGAGTTTCTGTCCAGATACCCACATGTGACGCTTTTTATATATATTGCCCGCTTGTATCACCACGCTGACCCTAGAAACCGCCAGGGTCTTCGCGATCTGATATCTTCAGGAGTTACCATCCAAATAATGACGGAACAAGAATCCGGTTACTGTTGGCGCAATTTCGTCAACTATAGCCCTTCCAATGAAGCTCATTGGCCTAGATATCCGCACCTCTGGGTCCGGCTGTATGTTCTCGAGCTTTACTGCATTATACTTGGACTTCCCCCCTGCTTGAATATTCTCCGCAGAAAGCAGCCTCAGCTTACGTTTTTTACGATTGCACTCCAAAGTTGTCATTATCAGAGACTGCCACCCCATATCTTGTGGGCTACGGGACTGAAG。

[0049] The nucleotide sequence of SEQ ID No. 4 is as follows:

[0050] ATGACAGATGCTGAATATGTCAGAATCCACGAAAAGTTGGACATTTACACGTTTAAGAAGCAGTTCTTCAACAACAAGAAATCTGTTTCGCATAGGTGCTATGTGCTTTTCGAACTAAAACGTCGTGGAGAAAGACGGGCTTGCTTTTGGGGTTACGCGGTTAACAAACCACAATCAGGTACTGAACGAGGAATACACGCTGAAATCTTTTCTATCCGAAAGGTTGAGGAATATCTACGTGACAATCCTGGACAGTTCACTATCAATTGGTATTCTAGCTGGTCACCATGTGCAGATTGTGCTGAGAAGATTCTCGAATGGTACAATCAAGAGCTTAGAGGCAATGGACATACATTGAAAATATGGGCATGCAAGCTCTACTACGAAAAGAATGCCAGAAACCAAATTGGGCTTTGGAACTTGAGGGATAATGGAGTTGGGCTTAATGTCATGGTTTCTGAGCACTATCAATGTTGTCGGAAGATCTTCATACAAAGTTCCCATAACCAGTTGAATGAGAACAGATGGTTAGAGAAAACCCTTAAAAGAGCCGAGAAGAGAAGATCCGAACTGAGCATTATGATACAGGTCAAAATTCTGCATACCACTAAGAGTCCAGCTGTA。

[0051] The nucleotide sequence of SEQ ID No.5 is as follows:

[0052] .

[0053] Compared with the prior art, the present invention has one of the following beneficial effects:

[0054] 1. The present invention designs an ABE8e-mediated efficient adenine base editing system and an Sdd7-mediated efficient cytosine base editing system, and fuses the two together. This can not only mediate the simultaneous function of the two editors at the same site, but also further reduce the occurrence of unexpected base substitutions, thereby improving the editing efficiency of the base editors and having broad application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 Schematic diagram of the pHUC422-ABE8e-Sdd7-nSpCas9 plant expression vector plasmid in Example 1 of the present invention;

[0056] Figure 2 The efficiency of base substitution after pHUC422-ABE8e-Sdd7-nSpCas9 edits the SLR1 gene in Example 2 of the present invention;

[0057] Figure 3 It is the efficiency of base replacement of pHUC422-ABE8e-Sdd7-nSpCas9-SLR1 and pHUC422-ABE8e-APOBEC1-nSpCas9-SLR1, pHUC422-ABE8e-PmCDA1-nSpCas9-SLR1, and pHUC422-ABE8e-Sdd6-nSpCas9-SLR1 in Example 2 of the present invention and Comparative Examples 1, 2, and 3.

[0058] Figure 4 It is the efficiency of base replacement of pHUC422-ABE8e-Sdd7-nSpCas9-PDS and pHUC422-ABE8e-APOBEC1-nSpCas9-PDS, pHUC422-ABE8e-PmCDA1-nSpCas9-PDS, and pHUC422-ABE8e-Sdd6-nSpCas9-PDS in Example 2 of the present invention and Comparative Examples 1, 2, and 3.

[0059] Figure 5 It is the efficiency of base replacement of pHUC422-ABE8e-Sdd7-nSpCas9-Pikh and pHUC422-ABE8e-APOBEC1-nSpCas9-Pikh, pHUC422-ABE8e-PmCDA1-nSpCas9-Pikh, and pHUC422-ABE8e-Sdd6-nSpCas9-Pikh in Example 2 of the present invention and Comparative Examples 1, 2, and 3. DETAILED DESCRIPTION

[0060] The following embodiments of the present invention are described in conjunction with the accompanying drawings. It should be noted that the following embodiments are only used to illustrate exemplary implementations of the present invention, and are not intended to limit the present invention in any way. Those skilled in the art may make certain equivalent changes and obvious improvements to the present invention.

[0061] In the absence of other specific instructions, the operations in the following specific embodiments are all carried out using conventional operations commonly used in the art. Those skilled in the art can easily obtain guidance on such conventional operations from the prior art. The medicinal raw materials, reagents, materials, etc. used in the following examples are all commercially available products unless otherwise specified.

[0062] Example 1

[0063] 1. Splicing of T-ABE8e-Sdd7-nSpCas9 gene

[0064] The gene of the present application is named ABE8e-Sdd7-nSpCas9, and the sequence is shown in SEQ ID No.1.

[0065] The single-chain cytosine deaminase Sdd7 gene (sequence shown in SEQ ID No. 2) was sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis, and then connected to the PUC57-AMP vector to form the PUC57-AMP-Sdd7 vector, which was then loaded into the Escherichia coli XL-blue strain.

[0066] Then the mutant adenine deaminase ABE8e suitable for rice was connected to the PUC57-AMP vector to form the PUC57-AMP-ABE8e vector, and loaded into the Escherichia coli XL-blue strain.

[0067] According to the principle of homologous recombination splicing, the ABE8e gene, Sdd7 gene, and nSpCas9 gene were connected to the T vector. The specific operation is as follows:

[0068] According to the splicing sequence of ABE8e gene, Sdd7 gene, nSpCas9 gene and T vector sequence, primers were synthesized respectively:

[0069] The upstream primer of ABE8e gene was: 5′-TTACGCCAAGCTGCCCTTGCTGCAGGCCACCATGGCCCCAAAGAAGAAGCGCA-3′.

[0070] The downstream primer of ABE8e gene was: 5′-TGGCGGGTCCTCCGGTGGTTCC-3′.

[0071] The upstream primer of Sdd7 gene was: 5′-GCGGGTCCTCCGGTGGTTCCCTGGAGGCCGTCCGTGCACGG C-3′.

[0072] The downstream primer of Sdd7 gene was: 5′-AGGGGCAAGACCATGGTGGAGCGAGTCATCTGGCGGGTCCT C-3′.

[0073] The upstream primer of the nSpCas9 gene was: 5′-GCGGGTCCTCCGGTGGTTCCGACAAGAAGTACTCCATCGGCC-3′.

[0074] The downstream primer of the nSpCas9 gene was: 5′-GCGAATTGAAGCTGCCCTTGGAGCTCTCACACCTTCCT-3′.

[0075] Using PUC57-AMP-Sdd7 as a template, PCR amplification was performed using the upstream primer of the Sdd7 gene and the downstream primer of the Sdd7 gene, and the PCR product was recovered. Using the ABE8e gene as a template, PCR amplification was performed using the upstream primer of ABE8e and the downstream primer of ABE8e gene, and the PCR product was recovered. Using the nSpCas9 gene as a template, PCR amplification was performed using the upstream primer of the SpCas9 gene and the downstream primer of the SpCas9 gene, and the PCR product was recovered. The above three recovered PCR products and the T vector fragment after EcoRI digestion were spliced ​​according to the principle of homologous recombination to form a gene fused with the ABE8e gene, the Sdd7 gene, and the nSpCas9 gene, named T-ABE8e-Sdd7-nSpCas9 gene.

[0076] 2. Construction of plant targeting vector containing ABE8e-Sdd7-nSpCas9 gene

[0077] The plasmid was extracted from the E. coli XL-blue containing the T-ABE8e-Sdd7-nSpCas9 vector using an Axygen plasmid extraction kit, and the ABE8e-Sdd7-nSpCas9 gene fragment was recovered by digestion with PstI / SacI. At the same time, the intermediate vector pH UC400 vector was linearized using PstI / SacI enzymes, the pHUC400 fragment was recovered, and the above-mentioned ABE8e-Sdd7-nSpCas9 gene fragment and pH UC400 fragment were connected with Quick ligase enzyme (purchased from NEB) to obtain the plant intermediate vector pHUC400-ABE8e-Sdd7-nSpCas9.

[0078] The plasmid was extracted from the E. coli XL-blue containing the pHUC400-ABE8e-Sdd7-nSpCas9 plant intermediate vector using the Axygen plasmid extraction kit, and the ABE8e-Sdd7-nSpCas9 gene fragment was recovered by HindⅢ enzyme digestion. At the same time, the expression vector pHUC422 was linearized by HindⅢ enzyme, and the pHUC422 fragment was recovered. The ABE8e-Sdd7-nSpCas9 gene fragment and the pHUC422 fragment were connected with Quick ligase enzyme to obtain the plant expression vector pHUC422-ABE8e-Sdd7-n SpCas9. The schematic diagram of the plant expression vector pHUC422-ABE8e-Sdd7-nSpCas9 plasmid can be found in Figure 1 .

[0079] Select the nucleotide sequence at positions 725-747 in the rice SLR1 gene (Os03g0707600) CCT CGCGGGGCTCTGT GGTGGAG (the underlined part is the PAM sequence of the 5'-CCN-3' structure) was used as the target site, and the target site sequence was fused with pHUC422-ABE8e-Sdd7-nSpCas9 to form pHUC422-ABE8e-Sdd7-nSpCas9-SLR1; the nucleotide sequence TGTTCGCTCTTTGGGTGGTG at positions 3726-3745 in the rice PDS gene (Os03g0184000) was selected. AGG , as the target site, the target site sequence was fused with pHUC422-ABE8e-Sdd7-nSpCas9 to form pHUC422-ABE8e-Sdd7-nSpCas9-PDS; the nucleotide sequence AGCTCGAAGGAAGGT CTGAG at positions 578-597 in the rice Pik-h gene (Os11g0639100) was selected AGG , as the target site, the target site sequence was fused with pHUC422-ABE8e-Sdd7-nSpCas9 to form pHUC422-ABE8e-Sdd7-nSpCas9-Pikh. The plant expression vector was transferred into Agrobacterium tumefaciens EHA105 strain (preserved by the Rice Research Institute of Anhui Academy of Agricultural Sciences) by freeze-thaw method for genetic transformation.

[0080] Example 2

[0081] Genetic transformation of rice using pHUC422-ABE8e-Sdd7-nSpCas9-SLR1 / PDS / Pikh as targeting vector and acquisition of mutants

[0082] 1. Induction and pre-culture of mature embryo callus

[0083] Shell the mature seeds of Nipponbare, select the seeds with normal appearance, clean and without mildew, shake with 70% alcohol for 90 seconds, and pour out the alcohol; then wash the seeds with 50% sodium hypochlorite solution containing Tween20 (the effective chlorine concentration of the original solution is greater than 4%, and 1 drop of Tween20 is added for every 100 ml), and shake on a shaker for 45 minutes (180r / min). Pour out the sodium hypochlorite, wash with sterile water 5-10 times until there is no smell of sodium hypochlorite, and finally add sterile water and soak at 30℃ overnight. Use a surgical blade to separate the embryo along the aleurone layer, place it on the induction medium (see Table 1) with the scutellum facing up, 12 seeds / dish, and culture in the dark at 30℃ to induce callus tissue.

[0084] After two weeks, spherical, rough, light yellow secondary callus appeared, and pre-culture operation was carried out, that is, the secondary callus was transferred to a new callus induction medium and pre-cultured in the dark at 30°C for 5 days. After the pre-culture, the small particles in good condition and vigorous division were collected with a spoon into a 50mL sterile centrifuge tube for Agrobacterium infection.

[0085] 2. Cultivation of Agrobacterium strains and preparation of suspensions

[0086] Agrobacterium strain EHA105 containing pHUC422-ABE8e-Sdd7-nSpCas9-SLR1 / PDS / Pikh vector was streaked on an LB plate containing k / r (50 mg / mL kanamycin 20 mg / mL rifampicin) (see Table 1), cultured in the dark at 28°C, and inoculated with a sterile inoculation loop after 24 hours. The activated Agrobacterium was inoculated onto a fresh LB plate containing k / r (50 mg / mL kanamycin 20 mg / mL rifampicin) for a second activation, and cultured in the dark at 28°C overnight. 20-30 mL of Agrobacterium suspension culture medium (see Table 1) was added to a 50 mL sterile centrifuge tube, and the Agrobacterium activated twice was scraped off with an inoculation loop, and the OD660 was adjusted to about 0.10-0.25, and allowed to stand at room temperature for more than 30 min.

[0087] 3. Infection and Co-cultivation

[0088] Add the Agrobacterium suspension to the prepared callus (obtained in step 1) and soak for 15 minutes, shaking gently from time to time. After soaking, pour out the liquid (try to drip the liquid completely), absorb the excess Agrobacterium liquid on the surface of the callus with sterile filter paper, and blow dry with sterile air in the clean bench. Place three sterile filter papers on a 100×25mm disposable sterile culture dish, add 2.5mL of Agrobacterium suspension culture medium, evenly spread the dried callus on the filter paper, and culture in the dark at 23℃ for 48h.

[0089] 4. Pre-screening and screening culture

[0090] After the co-culture, the co-cultured callus was evenly spread in the pre-screening medium (see Table 1) and cultured in the dark at 30°C for 5 days. After the pre-screening culture, the callus was transferred to the screening medium (see Table 1), 25 callus were inoculated in each culture dish, and cultured in the dark at 30°C. After 2-3 weeks, the resistant callus grew significantly and differentiation and regeneration operations could be performed.

[0091] 5. Differentiation and regeneration

[0092] For each independent transformant, select 2-3 fresh small particles with good growth status and transfer them to differentiation and regeneration medium (see Table 1). Inoculate 5 independent transformants per culture dish. Culture at 28°C under light, with a light cycle of 16 hours of light and 8 hours of darkness, and a light intensity of 3000-6000 lx.

[0093] 6. Rooting and transplanting

[0094] When the buds differentiated from the resistant callus grew to about 2 cm, only one well-growing seedling from each independent transformant was taken and transferred to the rooting medium (see Table 1) and cultured at 28°C under light, with a photoperiod of 16 h light and 8 h dark, and a light intensity of 3000-6000 lx. After two weeks, the seedlings with well-developed root systems were selected, the medium was washed off with water, and transplanted into the soil.

[0095] 7. Molecular identification

[0096] Before differentiation and regeneration, rice callus samples were collected and DNA was extracted using the CTAB method. The obtained genomic DNA samples were used for PCR analysis. PCR primers 5'-GGACACCAAGCGGATGCGCACT-3' and 5'-GGTTGTGGTGGTTGACACGCAG-3' were designed to amplify the 175bp sequence near the SLR1 target; PCR primers 5'-GTAGGAGAAGCATGGTTCTAAG-3' and 5'-TTTGCACTTACTGATGGAACTC-3' were designed to amplify the 182bp sequence near the PDS target; PCR primers 5'-TTGAGAGCACTGCATATGGAGT-3' and 5'-GGTCTACAGGCT CTTGATCGCC-3' were designed to amplify the 187bp sequence near the Pikh target.

[0097] The PCR components were first kept at 95°C for 5 minutes, and then 35 cycles were performed: 95°C for 30 seconds, 60°C for 30 seconds, 72°C for 30 seconds, and finally 72°C for 10 minutes. The PCR products were sequenced and the results were compared with the wild-type sequence. The efficiency of simultaneous mutation of CT and AG in the callus DNA sample obtained by pHUC422-ABE8e-Sdd7-nSpCas9-SLR1 was 19.96% (see Figure 3 ), the efficiency of only CT substitution is 12.48%, and the efficiency of only AG substitution is 17.37% (see Figure 2 and Figure 3 ); In the callus DNA sample obtained by pHUC422-ABE8e-Sdd7-nSpCas9-PDS, the efficiency of simultaneous mutation of CT and AG was 34.20% (see Figure 3 ), the efficiency of CT substitution alone was 0.69%, and the efficiency of AG substitution alone was 23.84%; in the callus DNA sample obtained by pHUC422-AB E8e-Sdd7-nSpCas9-Pikh, the efficiency of CT and AG mutations occurring simultaneously was 37.12% (see Figure 3 ), the efficiency when only CT substitution occurs is 18.52%, and the efficiency when only AG substitution occurs is 2.91%.

[0098] Comparative Example 1

[0099] The existing pHUC422-ABE8e-APOBEC1-nSpCas9 (wherein the sequence of APOBEC1 is shown in SEQ ID No. 3) vector was used to connect SLR1, PDS, and Pikh targets to obtain a bidirectional single-base mutated pHUC422-ABE8e-APOBEC1-nSpCas9-SLR1 / PDS / Pikh vector as a control group. The results showed that the efficiency of simultaneous editing of CT and AG of pHUC422-ABE8e-Sdd7-nSpCas9-SLR1 / PDS / Pikh was higher than that of pHUC422-ABE8e-APOBEC1-nSpCas9-SLR1 / PDS / Pikh (see Figure 3 , Figure 4 and Figure 5 ). It can be seen that pHUC422-ABE8e-Sdd7-nSpCas9 can efficiently mediate bidirectional base substitution.

[0100] Comparative Example 2

[0101] The pHUC422-ABE8e-PmCDA1-nSpCas9 (wherein the sequence of PmCDA1 is shown in SEQ ID No. 4) vector was used to connect SLR1, PDS, and Pikh targets to obtain the bidirectional single-base mutated pHUC422-ABE8e-PmCDA1-nSpCas9-SLR1 / PDS / Pikh vector as a control group. The results showed that the efficiency of simultaneous editing of CT and AG of pHUC422-ABE8e-Sdd7-nSpCas9-SLR1 / PDS / Pikh was higher than that of pHUC422-ABE8e-PmCDA1-nSpCas9-SLR1 / PDS / Pikh (see Figure 3 , 4 , 5). It can be seen that pHUC422-ABE8e-Sdd7-nSpCas9 can efficiently mediate bidirectional base substitution.

[0102] Comparative Example 3

[0103] The pHUC422-ABE8e-Sdd6-nSpCas9 (wherein the sequence of Sdd6 is shown in SEQ ID No. 5) vector was used to connect S LR1, PDS, and Pikh targets to obtain the bidirectional single-base mutated pHUC422-ABE8e-Sdd6-nSpCas9-SLR1 / PDS / Pikh vector as a control group. The results showed that the efficiency of simultaneous editing of CT and AG of pHUC422-ABE8e-Sdd7-nSpCas9-SLR1 / PDS / Pikh was higher than that of pHUC422-ABE8e-Sdd6-nSpCas9-SLR1 / PDS / Pikh (see Figure 3 , 4 , 5). It can be seen that pHU C422-ABE8e-Sdd7-nSpCas9 can efficiently mediate bidirectional base substitution.

[0104] Although the principles of the present invention are described in detail above in conjunction with the preferred embodiments of the present invention, those skilled in the art should understand that the above embodiments are merely explanations of the exemplary implementations of the present invention, and are not intended to limit the scope of the present invention. The details in the embodiments do not constitute limitations on the scope of the present invention, and any obvious changes such as equivalent transformations, simple replacements, etc. based on the technical solution of the present invention, without departing from the spirit and scope of the present invention, fall within the protection scope of the present invention.

Claims

1. A rice bidirectional single base editing co-transcriptional unit gene ABE-CBE system, characterized in that: The co-transcription unit gene ABE-CBE includes the coding gene ABE8e of adenine deaminase and the coding gene Sdd7 of cytosine deaminase, and the coding gene ABE8e and the coding gene Sdd7 in the co-transcription gene ABE-CBE are constructed in the same expression vector.

2. The rice bidirectional single base editing co-transcription unit gene ABE-CBE system according to claim 1, characterized in that: The adenine deaminase in the adenine deaminase encoding gene ABE8e is Tad-8e adenine deaminase evolved from TadA deaminase in Escherichia coli, and the cytosine deaminase in the cytosine deaminase encoding gene Sdd7 is Sdd7 single-chain cytosine deaminase.

3. An expression vector having a rice bidirectional single base editing co-transcription unit gene ABE-CBE system, characterized in that: Each gene fragment in the expression vector is inserted into the same expression frame and at least comprises: (a) the nucleotide sequence shown in SEQ ID No. 1 in the sequence listing; or (b) a nucleotide sequence which replaces one or more nucleotides in the nucleotide sequence shown in SEQ ID No. 1 in the sequence listing and is capable of performing rice genome shearing; or (c) a nucleotide sequence capable of performing rice genome shearing by adding one or more nucleotides to the nucleotide sequence shown in SEQ ID No. 1 in the sequence listing; or (d) A nucleotide sequence in which one or more nucleotides are deleted from the nucleotide sequence shown in SEQ ID No. 1 in the sequence listing and which is capable of performing rice genome shearing.

4. The expression vector of the co-transcription unit gene ABE-CBE with bidirectional single base editing of rice according to claim 3, characterized in that: The expression vector also contains a co-fusion editing tool; In the co-fusion editing tool, the cytosine deaminase coding gene Sdd7 is located at the 5' end of the SpCas9 protein coding gene SpCas9n, the adenine deaminase coding gene ABE8e is located at the 5' end of the coding gene Sdd7, and the coding gene Sdd7 and the coding gene SpCas9n are connected in series with a 10-amino acid linker, and a 4×SV40 NLS nuclear localization signal is placed at the 3' end of the SpCas9 protein coding gene SpCas9n.

5. A method for constructing a fusion editing tool for bidirectional single-base editing in rice, characterized in that: The following steps are involved: The sgRNA expression frame, Cas9 protein, cytosine deaminase ABE8e gene and adenine deaminase Sdd gene are introduced into the target receptor, so that the sgRNA expression frame, Cas9 protein, cytosine deaminase ABE8e gene and adenine deaminase Sdd7 gene are expressed in the target receptor, thereby performing base editing on the target gene in the receptor genome and producing precise and efficient bidirectional single-base editing.

6. The method for constructing a fusion editing tool for bidirectional single base editing in rice according to claim 5, characterized in that: The method further comprises: S1: synthesizing fragments containing the cytosine deaminase ABE8e gene, the adenine deaminase Sdd7 gene and the nSpCas9 gene respectively; S2: The synthesized ABE8e gene fragment, adenine deaminase Sdd7 gene fragment and nSpCas9 gene fragment are PCR amplified and purified to obtain PCR products of ABE8e, Sdd7 and nSpCas9; S3: Using a T vector, the PCR products of ABE8e, Sdd7 and nSpCas9 are homologously recombined to obtain a T-ABE8e-Sdd7-nSpCas9 gene; S4: Add PstI / SacI restriction sites at both ends of the T-ABE8e-Sdd7-nSpCas9 gene, digest with PstI / SacI, recover the ABE8e-Sdd7-nSpCas9 gene fragment, digest the plant intermediate vector pHUC400 with PstI / SacI and recover it, connect the gene fragment ABE8e-Sdd7-nSpCas9 to the intermediate vector pHUC400, and obtain the plant intermediate vector pHUC400-ABE8e-Sdd7-nSpCas9; S5: Recover the ABE8e-Sdd7-nSpCas9 gene fragment in the plant intermediate vector pHUC400-ABE8e-Sdd7-nSpCas9, then use HindⅢ to cut and recover the plant expression vector pHUC422, and connect the gene fragment ABE8e-Sdd7-nSpCas9 to the expression vector pHUC422 to obtain the plant expression vector pHUC422-ABE8e-Sdd7-nSpCas9; S6: Use the enzyme cutting site to connect the promoter and target gene sequence of the plant expression vector to the plant expression vector pHUC422-ABE8e-Sdd7-nSpCas9, and then introduce the plant expression vector pHUC422-ABE8e-Sdd7-nSpCas9 containing the promoter and target gene sequence into the target receptor for expression.

7. The method for constructing a fusion editing tool for bidirectional single base editing in rice according to claim 5, characterized in that: The cytosine dehydrogenase ABE8e gene and the adenine deaminase Sdd7 gene use the same constitutive promoter Ubiqutin and the same 35S terminator.

8. The method for constructing a fusion editing tool for bidirectional single-base editing of rice according to claim 5, characterized in that: The sgRNA expression frame includes: a rice OsU6 promoter, a spectinomycin resistance gene SpR, an artificially synthesized sgRNA backbone sequence and a Poly-T terminator.

9. An application of the rice bidirectional single base editing co-transcription unit gene ABE-CBE system according to claim 1, characterized in that: The application comprises introducing the co-transcription unit gene ABE-CBE into plant callus.

10. The use according to claim 9, characterized in that: The application also includes infecting, co-culturing, and screening plant callus to obtain edited plant callus, and then differentiating the callus into plants, using the rice bidirectional single-base editing co-transcription unit gene AB E-CBE system to improve the site-specific replacement efficiency of CT and AG on the rice genome, and obtain transgenic plants or plant gene fragments containing mutation sites.

Images