Method for removing exogenous genome in cassava

Abstract

The invention discloses a method for removing exogenous genomes in cassava. The method comprises the following steps: (1) selecting a transgenic cassava strain of which a target gene is mutated; (2) selecting tissue culture seedlings of the transgenic cassava strain, inducing axillary buds of the tissue culture seedlings of the transgenic cassava strain to form somatic embryos, continuing to culture the somatic embryos into calluses, performing heat shock treatment on the calluses, inducing the transgenic cassava strain to edit T-DNA of a carrier exogenous gene, and inducing the transgenic cassava strain to edit the T-DNA of the carrier exogenous gene; the Free of all T-DNA of the exogenous gene of the transgenic cassava strain editing carrier is realized. According to the invention, the copy number of T-DNA in a double mutant in a genome is reduced through heat shock treatment, and Free of T-DNA is realized.

Description

Technical Field

[0001] The invention belongs to the technical field of biochemistry and molecular biology, and particularly relates to a method for removing exogenous genomes in cassava. Background Art

[0002] With the increase in population, the reduction in the amount of arable land and the current situation of water shortage, the traditional breeding methods of hybrid breeding and mutation breeding are time-consuming and laborious, and can no longer meet the rapidly growing food demand of mankind. Therefore, it is necessary to continuously innovate crop breeding technology. In the 1980s, transgenic technology came into being. The target gene was introduced into the genome of the organism after cloning and recombination, breaking the bottleneck of traditional reproductive isolation and improving the traits of crops. However, the long and expensive regulatory process and public attention and other limiting factors have prevented the technology from being effectively promoted. The emerging gene editing technology, especially the more efficient, more widely applicable, and lower-cost T-DNA Free plant genome editing technology, can not only achieve precise modification of specific target genes in the genome of the organism and induce the DNA repair mechanism of the organism itself, but also will not introduce exogenous genes, which has accelerated the crop breeding process, reduced regulatory costs, and promoted the industrial application of gene-edited crops, and has been increasingly recognized both internationally and domestically.

[0003] So how do you screen for T-DNA Free gene-edited crops? Five methods have been reported so far. The first is screening through genetic separation, including fluorescent labeling or resistance screening and the TKC (Transgene Killer CRISPR) system. The second is a gene editing system that transiently expresses CRISPR / Cas9 DNA / RNA. The third is the RGEN ribonucleoprotein (RNPs) gene editing system. The fourth is an RNA virus-mediated CRISPR / Cas9 gene editing system. The fifth is haploid induced editing technology (Hi-Edit).

[0004] CRISPR / Cas9 technology requires that expression elements carrying Cas9-sgRNA and transgenic screening markers be introduced into recipient plant materials through Agrobacterium-mediated methods, thereby integrating the expression elements into the plant genome. This method of editing target genes based on CRISPR / Cas9 technology to create new germplasm is prone to biosafety issues, so researchers have developed some methods to achieve T-DNA Free, including the RGEN gene editing system (Kim et al., 2014), the virus-mediated CRISPR / Cas9 gene editing system (Ma et al., 2020), and haploid induced editing technology (Kelliher et al., 2019). Selfing is the main way for most plants to obtain gene-edited materials without exogenous transgenic components. However, the cassava genome is highly heterozygous, and the self-pollinated offspring are severely separated, so the method of separating T-DNA-free offspring through selfing has limitations. Summary of the invention

[0005] The object of the present invention is to provide a method for removing foreign genomes in cassava.

[0006] The above-mentioned object of the present invention can be achieved by the following technical scheme: A method for removing exogenous genomes in cassava, comprising the following steps:

[0007] (1) selecting a transgenic cassava strain with a target gene mutation, extracting DNA from the transgenic cassava strain for genome resequencing, and determining that the T-DNA carrying the target gene is inserted into the cassava chromosome genome;

[0008] (2) selecting the tissue culture seedlings of the transgenic cassava strain described in step (1), inducing the axillary buds of the tissue culture seedlings of the transgenic cassava strain to form somatic embryos, further culturing the somatic embryos into callus tissue, and subjecting the callus tissue to heat shock treatment to induce the T-DNA of the exogenous gene of the editing vector of the transgenic cassava strain, thereby achieving the freeing of all T-DNA of the exogenous gene of the editing vector of the transgenic cassava strain.

[0009] The present invention obtains callus tissue of mutant strains by induction, and performs multiple cycles of heat shock on the callus tissue, and activates the expression of vector editing target sgRNA on both sides of T-DNA through a heat shock promoter, in order to guide the Cas9 protein to remove T-DNA.

[0010] In the above method for removing exogenous genomes from cassava:

[0011] Optionally, the transgenic cassava strain with a mutation in the target gene described in step (1) is constructed by the following method: using a pCAMBIA1301-Cas9-sgRNA editing vector, cloning the target site of the editing target gene MeCYP79D into the vector, and naming it pCAMBIA1301-Cas9-MeCYP79D-sgRNA; genetically transforming cassava brittle embryonic callus tissue using the constructed gene editing vector pCAMBIA1301-Cas9-MeCYP79D-sgRNA by Agrobacterium transformation to obtain a transgenic cassava strain with a mutation in the target gene.

[0012] The CRISPR / Cas9 system is the most widely used gene editing technology. This technology introduces expression elements carrying Cas9-sgRNA and transgenic screening markers into recipient plant materials through Agrobacterium-mediated methods and integrates the expression elements into the genome.

[0013] Optionally, the pCAMBIA1301-Cas9-sgRNA editing vector carries a hygromycin resistance gene expressed by a 35S promoter, a MYB gene expressed by a cassava promoter, and a vector border target sgRNA expressed by a heat shock promoter of T-DNA.

[0014] The present invention screens T-DNAFree gene-edited crops by fluorescent labeling. The principle is to connect the MYB marker gene, heat shock promoter and T-DNA that control anthocyanin synthesis to the CRISPR / Cas9 editing vector, and introduce the plasmid into cassava brittle embryonic callus through Agrobacterium-mediated. During plant tissue culture and vegetative growth, the plasmid expresses Cas9 and sgRNA to edit the target gene. Later, the transgenic positive plants are screened by visualizing the anthocyanins expressed by the MYB gene. Under the optimal heat shock conditions, the heat shock promoter starts the expression of the vector boundary target sgRNA, thereby realizing T-DNA Free and obtaining gene-edited plants without transgenic components.

[0015] The present invention constructs a pCAMBIA1301-Cas9-gRNA vector. In addition to assembling the sgRNA carrying the target gene, the vector expression cassette also adds a hygromycin resistance gene expressed by a 35S promoter, a MYB gene driven by a cassava promoter, and a vector border target sgRNA driven by a heat shock promoter. The MYB gene starts expression, and the leaves of the transgenic plants carry anthocyanins, which change from green to purple, providing a visual screening marker. Through heat shock, the heat shock promoter starts the expression of the vector border target sgRNA, realizing the plant genome T-DNA Free. After the vector is successfully constructed, it is named pCAMBIA1301-Cas9-MeCYP79D-sgRNA, and then the vector is transformed into LBA4404 Agrobacterium and stored at -20°C.

[0016] Optionally, the target gene MeCYP79D includes MeCYP79D1 gene and MeCYP79D2 gene, the nucleotide sequence of the MeCYP79D1 gene is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 3, the nucleotide sequence of the MeCYP79D2 gene is shown in SEQ ID NO: 2, and the amino acid sequence is shown in SEQ ID NO: 4.

[0017] Cassava is an important food crop, but cassava contains cyanogenic glycosides, which will be decomposed into toxic cyanide during digestion in the body. Therefore, it is of great significance to knock out genes in the synthesis of cyanogenic glycosides through gene editing technology to reduce the content of cyanogenic glycosides in cassava. The present invention simultaneously knocks out the rate-limiting enzymes CYP79D1 and CYP79D2 genes in the synthesis of cassava cyanogenic glycosides, aiming to inhibit the synthesis of cyanogenic glycosides, thereby reducing the content of cassava cyanogenic glycosides, so that cassava can be widely promoted in food like sweet potatoes and potatoes. After obtaining the mutant plants, heat shock treatment is performed to edit the left and right boundary targets of the vector T-DNA to induce T-DNA to detach, and finally obtain a new germplasm of non-transgenic low-cyanide cassava.

[0018] In order to explore whether the mutation of MeCYP79D1 and MeCYP79D2 genes affects the synthesis of cyanogenic glycosides in gene-edited cassava, the present invention uses high performance liquid chromatography to detect the content of cyanogenic glycosides in SC8 cassava and double gene-edited cassava leaves. As a result, in the two strains (L33 and L34) of double gene editing, the linamarin content of L33 is zero, and the linamarin content of L34 is close to zero. The content of linamarin in L33 and L34 is both zero. Comprehensive analysis of linamarin and linamarin showed that the content of cyanogenic glycosides in L33 was reduced by 100% compared with the wild type, and the content of cyanogenic glycosides in L34 was reduced by 99.3% compared with the wild type. This shows that the mutation of MeCYP79D1 and MeCYP79D2 genes significantly inhibits the synthesis of cyanogenic glycosides in cassava and greatly reduces the content of cyanogenic glycosides.

[0019] Optionally, the sequences of the target sites of the simultaneously edited target genes MeCYP79D1 gene and MeCYP79D2 gene are as shown in SEQ ID NO:9.

[0020] According to the information of MeCYP79D1 and MeCYP79D2 of SC8 cassava, the optimal target site ATGTTTCCGATGAGTGGCCA (as shown in SEQ ID NO: 7) for editing both MeCYP79D1 and MeCYP79D2 genes was designed using CRISPR-P v2.0 online software. The GC value content of the target site is 50%, the editing score is 0.2545, and the PAM sequence is TGG. The target sites are both located in the first exon of the coding regions of the two genes.

[0021] Optionally, the site where the T-DNA is inserted into the cassava chromosome genome in step (1) is located on chromosome 2 of the cassava genome.

[0022] In order to determine the location of T-DNA insertion in the cassava genome, the present invention resequenced the genomic DNA of the double mutant strains L33 and L34. The analysis found that although the editing types of L33 and L34 were different, the T-DNA insertion sites on the chromosome were the same and were located on chromosome 2.

[0023] Optionally, in step (2), the heat shock temperature is 43° C., the heat shock time is 4 h / day, and the heat shock lasts for 30 days, wherein the GD medium is replaced with a new one every 15 days.

[0024] The present invention has the following advantages:

[0025] (1) The present invention constructs an editing vector carrying the MYB marker gene and genetically transforms cassava SC8 brittle callus to obtain purple cotyledons containing anthocyanin synthesis genes. Through visual screening of purple cotyledons, hygromycin resistance rooting screening, transgenic positive plant identification and Hi-TOM high-throughput sequencing, multiple double mutant strains of MeCYP79D1 and MeCYP79D2 genes are successfully obtained;

[0026] (2) The present invention screened out transgenic positive plants through MYB gene visualization tags, proving that knocking out MeCYP79D1 and MeCYP79D2 genes can reduce the cyanogenic glycoside content of cassava;

[0027] (3) The present invention found through experiments that the optimal condition for the heat shock promoter to start sgRNA is 43°C for 4h. After heat shock, the sgRNA expression drops back to the heat shock level after being placed at 28°C for 48h. The absolute quantitative analysis of the copy number of T-DNA in the genome of the double mutant callus after multiple cycles of heat shock found that the copy number of T-DNA was reduced, indicating that the T-DNA was successfully induced to separate from the mutant cassava genome chromosome;

[0028] (4) The present invention also reduces the copy number of T-DNA in the genome of the double mutant by heat shock treatment, thereby achieving T-DNA Freedom. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The results of 1% agarose gel electrophoresis of cassava MeCYP79D1 and MeCYP79D2 genes in Example 1;

[0030] Figure 2 is the location of the MeCYP79D1 and MeCYP79D2 gene editing targets in Example 1;

[0031] Figure 3 Schematic diagram of the editing vector T-DNA structure in Example 1, Note: LB: left border; Hyg R: hygromycin resistance gene; MYB: anthocyanin marker gene; sgRNA: single guide RNA; GFP: fluorescent marker gene; Cas9: Cas9 protein; RB: right border;

[0032] Figure 4 The results of induction and infection of cassava FEC in Example 1. Note: A: tissue culture seedlings; B: stem segment axillary buds; C:

[0033] Somatic embryo; D: FEC; E: FEC in subculture; F: FEC after transformation;

[0034] Figure 5This is the transgenic cassava regeneration in Example 1. Note: A, B, C: cotyledons; D: regenerated buds; E: regenerated seedlings; F: regenerated plants;

[0035] Figure 6 It is the positive strain screened by PCR in Example 1. Note: M: DL2000 DNA Marker; 1-47: regenerated resistant plants; 48: positive control; WT: negative control;

[0036] Figure 7 The MeCYP79D1 / D2 gene-edited cassava tissue culture seedlings in Example 1 accumulate anthocyanins, WT: non-transgenic cassava, L33 / L34: MeCYP79D1 / D2 gene double-edited cassava;

[0037] Figure 8 is the location of the T-DNA on the chromosome in Example 1;

[0038] Fig. 9 This is a diagram of the single copy effect verified by ddPCR in Example 1, A: single copy strain; B: mutant strain;

[0039] Fig.10 This is the process of inducing brittle embryonic callus of the mutant in Example 1. Note: A: seedling; B: somatic embryo; C: FEC;

[0040] Fig.11 is the relative expression level of sgRNA at different heat shock temperatures in Example 1;

[0041] Fig.12 is the relative expression level of sgRNA at different heat shock times in Example 1;

[0042] Fig.13 is the mutant callus after heat shock in Example 1;

[0043] Fig.14 The mutant callus induced budding after heat shock in Example 1, Note: A: callus; B: induced cotyledon; C: induced budding;

[0044] Fig.15 is the relative expression level of sgRNA at different time periods after heat shock in Example 1;

[0045] Fig.16 is the electrophoresis diagram of the genomic DNA of the heat-shocked cassava callus in Example 1;

[0046] Fig.17 This is a ddPCR effect diagram of callus T-DNA after heat shock in Example 1;

[0047] Fig.18This is a picture of the regenerated plants induced after heat shock and the candidate DNA-Free tissue culture seedlings in Example 1, and the cotyledons in the red frame appear green;

[0048] Fig.19 The candidate DNA-Free tissue culture seedlings and the cyp79d mutant tissue culture seedlings in Example 1;

[0049] Fig. 20 This is the electrophoresis detection diagram of the candidate DNA-Free tissue culture seedlings in Example 1. DETAILED DESCRIPTION

[0050] The technical scheme of the present invention is described in detail below in conjunction with specific embodiments, so that those skilled in the art can better understand and implement the technical scheme of the present invention. The following examples and accompanying drawings are only used for exemplary description and cannot be construed as limiting the present invention. The reagents or materials used in the embodiments, if not otherwise specified, are all derived from commercial channels. Unless otherwise specified, the experimental instruments used are all conventional laboratory instruments.

[0051] To illustrate the present invention in more detail, the following examples are provided. It should be emphasized that the following examples are only for explaining the present invention and are not intended to limit the essential scope or content of the present invention.

[0052] Example 1

[0053] 1. Cloning of SC8 MeCYP79D1 and MeCYP79D2 genes

[0054] In this example, the MeCYP79D1 and MeCYP79D2 genes of SC8 were cloned. The CDS region of the MeCYP79D1 gene is 1629 bp (the nucleotide sequence is shown in SEQ ID NO: 1), encoding 542 amino acids (the nucleotide sequence is shown in SEQ ID NO: 2), and the CDS region of the MeCYP79D2 gene is 1626 bp (the nucleotide sequence is shown in SEQ ID NO: 3), encoding 541 amino acids (the nucleotide sequence is shown in SEQ ID NO: 4).

[0055] Specifically, the following steps were included: extracting total RNA from SC8 cassava (using the Plant Total RNA Isolation Kit Plus kit from FOREGENE Biotechnology to extract total RNA from SC8 tissue culture seedlings), reversely transcribing the total RNA (using MonScript TMTotal RNA was reverse transcribed using RTIII Super Mix with dsDNase (Two-Step) Reverse Transcription Kit), and the cDNA obtained by reverse transcription was used as a template. RT-PCR was performed using MeCYP79D1-F, MeCYP79D1-R, MeCYP79D2-F and MeCYP79D2-R as primers to clone the target genes MeCYP79D1 and MeCYP79D2. The primer sequences are shown in Table 1 below:

[0056] Table 1 Primer sequences

[0057] Primer name Sequence (5`-3`) MeCYP79D1-F TGGCGATATCCCTGGATTTGA (SEQ ID NO: 5) MeCYP79D1-R GCAAGAGAAACAAGATAACCCCA (SEQ ID NO: 6) MeCYP79D2-F TCTTGGTCATAGCCCTGGAC (SEQ ID NO: 7) MeCYP79D2-R TCCCTTCCCATCTTTGGGCT (SEQ ID NO: 8)

[0058] The results of 1% agarose gel electrophoresis showed that both genes had a single target band of about 2000 bp, which was consistent with the expected fragment length ( Figure 1 ).

[0059] The amplified products of MeCYP79D1 and MeCYP79D2 genes were recovered, connected to the recombinant vector (the purified products were connected to TAKARA's T-Vector pMD19 (simple) at 16°C for 2 hours), transformed into Escherichia coli DH5α competent cells with the recombinant vector, screened for positive clones, sequenced, and extracted the recombinant plasmid.

[0060] 2. Construction of CRISPR / Cas9 gene dual editing vector for MeCYP79D1 and MeCYP79D2 genes

[0061] 2.1 Selection of MeCYP79D1 and MeCYP79D2 gene target sites

[0062] According to the information of MeCYP79D1 and MeCYP79D2 of SC8 cassava, the optimal target ATGTTTCCGATGAGTGGCCA (SEQ ID NO: 9) for editing both MeCYP79D1 and MeCYP79D2 was designed using CRISPR-P v2.0 online software. The GC value of the target is 50%, the editing score is 0.2545, and the PAM sequence is TGG. The target is located in the first exon of the coding region of the two genes ( Figure 2 ).

[0063] 2.2 Construction of dual editing vectors for MeCYP79D1 and MeCYP79D2 genes

[0064] In this experiment, the pCAMBIA1301-Cas9-gRNA vector was constructed (constructed according to the method in application number 202111588443.3). In addition to assembling the sgRNA carrying the target gene, the expression cassette of the vector also added a hygromycin resistance gene driven by the 35S promoter, a MYB gene driven by the cassava promoter, and a vector border target sgRNA driven by a heat shock promoter ( Figure 3 ). The MYB gene starts expression, and the leaves of the transgenic plants carry anthocyanins, changing from green to purple, providing a visual screening marker. Through heat shock, the heat shock promoter starts the expression of the vector boundary target sgRNA, achieving plant genome T-DNA Free. After the vector was successfully constructed, it was named pCAMBIA1301-Cas9-MeCYP79D-sgRNA, and then the vector was transformed into LBA4404 Agrobacterium and stored at -20℃.

[0065] Referring to the method of Li Zhan (2020), the co-target site for editing MeCYP79D1 and MeCYP79D2 genes was cloned into the pCAMBIA1301-Cas9-sgRNA vector, and the plasmid was sent to a sequencing company for sequencing to verify whether the vector was successfully constructed. After successful construction, it was named pCAMBIA1301-Cas9-gRNA-MeCYP79D.

[0066] 2.3 Transformation of recombinant plasmid pCAMBIA1301-Cas9-gRNA-MeCYP79D into LBA4404

[0067] (1) The pCAMBIA1301-Cas9-gRNA-MeCYP79D plasmid with successful recombination was transformed into LBA4404 Agrobacterium competent cells. For specific operation steps, please refer to the LBA4404 instruction manual.

[0068] (2) For coating, YEP solid medium to which kan and rif were added in advance at a concentration of 50 μg / mL was used.

[0069] 2.4 Preparation and transformation of cassava FEC (cassava embryonic callus)

[0070] 2.4.1 Preparation of cassava FEC

[0071] (1) Select SC8 cassava plantlets with good growth, with a growth period of about 40 days, pick axillary buds, and transfer them to CIM medium. The operation is carried out under a microscope. After the operation is completed, the culture medium is placed in the dark at a temperature of 28°C for 18 days.

[0072] (2) After 3-4 cycles, the axillary buds that grew well in step (1) gradually turned into somatic embryos.

[0073] (3) Some somatic embryos with poor growth were removed, and the somatic embryos with good growth were transferred to new CIM medium for further expansion.

[0074] (4) After expansion culture, the somatic embryos that grew well were transferred to GD medium and cultured in the dark for 21 days at a temperature of 28°C.

[0075] (5) Somatic embryos cultured in dark on GD medium can form SC8 cassava friable callus (FEC) after 4-5 cycles.

[0076] (6) The well-growing FECs obtained can be divided into several small pieces and transferred to new GD medium for expansion culture to provide sufficient callus tissue for subsequent experiments.

[0077] 2.4.2 Genetic transformation gene editing vector

[0078] (1) Take out the Agrobacterium containing the gene editing vector pCAMBIA1301-Cas9-gRNA-MeCYP79D stored in a -80°C refrigerator, add rif and kan at a concentration of 50 μg / mL to the solid YEP medium, and use a sterilized pipette tip to streak the Agrobacterium on the YEP plate. The entire operation is performed in a clean bench.

[0079] (2) After streaking, select a few growing single colonies for plaque PCR verification. Prepare liquid YEP culture medium (add rif and kan at a concentration of 50 μg / mL) in advance and dispense into centrifuge tubes, 1.5 mL per tube. After successful plaque PCR verification, place the culture in a centrifuge tube.

[0080] (3) Prepare 50 mL of working solution in advance. Both the working solutions rif and kan are 50 μg / mL YEP medium. Transfer the cultured bacteria in the centrifuge tube into the working solution and culture until the concentration is OD 600 = 0.75-1.0.

[0081] (4) Add 40 mL of cultured bacterial solution to a 50 mL sterile centrifuge tube and set the centrifuge speed to 5000 rpm, temperature to 25°C, and centrifuge for 10 min to collect the bacteria.

[0082] (5) After centrifugation, discard the supernatant in the centrifuge tube and keep the bacterial cells. Prepare liquid GD medium in advance, add acetosyringone to it at a concentration of 200 μmol / l, and mix well. Add 30 mL of the mixed liquid GD medium to the bacterial cells and shake well. Put it into the centrifuge again, maintain the same speed and temperature conditions as in (4), and centrifuge for 10 minutes to collect the bacterial cells.

[0083] (6) Repeat step (5) once.

[0084] (7) After centrifugation, discard the supernatant, add 21 mL of liquid GD medium to the bacteria, mix thoroughly, and then pipette 1 mL into a 1.5 mL centrifuge tube for concentration measurement. Use two 50 mL centrifuge tubes to resuspend the bacterial solution after concentration measurement to OD 600 = 0.65 for later use.

[0085] (8) Take 20 clusters of SC8 brittle callus and put them into a centrifuge tube and shake them loose. The callus used in this study is cassava brittle callus that has been dark-cultured for three months (prepared in 2.4.1). After shaking the callus in the centrifuge tube, adjust the speed of the centrifuge to 1000 rpm, and keep the temperature and time unchanged. After the centrifugation is completed, place the centrifuge tube in a shaker at a speed of 40 rpm and culture at 25°C for 40 minutes.

[0086] (9) Acetosyringone was added to the solid GD medium at a concentration of 200 μmol / L in advance. A nylon mesh was placed on the absorbent paper, and the callus tissue after co-cultivation was moved into the nylon mesh. After the absorbent paper completely absorbed the water on the nylon mesh, the nylon mesh and the callus tissue were moved into the solid GD medium and cultured at 22°C for 3 days in a dark environment.

[0087] (10) After 3 days of culture, the callus was washed three times with liquid GD medium, dried with absorbent paper, and transferred to new solid GD medium together with the nylon mesh. Incubate at 28°C for 7 days in the dark. (Carbenicillin was added to the liquid and solid GD medium at concentrations of 500 mg / L and 250 mg / L, respectively).

[0088] (11) Add carbenicillin and hygromycin to solid GD medium at concentrations of 250 mg / L and 5 mg / L respectively for future use. Remove the callus tissue from the original medium together with the nylon mesh after 7 days of dark culture and transfer them to a new GD medium for further culture. Protect from light, keep the temperature at 28°C, and culture for 7 days. Then gradually increase the concentration of hygromycin to 8 mg / L, 15 mg / L, and 20 mg / L, and keep the culture time at each concentration unchanged at 7 days.

[0089] (12) Carbenicillin and hygromycin were added to the solid MSN medium at concentrations of 250 mg / L and 15 mg / L, respectively. The callus tissue was removed from the GD medium together with the nylon mesh and transferred to the MSN medium. The photoperiod was 16 h, the culture room temperature was set at 28 °C, and the culture time was 14 days.

[0090] (13) Repeat step (12) twice until the callus swells.

[0091] SC8 cassava FEC was obtained by induction, and the constructed gene editing vector pCAMBIA1301-Cas9-gRNA-MeCYP79D was used to infect cassava FEC by Agrobacterium transformation, and finally 2 dishes of callus were obtained ( Figure 4 ). Since the MYB gene carried on the gene editing vector can control the synthesis of anthocyanins, it provides a visual label for screening positive plants. Later, the callus tissue can be judged whether it has been successfully transformed by observing whether the color of the cotyledons is purple.

[0092] 2.5 Creation of MeCYP79D1 and MeCYP79D2 double gene mutants

[0093] 2.5.1 Obtaining regenerated seedlings

[0094] (1) Carbenicillin and hygromycin were added to the solid MSN medium at concentrations of 250 mg / L and 15 mg / L, respectively. The culture room temperature was set to 28°C and the photoperiod was 16 h. The callus prepared in 2.4.2 was grown in the MSN under these conditions. The medium was changed every 14 days until cotyledons grew.

[0095] (2) Carbenicillin was added to the CEM medium containing 0.1 mg / L 6-BA at a concentration of 200 mg / L, and the grown cotyledons were transferred from the MSN to the CEM medium for further culture. The photoperiod was 16 h and the temperature was 28°C. The medium was changed every 7 days until the cotyledons were induced into seedlings.

[0096] 2.5.2 Rooting and screening of regenerated plants

[0097] Hygromycin and carbenicillin were added to the solid MS medium at concentrations of 15 mg / L and 50 mg / L, respectively. The regenerated seedlings obtained in 2.5.1 were transferred from the CEM medium to the MS medium for rooting screening. After 20 days, the rooted lines were selected for the next experiment.

[0098] After transformation, 121 cotyledons were grown from the two callus dishes on MSN medium, 78 of which were purple cotyledons. It is speculated that these 78 purple cotyledons were successfully transferred into the editing vector. For further verification, all 121 cotyledons were placed on CEM medium for further induction, and 67 regenerated buds were obtained. The 67 regenerated buds were transferred to MS medium, and 47 regenerated plants were induced ( Figure 5 ). The regenerated plants were transferred to MS medium supplemented with hygromycin for rooting screening, and it was found that all 47 plants had roots.

[0099] 2.5.3 PCR detection of positive strains

[0100] (1) Leaf lysis of rooted plants

[0101] Sample the leaves of the rooted strains, with a leaf area of ​​about 2 square millimeters, and place them in a PCR tube. Add 30 μL of M5 ultrafast lysis solution from Beijing PolyMei Biotechnology Co., Ltd. and grind the leaves in the PCR tube with a gun. Set the PCR instrument temperature to 94°C and the time to 5 minutes to perform thermal lysis on the ground and broken samples. The pyrolysis solution can be used for the next experimental verification.

[0102] (2) PCR positive strains

[0103] The target fragment was amplified using universal target primers using the cleaved DNA in (1) as a template. The amplification results were detected by 1% agarose gel electrophoresis.

[0104] The leaf direct PCR kit was used to perform PCR on the leaves of 47 regenerated resistant strains rooted in hygromycin. After PCR amplification of the target fragment, 1% agarose gel electrophoresis was used to detect the amplification effect. The results showed that the size of 35 bands met the expected length of the target fragment, which was about 600 bp ( Figure 6 ). This result indicated that a total of 35 transgenic positive lines were obtained.

[0105] 2.5.4 Hi-TOM high-throughput sequencing of positive strains to verify the effect of MeCYP79D1 and MeCYP79D2 gene editing

[0106] The editing status of the obtained mutants was analyzed and the specific forms of mutations in the MeCYP79D1 and MeCYP79D2 genes were further identified using Hi-TOM technology, which required two rounds of PCR reactions.

[0107] Eight positive strains were randomly selected for Hi-TOM detection of the editing effect of the target gene. The second round of PCR products were sent to Novogene Biotech for high-throughput sequencing, and the sequencing results were analyzed using Hi-TOM online analysis software. It was found that the MeCYP79D1 and MeCYP79D2 genes of six of the eight randomly selected positive strains were edited at the same time, and frameshift mutations occurred in two strains, L33 and L34. The results are shown in Table 2 below:

[0108] Table 2 Analysis of Hi-TOM results of positive strains

[0109]

[0110]

[0111] Note: The black bold underline represents the PAM region; -- represents the missing base; I: insertion, D: deletion, SNP: substitution, WT: wild type.

[0112] 2.6 Subculture of gene-edited plants and phenotypic observation

[0113] The mutant plants in the tissue culture bottles were removed from the roots, the leaves were removed, and the stem segments with buds were retained. The stem segments were segmented and inserted into solid MS culture medium for subculture. The operation process should be completed in a clean bench that has been sterilized by ultraviolet light. Enough strains can be obtained for subsequent seedling hardening and transplanting. After the seedlings are transplanted, the seedling box is placed on a culture rack specially equipped in this laboratory and cultured for 21 days before being taken out. The photoperiod is 16 hours and the temperature is 28°C. The seedlings are cultured indoors for one week and then moved outdoors for further cultivation. After one week outdoors, the plants can be transplanted into pots with a substrate and red soil ratio of 1:3 for cultivation. A small amount of compound fertilizer can be applied during the cultivation period, with an interval of about 20 days.

[0114] L33 and L34 were selected for subsequent research. By comparing the double mutant strains L33, L34 and the wild-type strain in tissue culture bottles, it was found that compared with the wild-type, the most obvious phenotype of the mutant strain was purple leaves ( Figure 7 ). This result indicates that the anthocyanin marker expression frame on the gene editing vector of this study functions normally and promotes the accumulation of anthocyanins in cassava, and can be used as a screening marker for the successful transformation of cassava by gene editing vectors.

[0115] 2.7 Analysis of cyanogenic glycoside content in mutant strains

[0116] 2.7.1 Preparation of cassava flour

[0117] The leaves of potted seedlings of cassava wild-type SC8 and mutant strains were quickly frozen in liquid nitrogen, ground into cassava flour, and then further quickly frozen in liquid nitrogen, and stored in a -80°C refrigerator for use.

[0118] 2.7.2 Extraction of cyanogenic glycosides

[0119] Take 0.200g of pre-ground cassava flour frozen at -80℃, add 1.5mL of 0.100M pre-cooled sulfuric acid, and vortex to mix. Set the centrifuge speed to 10,000rpm and the temperature to 4℃ in advance, centrifuge for 10min, and collect the supernatant for sample analysis. All sample supernatants can be stored at -20℃ for use. Thaw and mix the samples before loading them, filter them with 0.22μm PTFE microporous filter membrane, and perform HPLC analysis. Set 3 replicates for each sample.

[0120] 2.7.3 Detection of cyanogenic glycosides

[0121] An Agilent 1260 liquid chromatography system was used to analyze cyanogenic glycosides, equipped with a quaternary pump (model: G1311C), an automatic sampler (model: G1329B), an evaporative light detector (model: G4260B) and a column oven (model: G1316A); a chromatographic column (Atlantic C18, 4.6 mm × 150 mm, 5 μm) purchased from Waters, USA; an Elix3+Synergy ultrapure water system purchased from Millipore, USA; and a 1 / 10,000 balance (model: BSA124S) purchased from Sartorius, USA.

[0122] The cyanogenic glycosides in the sample were analyzed by liquid chromatography. Chromatographic conditions: Waters Atlantic C18 column (4.6mm×150mm, 5μm), column temperature 25℃, binary gradient elution, mobile phase A was 80% acetonitrile / water (V / V) containing 0.1% formic acid (v / v), and B was 0.1% (v / v) formic acid aqueous solution. At the beginning, A was 10%, B was 90%, and at 15min, A and B were both 50%; at 18min, A was 100%, and maintained for 2min; at 22min, A changed to 10%, B% to 90%; balance the column for 5min, and then enter the next sample. Flow rate 0.6mL / min; drift tube temperature 95℃, atomization temperature 80℃, air flow rate: 2.0L / min; gain 3; injection volume 10μL; the content of linamarin and radix lansimarin in the sample was calculated by external standard method.

[0123] In order to explore whether the mutation of MeCYP79D1 and MeCYP79D2 genes affects the synthesis of cyanogenic glycosides in gene-edited cassava, this study used high-performance liquid chromatography to detect the content of cyanogenic glycosides in the leaves of SC8 cassava and double-gene-edited cassava. As a result, in the two double-gene-edited strains, the linamarin content of L33 was zero, and the linamarin content of L34 was close to zero. The content of linamarin in L33 and L34 was zero. Based on the comprehensive analysis of linamarin and linamarin, it was found that the content of cyanogenic glycosides in L33 was 100% lower than that in the wild type, and the content of cyanogenic glycosides in L34 was 99.3% lower than that in the wild type. This shows that the mutation of MeCYP79D1 and MeCYP79D2 genes significantly inhibited the synthesis of cyanogenic glycosides in cassava and greatly reduced the content of cyanogenic glycosides.

[0124] 2.8 Free T-DNA in double mutants

[0125] 2.8.1 Mutant genomic DNA resequencing

[0126] In order to determine the location of T-DNA insertion in the cassava genome, this study resequenced the genomic DNA of the double mutant strains L33 and L34. Two strains with simultaneous frameshift mutations in the MeCYP79D1 and MeCYP79D2 genes were selected, and DNA from the two strains was extracted for genome resequencing to determine whether the T-DNA carrying the target gene was inserted into the cassava chromosome genome. The analysis found that although the editing types of L33 and L34 were different, the T-DNA insertion sites on the chromosome were the same and were both located on chromosome 2 ( Figure 8 ).

[0127] At the same time, digital PCR was performed to verify the genomic DNA of L33 and L34, and compared with the known single-copy strains to verify whether the T-DNA of the mutant strains is a single-copy gene in the genome. The results showed that the T-DNA copy number of L33 and L34 was 1 ( Fig. 9 ), which is consistent with the resequencing result.

[0128] 2.8.2 Obtaining mutant callus

[0129] Take the tissue culture seedlings of the two mutant lines, pick out the axillary buds of the tissue culture seedlings with a syringe needle under a microscope and place them on CIM medium, induce somatic embryo formation under dark conditions, and change the medium every 7-10 days. After somatic embryo formation, it continues to grow and gradually transitions to callus tissue. In this step, the callus tissue can be transferred to GD medium.

[0130] The axillary buds of the MeCYP79D1 and MeCYP79D2 double mutant L33 were induced to form somatic embryos. The somatic embryos of the mutants were purple during the growth stage. When the somatic embryos continued to be cultured into callus tissue, the purple color gradually disappeared (Figure Fig.10 ). The obtained L33 mutant callus can be subjected to the next step of heat shock treatment to induce the editing of the T-DNA on the vector.

[0131] 2.8.3 Determining the optimal heat shock conditions

[0132] Since the heat shock promoter is assembled on the T-DNA of the vector, the heat shock promoter starts the expression of the target sgRNA at the border of the vector, which can make the sgRNA inserted into the genome separate from the chromosome. Therefore, it is necessary to explore the optimal heat shock conditions to maximize the heat shock efficiency.

[0133] The incubator temperature of the experimental group was set at 35°C, 37°C, 39°C, 41°C, and 43°C, with 5 temperature gradients, and the control group was set at 28°C. One bottle of tissue culture seedlings was placed in each temperature gradient of the experimental group to heat shock the callus for 2 hours. Three seedlings in one bottle of tissue culture seedlings were used as 3 replicates. After heat shock, the leaves of the tissue culture seedlings in the experimental group and the control group were removed, and the stem segments were used for RNA extraction, reverse transcription into cDNA, and Q-PCR was performed on the reverse transcribed cDNA. The optimal heat shock temperature was determined based on the results of fluorescent quantitative PCR.

[0134] The results showed that the expression of sgRNA was activated at 39°C and increased significantly. The relative expression of sgRNA was the highest at 43°C, about 350 times that of the control group. Therefore, 43°C was determined as the optimal temperature for heat shock ( Fig.11 ).

[0135] According to the optimal heat shock temperature established in the previous step, the experimental group tissue culture seedlings were heat-shocked at the optimal heat shock temperature for 2h, 4h, 6h, and 8h, and three strains of tissue culture seedlings in the same bottle were used as three replicates. After heat shock, RNA from the experimental group and the control group was extracted and reverse transcribed into cDNA, and real-time fluorescence quantitative PCR was performed to perform relative quantitative analysis of the sgRNA of the tissue culture seedlings, and the optimal heat shock time was determined based on the Q-PCR results.

[0136] The results showed that the expression level of sgRNA increased first and then decreased with the extension of heat shock time, reaching the highest level at 4h ( Fig.12 ), which is about 750 times that of the control group, thus the optimal heat shock duration was determined to be 4h.

[0137] 2.8.4 Heat-Shocked Callus and Induced Cotyledons

[0138] The callus obtained in 2.8.2 was placed in an incubator in the dark, and the optimal heat shock temperature and optimal heat shock duration of the incubator were set. 24 hours was one cycle, and multiple heat shocks were performed in multiple cycles. The number of heat shocks was 6, 9, 12, 15 and 18 times respectively. After heat shock, part of the callus can be transferred from the GD medium to the MSN medium without hygromycin, and light culture was used to induce the formation of cotyledons.

[0139] After determining the optimal temperature and duration, the transgenic callus on the GD medium was subjected to 6, 9, 12, 15, and 18 cycles of heat shock under the optimal conditions. Since the T-DNA of the transgenic callus carries the GFP fluorescent marker gene, the callus was illuminated with a fluorescent flashlight and it was found that the fluorescence of some of the heat-shocked callus had disappeared ( Fig.13 ). It is speculated that the callus tissue with lost fluorescence has achieved the separation of T-DNA from the genome.

[0140] After heat shock, the callus was transferred from GD medium to MSN medium again, and cotyledons were induced by light culture. At this time, some cotyledons were free of anthocyanins ( Fig.14 ).

[0141] 2.8.5 Changes in relative expression of sgRNA at different times at room temperature after heat shock

[0142] Prolonged heat shock may affect the vitality of callus tissue. Therefore, this study explored the process of decreasing the expression of sgRNA after the callus tissue was placed at room temperature (28°C) for different time periods after heat shock (43°C, 4h). The relative expression of sgRNA was analyzed and it was found that the relative expression of sgRNA was the highest when placed at room temperature for 0h after heat shock treatment. As the time at room temperature increased, the relative expression of sgRNA gradually decreased, reaching the lowest expression at 48h ( Fig.15 ). Therefore, it can be inferred that after each heat shock for 48 h, sgRNA returns to the lowest expression level.

[0143] 2.8.6 Digital PCR Analysis of T-DNA Isolation Effect

[0144] The genomic DNA of callus tissue was extracted after heat shock for 0, 6, 9, 12, 15, and 18 days. Fig.16 ), and ddPCR was performed. The results showed that the copy number of T-DNA decreased ( Fig.17 ), indicating that some callus tissues achieved partial T-DNA Free after heat shock.

[0145] 2.8.7 Callus induction and plant regeneration after heat shock and detection

[0146] The callus was heat-shocked using the optimized heat shock conditions, and the heat-shocked callus was transferred to non-resistant MSN medium to induce the formation of regenerated cotyledons. The cotyledons without purple were selected and transferred to CEM medium to induce the formation of regenerated plants ( Fig.18 , Fig.19 ). The genomic DNA was extracted from the regenerated plants whose leaves were not purple, and PCR was performed using Cas9 detection primers. The results showed that no Cas9 gene fragment was amplified, indicating that the exogenous T-DNA had been removed ( Fig. 20 ). PCR detection was performed using CYP79D2 target detection primers to detect that the target gene in the regenerated plants was still edited and the editing form remained unchanged.

[0147] The above embodiments are only used to illustrate the present invention, and the protection scope of the present invention is not limited to the above embodiments. A person skilled in the art can achieve the purpose of the present invention based on the above disclosure of the present invention, and any improvement and deformation based on the concept of the present invention shall fall within the protection scope of the present invention, and the specific protection scope shall be subject to the claims.

Claims

1. A method for removing exogenous genomes in cassava, characterized in that: The following steps are involved: (1) selecting a transgenic cassava strain with a target gene mutation, extracting DNA from the transgenic cassava strain for genome resequencing, and determining that the T-DNA carrying the target gene is inserted into the cassava chromosome genome; (2) selecting the tissue culture seedlings of the transgenic cassava strain described in step (1), inducing the axillary buds of the tissue culture seedlings of the transgenic cassava strain to form somatic embryos, further culturing the somatic embryos into callus tissue, and subjecting the callus tissue to heat shock treatment to induce the T-DNA of the exogenous gene of the editing vector of the transgenic cassava strain, thereby achieving the freeing of all T-DNA of the exogenous gene of the editing vector of the transgenic cassava strain.

2. The method for removing exogenous genomes in cassava according to claim 1, characterized in that: The transgenic cassava strain with a mutation in the target gene described in step (1) is constructed by the following method: using a pCAMBIA1301-Cas9-sgRNA editing vector, cloning the target site of the editing target gene MeCYP79D into the vector, and naming it pCAMBIA1301-Cas9-MeCYP79D-sgRNA; genetically transforming cassava brittle embryonic callus tissue using the constructed gene editing vector pCAMBIA1301-Cas9-MeCYP79D-sgRNA by Agrobacterium transformation to obtain a transgenic cassava strain with a mutation in the target gene.

3. The method for removing exogenous genome in cassava according to claim 2, characterized in that: The pCAMBIA1301-Cas9-sgRNA editing vector carries a hygromycin resistance gene expressed by a 35S promoter, a MYB gene expressed by a cassava promoter, and a vector border target sgRNA expressed by a heat shock promoter of T-DNA.

4. The method for removing exogenous genome in cassava according to claim 2, characterized in that: The target gene MeCYP79D includes MeCYP79D1 gene and MeCYP79D2 gene, the nucleotide sequence of the MeCYP79D1 gene is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2, the nucleotide sequence of the MeCYP79D2 gene is shown in SEQ ID NO: 3, and the amino acid sequence is shown in SEQ ID NO:

4.

5. The method for removing exogenous genomes in cassava according to claim 4, characterized in that: The sequence of the target site for simultaneously editing the target genes MeCYP79D1 gene and MeCYP79D2 gene is shown in SEQ ID NO:

9.

6. The method for removing exogenous genomes in cassava according to claim 1, characterized in that: The site where the T-DNA is inserted into the cassava chromosome genome in step (1) is located on chromosome 2 of the cassava genome.

7. The method for removing exogenous genomes in cassava according to claim 1, characterized in that: In step (2), the heat shock temperature is 43°C, the heat shock time is 4 hours per day, and the heat shock is continued for 18 days.

Images