Multiplex nucleic acid detection primer probe group, kit and detection method

Abstract

The invention discloses a multiplex nucleic acid detection primer probe group, a kit and a detection method, and belongs to the technical field of gene detection. The invention provides a multiplex nucleic acid detection primer probe group, which comprises a target primer, a hairpin probe primer, a general fluorescent probe, a general crRNA, an auxiliary target and a reporter probe, and can be combined with qPCR, ddPCR, CRISPR / Cas12a and melting curve analysis (MCA) technologies to realize nucleic acid specificity and multiplex detection based on the general fluorescent probe or the crRNA. The invention also provides a kit containing the multiplex nucleic acid detection primer probe group, and a corresponding detection method. The problem that the number of single-tube detection targets is limited due to limitation of a fluorescent channel is solved.

Description

Technical Field

[0001] The invention belongs to the technical field of gene detection, and in particular relates to a multiple nucleic acid detection primer probe group, a kit and a detection method. Background Art

[0002] Nucleic acid amplification technology is an indispensable and important tool for clinical diagnosis and biomedical research. It can be used to evaluate gene expression, identify DNA variations, and detect pathogens in patient samples. Real-time quantitative polymerase chain reaction (RT-qPCR) and digital PCR technology have shown excellent specificity and sensitivity in detecting nucleic acids. However, these methods usually require target-specific fluorescent probes to ensure the specificity of detection. Due to the high cost of specific probes, the analysis cost increases. In addition, because there are only 5 to 6 fluorescent channels in the fluorescent quantitative PCR instrument, the number of targets that can be detected at the same time is limited, that is, the multiplicity of detection is limited.

[0003] Previous universal detection technologies have faced challenges such as nonspecific amplification, insufficient sensitivity and multiplexity, and incompatibility with digital PCR. The mediating probe is cleaved by Taq polymerase to produce a mediating primer, which can achieve specific universal DNA detection in quantitative PCR (qPCR) or droplet digital PCR (ddPCR). MeltArray technology is a multiplex PCR method based on melting curve analysis (MCA) using a mediating probe. However, these detection methods do not fully utilize the mediating primer from the mediating probe, and modifications such as PO4 or C7NH2 at the 3' end of the mediating probe to prevent extension will increase the detection cost. At the same time, the effectiveness of this method depends on the effective combination of the amplicon and the mediating probe in each amplification cycle to produce a mediating primer. However, the continuous change of the amplicon concentration is not conducive to the combination of the two in different cycles. Therefore, it is necessary to innovate a new technology for universal and multiplex DNA detection. Summary of the invention

[0004] The present invention provides a multiple nucleic acid detection primer probe group, a kit and a detection method, which improve the detection performance, reduce the cost and get rid of the dependence on the mediating probe.

[0005] The present invention provides a multiple nucleic acid detection primer probe set, including a target primer, a hairpin probe primer, a universal fluorescent probe, a universal crRNA, an auxiliary target and a reporter probe;

[0006] The hairpin probe primer comprises: a 3' end complementary to the template DNA of the nucleic acid to be detected, an intermediate sequence consisting of 15 to 35 bases complementary to its own single-stranded amplicon, and a 5' end containing a protruding sequence of 10 to 25 bases;

[0007] The hairpin structure formed by the hairpin probe primer in the cooling step of PCR is degraded by Taq polymerase, and a secondary primer complementary to the auxiliary target or universal fluorescent probe is generated;

[0008] The two ends or the middle position of the universal fluorescent probe are respectively modified with a luminescent group and a quenching group, and a section of the universal fluorescent probe in the melting curve analysis is complementary to the secondary primer and can be extended and amplified to generate a certain length of double-stranded DNA;

[0009] The 3' end of the auxiliary target is complementary to the secondary primer, and the 5' end is complementary to the universal fluorescent probe or universal crRNA, and the 3' end or both ends of the auxiliary target contain continuous bases or modification groups to avoid non-specific extension.

[0010] In one embodiment of the present invention, the hairpin probe primer is designed upstream or downstream of the amplification template.

[0011] In one embodiment of the present invention, the secondary primer comprises the overhanging sequence at the 5' end of the hairpin probe primer, and the 3' end further comprises part of the bases of the middle sequence of the hairpin probe primer.

[0012] In one embodiment of the present invention, when multiple nucleic acid detection is performed using qPCR or ddPCR, the sequence length of the universal fluorescent probe is 10 to 35 bases;

[0013] When the melting curve analysis method is used for multiple nucleic acid detection, the sequence length of the universal fluorescent probe is 30 to 150 bases.

[0014] In one embodiment of the present invention, the universal fluorescent probe is a synthetic single-stranded DNA or a modified DNA with changed hybridization affinity, including at least one of the following: locked nucleic acid, peptide nucleic acid and DNA minor groove binder.

[0015] In one embodiment of the present invention, the universal fluorescent probe is cleaved under the action of Taq enzyme to release a fluorescent signal, and the type of the universal fluorescent probe includes any one of the following: Taqman probe and double quencher probe.

[0016] The present invention also provides a multiple nucleic acid detection kit, comprising the multiple nucleic acid detection primer probe group, hot start polymerase, polymerase buffer, dNTPs and MgCl2.

[0017] The present invention also provides a multiple nucleic acid detection method, comprising using the multiple nucleic acid detection kit and a target nucleic acid preparation system to perform amplification.

[0018] In one embodiment of the present invention, the multiple nucleic acid detection method includes any one of the following: qPCR, ddPCR, CRISPR / Cas12a or melting curve analysis.

[0019] In one embodiment of the present invention, the target nucleic acid includes any one of the following: extracted sample DNA containing rare mutations or wild-type genes, cDNA obtained by reverse transcription, synthesized plasmid DNA or single-stranded DNA.

[0020] Beneficial effect: The present invention provides a multiple nucleic acid detection primer probe set, including a target primer, a hairpin probe primer, a universal fluorescent probe, a universal crRNA, an auxiliary target and a reporter probe, and its working principle for detection is as follows Figure 1 As shown, the new detection system is named as the hairpin probe primer amplification system (HPPA), which can be combined with qPCR, ddPCR, CRISPR / Cas12a and melting curve analysis (MCA) technology to achieve nucleic acid specific and multiple detection based on universal fluorescent probes or crRNA. During the amplification process, the hairpin probe primer hybridizes with the template and initiates extension to produce a complementary chain. In the subsequent cycle, the intermediate sequence hybridizes with the complementary sequence of its own DNA chain in the cooling step of PCR, and folds to form a hairpin structure. In the technical scheme of the present invention, the formed stable hairpin structure is cut by Taq polymerase during primer extension, and secondary primers are continuously generated in each cycle, and the 3' end of these secondary primers has some bases of the intermediate sequence of the hairpin probe primer. The auxiliary target is designed to match the endogenous secondary primer and the universal fluorescent probe. The released secondary primer binds to the auxiliary target, extends and cuts the universal fluorescent probe (HPPAqPCR, ddPCR). In addition, universal crRNA is combined with double-stranded DNA (with PAM sequence) amplified by secondary primers to realize CRISPR / Cas12a-specific DNA detection (HPPACRISPR / Cas12a) based on universal crRNA. Furthermore, different secondary primers can be extended at different positions of the fluorescent probe to produce fluorescent double-stranded DNA of different lengths or melting temperatures (Tm), thereby distinguishing different targets by the combination of fluorescent color and Tm value. This technology is called HPPA melting curve analysis (HPPA-MCA), which overcomes the problem of limited number of targets detected in a single tube due to limited fluorescence channels. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of the principle of a method for achieving specific and multiplex detection of nucleic acids based on universal probes or crRNA;

[0022] Figure 2 The results of HPPAqPCR and specific probe qPCR for detecting HPV18 (A, B) and HPV16 (C, D), where A and C are amplification curves, and B and D are linear analysis;

[0023] Figure 3 The results of the HPPAddPCR system quantifying different cDNA targets and comparing them with the specific probe ddPCR;

[0024] Figure 4 Results of the HPPACRISPR / Cas12a system detecting different concentrations of HPV18 (A, B) and 16 (C, D) targets;

[0025] Figure 5 Visualization of the dual HPPACRISPR / Cas12a system for detecting HPV16 and 18 targets and applying it to clinical specimen detection results;

[0026] Figure 6 The results of the HPPAMCA system detecting HPV16, 18, 31 and 33 targets are shown in Figure 1. In the figure, A, B and C represent multiplex detection using linear probes, D and E represent multiplex detection using hairpin probes, and arrows represent the positions of secondary primers.

[0027] Figure 7 This is a result diagram of the HPPA-MCA system detecting multiple HPV targets based on multiple universal probes. The concentration of each target in the figure is 500 copies per reaction, and the arrows indicate different secondary primers generated by amplification of different targets. DETAILED DESCRIPTION

[0028] The present invention provides a multiple nucleic acid detection primer probe set, including a target primer, a hairpin probe primer, a universal fluorescent probe, a universal crRNA, an auxiliary target and a reporter probe;

[0029] The hairpin probe primer comprises: a 3' end complementary to the template DNA of the nucleic acid to be detected, an intermediate sequence consisting of 15 to 35 bases complementary to its own single-stranded amplicon, and a 5' end containing a protruding sequence of 10 to 25 bases;

[0030] The hairpin structure formed by the hairpin probe primer in the cooling step of PCR is degraded by Taq polymerase, and a secondary primer complementary to the auxiliary target or universal fluorescent probe is generated;

[0031] The two ends or the middle position of the universal fluorescent probe are respectively modified with a luminescent group and a quenching group, and a section of the universal fluorescent probe in the melting curve analysis is complementary to the secondary primer and can be extended and amplified to generate a certain length of double-stranded DNA;

[0032] The 3' end of the auxiliary target is complementary to the secondary primer, and the 5' end is complementary to the universal fluorescent probe or universal crRNA, and the 3' end or both ends of the auxiliary target contain continuous bases or modification groups to avoid non-specific extension.

[0033] The hairpin probe primer of the present invention can be designed upstream or downstream of the amplification template, and the hairpin probe primer comprises a 3' end, an intermediate sequence and a 5' end. In one embodiment, the 3' end of the hairpin probe primer is a primer sequence complementary to the template DNA; the intermediate sequence is an intermediate sequence of 15 to 35 bases that can be complementary to its own single-stranded amplicon; the 5' end is a protruding sequence of 10 to 25 bases. The intermediate sequence of the hairpin probe primer of the present invention can be complementary to the single-stranded template itself, so that it can be folded to form a stable hairpin structure in the cooling step of PCR. The hairpin structure can be degraded by Taq polymerase during the primer extension process, and generate a secondary primer that is complementary to the auxiliary target sequence or the universal probe.

[0034] The secondary primer of the present invention is obtained by degrading the hairpin probe primer (hairpin amplicon) with Taq enzyme. In addition to the complete 5' overhang sequence of the hairpin probe primer, the 3' end of the secondary primer also contains one or two bases of the intermediate sequence.

[0035] The auxiliary target sequence of the present invention consists of two parts, the 3' end of which is a sequence complementary to the secondary primer, and the 5' end is a sequence complementary to the universal fluorescent probe or crRNA, and chemical modifications such as a number of base A or a phosphate group are added to the 3' end or both ends of the auxiliary target sequence to prevent possible non-specific extension. When different methods are used for detection, the auxiliary target sequence is slightly different. For example, in one embodiment, the qPCR method is used for detection, and the 3' end of the auxiliary target sequence is a sequence complementary to the secondary primer, with a length of 10 to 25 bases, and the 5' end is a sequence complementary to the universal fluorescent probe, with a length of 15 to 30 bases. In another embodiment, the CRISPR / Cas12a method is used for detection, and the 3' end of the auxiliary target sequence is a sequence complementary to the secondary primer, with a length of 10 to 25 bases, and the 5' end is a sequence consistent with the universal crRNA sequence (complementary to the complementary strand of the auxiliary target) and contains a PAM sequence (TTTG), with a total length of 15 to 35 bases. In addition, chemical modifications such as adding a number of base A or phosphate groups to the 3' end or both ends of the auxiliary target prevent possible nonspecific extension.

[0036] The universal fluorescent probe of the present invention can have different lengths when different methods are used for detection. For example, the sequence length of the universal fluorescent probe in qPCR and ddPCR is 10 to 35 bases, and the two ends or the middle position are respectively modified by a luminescent group and a quenching group; for example, the sequence length of the universal fluorescent probe in melting curve analysis (MCA) is 30 to 150 bases, and the two ends or the middle position are respectively modified by a luminescent group and a quenching group.

[0037] The universal fluorescent probe described in the present invention can be a Taqman probe, a double quencher probe, etc., and is cleaved under the action of Taq enzyme to release a fluorescent signal; in the present invention, the secondary primer and a sequence of the universal fluorescent probe are complementary and paired, and extended and amplified to generate a certain length of double-stranded DNA, and this double-stranded DNA has a specific melting temperature (Tm).

[0038] The nucleotide sequence of the universal crRNA of the present invention is shown in SEQ ID No. 19: UAAUUUCUAAGUGUAGAUUUGGUCGUCUUCAGCAUGAGCUG;

[0039] The reporter probe used in the present invention may be slightly different for different detection methods. For example, when the fluorescence detection method is used, the sequence of the reporter probe may be: FAM-TTATT-BHQ1; when the test strip detection method is used, the sequence of the reporter probe may be SEQ ID No.42: FAM-TTATTTTATTTTATT-Biotin.

[0040] The universal fluorescent probe or universal crRNA of the present invention can use multiple probes in a reaction system, and these probe sequences are different and modified by a variety of different fluorescent groups and quenching groups. Different secondary primers produced by different targets in amplification will hybridize and extend with the probe, and ultimately produce melting curves with different fluorescence and different melting temperatures (Tm), thereby achieving super multiple target detection. The universal fluorescent probe or universal crRNA of the present invention can be a synthetic single-stranded DNA or a modified DNA that changes hybridization affinity, including locked nucleic acid (LNA), peptide nucleic acid (PNA) or DNA minor groove binder (MGB) and one or more combinations thereof.

[0041] The present invention also provides a multiple nucleic acid detection kit, comprising the multiple nucleic acid detection primer probe group, hot start polymerase, polymerase buffer, dNTPs and MgCl2.

[0042] Based on the detection kit of the present invention, when preparing the corresponding reaction system, in one embodiment, the reaction system may include: specific primer concentration 0.01-2 μM, universal fluorescent probe concentration 0.01-1 μM, auxiliary target concentration 0.01-1 μM. And the reaction system also includes hot start polymerase, polymerase buffer, dNTPs, MgCl2, and a suitable reaction program that can perform PCR. The template for the detection of the present invention is extracted sample DNA containing rare mutations or wild-type genes, cDNA obtained by reverse transcription, synthetic plasmid DNA or single-stranded DNA, etc.

[0043] The present invention also provides a multiple nucleic acid detection method, comprising using the multiple nucleic acid detection kit and a target nucleic acid preparation system to perform amplification.

[0044] In one embodiment of the present invention, the multiple nucleic acid detection method includes any one of the following: qPCR, ddPCR, CRISPR / Cas12a or melting curve analysis. In one embodiment of the present invention, the target nucleic acid includes any one of the following: extracted sample DNA containing rare mutations or wild-type genes, cDNA obtained by reverse transcription, synthetic plasmid DNA or single-stranded DNA.

[0045] To further illustrate the present invention, a multiple nucleic acid detection primer probe set, a kit and a detection method provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0046] Example 1

[0047] A new nucleic acid detection system: HPPA qPCR detection of HPV18 and 16, the steps are as follows:

[0048] The components of the efficient and universal detection system are shown in steps 1) to 5):

[0049] 1) Based on the HPV18 target, the nucleotide sequences of the upstream hairpin probe primer, target primer, universal fluorescent probe, and auxiliary target are shown in SEQ ID No. 1 to SEQ ID No. 4, respectively; the nucleotide sequences of each probe and primer from the 5' end to the 3' end are as follows:

[0050] SEQ ID No.1: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0051] SEQ ID No.2: AGGAACATTTTGTGAACAGGCA;

[0052] SEQ ID No.3: ROX-GGACTATGTCCGGGAACACAAAGA-BHQ2;

[0053] SEQ ID No. 4: aaaaTCTTTGTGTTCCCGGACATAGTCCaaaCCGTCACAGTCTGCTGATCTaaaaaa.

[0054] 2) Based on the HPV16 target, the nucleotide sequences of the upstream hairpin probe primer, target primer, and auxiliary target are shown in SEQ ID No. 5 to SEQ ID No. 7 respectively; the universal fluorescent probe is SEQ ID No. 3; the nucleotide sequence from the 5' end to the 3' end is as follows:

[0055] SEQ ID No.5: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0056] SEQ ID No.6:AATGACAGCTCAGAGGAGGAG;

[0057] SEQ ID No.7: aaaaTCTTTGTGTTCCCGGACATAGTCCaaaTGGTCACAGTCTGCTGATCTaaaaaa;

[0058] 3) The reaction volume was 30 μL, containing 2 mM MgCl2, 0.2 mM dNTPs, 0.25 μM each of the upstream hairpin probe primer and target primer, 0.15 μM universal fluorescent probe, 0.1 μM auxiliary target, 0.03 U / μL hot start polymerase; 10 μL of HPV plasmid DNA template of different concentrations was diluted in 3 ng / μL cell line 293T genomic DNA template. Specific probe qPCR and HPPA qPCR were each in separate tubes.

[0059] The reaction procedure of specific probe qPCR is the same as that of HPPA qPCR. When using specific probe qPCR for detection, the HPV18 target:

[0060] Upstream primer (SEQ ID No. 43): ACATGCAACACTTGTGCATC;

[0061] Target primer (SEQ ID No. 2): AGGAACATTTTTGTGAACAGGCA;

[0062] Specific probe (SEQ ID No. 44): FAM-CATTGTTCCATGCGCAGGAGGT-BHQ1;

[0063] HPV16 Target:

[0064] Upstream primer (SEQ ID No. 45): ACACTTGCAACAAAAGGTTACA;

[0065] Target primer (SEQ ID No. 6): AATGACAGCTCAGAGGAGGAG;

[0066] Specific probe (SEQ ID No. 46): FAM-CAAGCAGAACCGGACAGAGCC-BHQ1;

[0067] The concentrations were as follows: upstream primers were all 0.3 μM; downstream primers were all 0.2 μM; and probes were 0.08 μM.

[0068] 4) Perform qPCR amplification, the specific procedure is: enzyme activation at 95°C for 3 min; denaturation at 95°C for 10 s, annealing and extension at 56°C for 15 s, fluorescence collection at 74°C for 20 s, 55 cycles.

[0069] 5) qPCR amplification and signal acquisition were performed using the Shanghai Hongshi SLAN-96S qPCR system. The results are as follows: Figure 2 As shown, the sensitivity and linearity of HPPA qPCR and specific probe qPCR were similar, and both were able to detect target nucleic acids with high sensitivity.

[0070] Example 2

[0071] A new nucleic acid detection system: HPPA ddPCR detection of cDNA targets, the steps are as follows:

[0072] The components of the efficient and universal probe detection system are shown in steps 1) to 6):

[0073] 1) Based on the EGFR target, the nucleotide sequences of the upstream hairpin probe primer, the target primer, the universal double quencher probe, and the auxiliary target are shown in SEQ ID No. 8 to SEQ ID No. 11 respectively;

[0074] SEQ ID No.8: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0075] SEQ ID No.9: AACGTACTGGTGAAAACACCG;

[0076] SEQ ID No.10: VIC-GGACT(Q1)ATGTCCGGGAACACAAAGA-Q2;

[0077] SEQ ID No. 11: aaaaTCTTTGTGTTCCCGGACATAGTCCaaaAACGTCACAGTCTGCTGATCTaaaaa.

[0078] 2) Based on the BRAF target, the nucleotide sequences of the upstream hairpin probe primer, target primer, and auxiliary target are shown in SEQ ID No. 12 to SEQ ID No. 14, respectively; the universal double quencher probe is SEQ ID No. 10;

[0079] SEQ ID No.12: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0080] SEQ ID No.13: TTCTTCATGAAGACCTCACAG;

[0081] SEQ ID No.14: aaaaTCTTTGTGTTCCCGGACATAGTCCaaaGACGTCACAGTCTGCTGATCTaaaaaa;

[0082] 3) Based on the PIK3CA target, the nucleotide sequences of the upstream hairpin probe primer, target primer, and auxiliary target are shown in SEQ ID No. 15 to SEQ ID No. 17, respectively; the universal double quencher probe is SEQ ID No. 10;

[0083] SEQ ID NO.15: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0084] SEQ ID No.16: GGAATCCAGAGGTGAGCTTTC;

[0085] SEQ ID No.17: AGCAGACTGTGACGTGTTTAATTGTGTGGAAGATCCACTGGACAACAAAAATGGATTG;

[0086] 4) The reaction volume is 15 μL, containing 3 μL buffer, 0.15 μL Taq enzyme, 1 μM each of upstream hairpin probe primer and target primer, 0.5 μM universal quenching fluorescent probe, 0.4 μM auxiliary target; 5 μL cDNA template. Specific probe ddPCR and HPPAddPCR are each in separate tubes.

[0087] The reaction procedure of specific probe ddPCR was the same as that of HPPA.

[0088] Upstream primer of EGFR target (SEQ ID No. 47): ATGGTATTCTTTCTCTTCCG CAC;

[0089] Downstream primer (SEQ ID No. 9): AACGTACTGGTGAAAACACCG;

[0090] Specific probe (SEQ ID No. 48): FAM-CAGTTTGGCCAGCCCAAAATCT-BHQ1;

[0091] BRAF target upstream primer (SEQ ID No. 49): CTGTTCAAACTGATGGGACC;

[0092] Downstream primer (SEQ ID No. 13): TTCTTCATGAAGACCTCACAG;

[0093] Specific probe (SEQ ID No. 50) FAM-CATCGAGATTTCACTGTAGCTAGA C-BHQ1;

[0094] PIK3CA target upstream primer (SEQ ID No. 51): ATGAAACAAATGAATGATG CAC;

[0095] Downstream primer (SEQ ID No. 16): GGAATCCAGAGTGAGCTTTC;

[0096] Specific probe (SEQ ID No. 52): FAM-TGCTGTTTAATTGTGTGGAAGAT CC-BHQ1;

[0097] The concentrations of upstream and downstream primers were 1 μM; the concentration of probe was 0.3 μM.

[0098] 5) Zhejiang Linghang Technology AD3200 ddPCR was used for droplet generation and PCR amplification. The specific procedure was as follows: enzyme activation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing and extension at 58°C for 50 s, and 50 cycles.

[0099] 6) The signal was collected using the Zhejiang Linghang Technology AD3200 ddPCR system. The results are as follows: Figure 3 As shown, the positive and negative droplets of the HPPAddPCR system were clearly separated, and the quantitative and specific probe ddPCR of multiple targets were consistent.

[0100] Example 3

[0101] A new nucleic acid detection system: HPPA CRISPR / Cas12a detects HPV targets. The steps are as follows:

[0102] The components of the efficient and universal probe detection system are shown in steps 1) to 5):

[0103] 1) Based on the HPV18 target, the nucleotide sequences of the upstream hairpin probe primer, target primer, universal crRNA, and auxiliary target are shown in SEQ ID No. 18, SEQ ID No. 2, and SEQ ID No. 19 to SEQ ID No. 20, respectively;

[0104] SEQ ID No.18: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0105] SEQ ID No.19: UAAUUUCUACUAAGUGUAGAUUUGGUCGUCUUCAG CAUGAGCUG;

[0106] SEQ ID No.20: aaaaTTTTGGTCGTCTTCAGCATGAGCaaaaCCGTCACAGT CTGCTGAaaaaaa;

[0107] Based on the HPV16 target, the nucleotide sequences of the upstream hairpin probe primer, target primer, universal crRNA, and auxiliary target are shown in SEQ ID No. 21, SEQ ID No. 6, SEQ ID No. 19, and SEQ ID No. 22, respectively;

[0108] SEQ ID No.21: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0109] SEQ ID No. 22: aaaaTTTGGTCGTCTTCAGCATGAGCaaaaTGGTCACAGT CTGCTGAaaaaaa;

[0110] 2) The amplification reaction volume is 30 μL, containing 2 mM MgCl2, 0.2 mM dNTPs, 0.3 μM upstream target primer, 0.1 μM auxiliary target, 0.03 U / μL hot start polymerase; 10 μL of templates of different concentrations, and the templates of different concentrations are each independently placed in a tube during PCR amplification. In this embodiment, the template DNA is the genomic DNA of the 293T cell line with different concentrations.

[0111] 3) PCR amplification was performed using Shanghai Hongshi SLAN-96S, with the following procedure: enzyme activation at 95°C for 3 min; denaturation at 95°C for 10 s, annealing at 56°C for 15 s, and extension at 72°C for 15 s, for 50 cycles.

[0112] 4) 5μL PCR product was mixed with 0.2μM universal crRNA, 0.3μM Cas12a enzyme and 0.5μM reporter probe (fluorescence detection experiment: FAM-TTATT-BHQ1; test strip detection experiment: FAM-TTATTT TATTTTATT-Biotin), and incubated at 42℃ for 40min using Shanghai Hongshi SLAN-96S or for fluorescence detection. In the test strip experiment, the probe concentration was 0.06μM. After 5μL of the reaction mixture was mixed with 45μL of deionized water, it was dropped on the test strip sample area, and the results were observed and photographed after 10min.

[0113] 5) The results are as follows Figure 4 As shown in the figure, the new system has excellent detection performance. It has high sensitivity and 10 copies of HPV18 and 16 can be successfully detected.

[0114] Example 4

[0115] A new nucleic acid detection system: HPPA CRISPR / Cas12a detects HPV targets. The steps are as follows:

[0116] The components of the efficient and universal dual detection system are shown in steps 1) to 5):

[0117] 1) Based on the HPV18 target, the nucleotide sequences of the upstream hairpin probe primer, target primer, universal crRNA, and auxiliary target are shown in SEQ ID No.18, SEQ ID No.2, and SEQ ID No.19 to SEQ ID No.20, respectively; based on the HPV16 target, the nucleotide sequences of the upstream hairpin probe primer, target primer, universal crRNA, and auxiliary target are shown in SEQ ID No.21, SEQ ID No.6, SEQ ID No.19, and SEQ ID No.22, respectively.

[0118] 2) The amplification reaction volume is 30 μL, containing 3 mM MgCl2, 0.2 mM dNTPs, 0.3 μM of each upstream target primer, 0.08 μM of auxiliary target, 0.04 U / μL hot start polymerase; 10 μL of different templates or clinical sample DNA, each in a separate tube. The positive control is 10 copies / μL HPV18 or 16 sample (mixed with 293T genomic DNA).

[0119] 3) PCR amplification was performed using Shanghai Hongshi SLAN-96S, with the following procedure: enzyme activation at 95°C for 3 min; denaturation at 95°C for 10 s, annealing at 56°C for 15 s, and extension at 72°C for 15 s, for 50 cycles.

[0120] 4) 3μL PCR product was mixed with 0.2μM universal crRNA, 0.35μM Cas12a enzyme and 0.06μM reporter probe (strip test experiment: FAM-TTATTTTATTTTATT-Biotin), and incubated at 42℃ for 40min using Shanghai Hongshi SLAN-96S. Then 5μL reaction mixture was mixed with 45μL deionized water and dropped on the sample addition area of ​​the test strip. After 10min, the results were observed and photographed.

[0121] 5) From Figure 5 It can be seen that the dual detection system has excellent detection performance. 10 copies of HPV18 and 16 can be successfully detected by the test strips with high sensitivity. The test results of 20 clinical sample DNAs were completely consistent with those of the commercial kit.

[0122] Example 5

[0123] A new nucleic acid detection system: HPPA-MCA detects HPV targets, the steps are as follows:

[0124] The components of the efficient and multiplex detection system are shown in steps 1) to 5):

[0125] 1) Based on the HPV18 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are SEQ ID No. 18 and SEQ ID No. 2, respectively;

[0126] Based on the HPV16 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 23 and SEQ ID No. 6, respectively;

[0127] SEQ ID NO.23: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0128] Based on the HPV31 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 24 and SEQ ID No. 25, respectively;

[0129] SEQ ID No.24: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0130] SEQ ID No.25: CTGAGGCAACTGACCTCTAC;

[0131] Based on the HPV33 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 26 and SEQ ID No. 27, respectively;

[0132] SEQ ID No.26: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0133] SEQ ID No.27: CAACTGACCTATACTGCTA;

[0134] The universal fluorescent probe used is a linear probe or a hairpin probe, and the sequences are shown in SEQ ID No.28 and SEQ ID No.29.

[0135] SEQ ID No.28: ROX-AGGCGGACTCACGAGACCTGAGCAGTGGTCACAGGATCTCCGTCACAGTCTGCT-BHQ2;

[0136] SEQ ID No. 29: ROX-AGGCGGACTCACGAGACCTGAGCAGTGGTCACAGGATCTCCGTCACAGTTCTGCTCCGCCT-BHQ2.

[0137] 2) The reaction volume was 30 μL, containing 3 mM MgCl2, 0.2 mM dNTPs, 0.15-0.5 μM of each upstream target primer, 0.2 μM of universal fluorescent linear or hairpin probe, 0.04 U / μL hot start polymerase, and 10 μL of different HPV plasmid DNA templates (diluted in 3 ng / ul cell line 293T genomic DNA).

[0138] 4) Perform PCR amplification, the specific procedure is: enzyme activation at 95°C for 3 min; denaturation at 95°C for 10 s, annealing at 58°C for 20 s, and extension at 72°C for 10 s for 55 cycles.

[0139] 5) Shanghai Hongshi SLAN-96S qPCR system was used to perform melting curve analysis (50°C to 90°C) and collect fluorescence every 0.04°C.

[0140] The results are as follows Figure 6 As shown, both linear probes and hairpin probes can achieve multiplex detection and can detect multiple target nucleic acids simultaneously with high sensitivity.

[0141] Example 6

[0142] A new nucleic acid detection system: HPPA-MCA detects multiple HPV targets. The steps are as follows:

[0143] The components of the efficient and multiplex detection system are shown in steps 1) to 5):

[0144] 1) Based on the HPV18 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are SEQ ID No. 30 and SEQ ID No. 2, respectively;

[0145] SEQ ID No.30: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0146] Based on the HPV16 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 31 and SEQ ID No. 6, respectively;

[0147] SEQ ID No.31: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0148] Based on the ACTB target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 32 and SEQ ID No. 33, respectively;

[0149] SEQ ID No.32: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0150] SEQ ID No.33: AGGCATCCTCACCCTGAAG;

[0151] Based on the HPV58 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 34 and SEQ ID No. 35, respectively;

[0152] SEQ ID No.34: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0153] SEQ ID No.35: TATAACCTCAGATCGCTGCAA;

[0154] Based on the HPV31 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 36 and SEQ ID No. 25, respectively;

[0155] SEQ ID No.36: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0156] Based on the HPV33 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 37 and SEQ ID No. 27, respectively;

[0157] SEQ ID No.37: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0158] Based on the HPV35 target, the nucleotide sequences of the upstream hairpin probe primer and the target primer are shown in SEQ ID No. 38 and SEQ ID No. 39, respectively;

[0159] SEQ ID No.38: (The underline is the 5' protruding sequence; the italic is the middle sequence; the dashed line is the primer sequence);

[0160] SEQ ID No.39: GAACGACCTTACAAACTGCA;

[0161] The sequences of universal probes 1 and 2 are shown as SEQ ID No. 40 and SEQ ID No. 41, respectively;

[0162] SEQ ID No.40: FAM-TGTACACTCAGACAACAGTGAGACTCGACCTCA GTGAGTCAGCCAGCACA-BHQ1;

[0163] SEQ ID No. 41: ROX-AAGATGATACTTCTCTCTAGGACGACACGAGACCTGAGCAGTGGTCACAGGATCTCCA-BHQ2;

[0164] 2) The reaction volume was 30 μL, containing 6 mM MgCl2, 0.25 mM dNTPs, 0.2-0.5 μM upstream target primer, 0.15-0.25 μM universal fluorescent probe, 0.06 U / μL hot start polymerase, and 5 μL different HPV plasmid DNA templates (diluted in 3 ng / ul cell line 293T genomic DNA).

[0165] 4) Perform PCR amplification, the specific procedure is: enzyme activation at 95°C for 3 min; denaturation at 95°C for 10 s, annealing at 60°C for 35 s, and extension at 72°C for 10 s for 55 cycles.

[0166] 5) Shanghai Hongshi SLAN-96S qPCR system was used to perform melting curve analysis (50°C to 85°C) and collect fluorescence every 0.04°C.

[0167] The results are as follows Figure 7 As shown, the two universal probes achieved 7-fold nucleic acid detection, indicating that HPPA-MCA has multiplex detection capabilities.

[0168] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A multiplex nucleic acid detection primer probe set, characterized in that: Including target primers, hairpin probe primers, universal fluorescent probes, universal crRNA, auxiliary targets and reporter probes; The hairpin probe primer comprises: a 3' end complementary to the template DNA of the nucleic acid to be detected, an intermediate sequence consisting of 15 to 35 bases complementary to its own single-stranded amplicon, and a 5' end containing a protruding sequence of 10 to 25 bases; The hairpin structure formed by the hairpin probe primer in the cooling step of PCR is degraded by Taq polymerase, and a secondary primer complementary to the auxiliary target or universal fluorescent probe is generated; The two ends or the middle position of the universal fluorescent probe are respectively modified with a luminescent group and a quenching group, and a section of the universal fluorescent probe in the melting curve analysis is complementary to the secondary primer and can be extended and amplified to generate a certain length of double-stranded DNA; The 3' end of the auxiliary target is complementary to the secondary primer, and the 5' end is complementary to the universal fluorescent probe or universal crRNA, and the 3' end or both ends of the auxiliary target contain continuous bases or modification groups to avoid non-specific extension.

2. The multiple nucleic acid detection primer probe set according to claim 1, characterized in that: The hairpin probe primer is designed upstream or downstream of the amplification template.

3. The multiple nucleic acid detection primer probe set according to claim 1, characterized in that: The secondary primer comprises the overhanging sequence at the 5' end of the hairpin probe primer, and the 3' end also comprises part of the bases of the middle sequence of the hairpin probe primer.

4. The multiple nucleic acid detection primer probe set according to claim 1, characterized in that: When the qPCR or ddPCR method is used for multiple nucleic acid detection, the sequence length of the universal fluorescent probe is 10 to 35 bases; When the melting curve analysis method is used for multiple nucleic acid detection, the sequence length of the universal fluorescent probe is 30 to 150 bases.

5. The multiple nucleic acid detection primer probe set according to claim 4, characterized in that: The universal fluorescent probe is a synthetic single-stranded DNA or a modified DNA with changed hybridization affinity, including at least one of the following: a locked nucleic acid, a peptide nucleic acid and a DNA minor groove binder.

6. The multiple nucleic acid detection primer probe set according to claim 5, characterized in that: The universal fluorescent probe is cleaved under the action of Taq enzyme to release a fluorescent signal, and the type of the universal fluorescent probe includes any one of the following: Taqman probe and double quenching probe.

7. A multiple nucleic acid detection kit, characterized in that: The invention comprises the multiple nucleic acid detection primer probe set according to any one of claims 1 to 6, a hot start polymerase, a polymerase buffer, dNTPs and MgCl2.

8. A multiple nucleic acid detection method, characterized in that: The method comprises using the multiple nucleic acid detection kit according to claim 7 and a target nucleic acid preparation system to perform amplification.

9. The multiple nucleic acid detection method according to claim 8, characterized in that: The multiple nucleic acid detection method includes any one of the following: qPCR, ddPCR, CRISPR / Cas12a or melting curve analysis.

10. The multiple nucleic acid detection method according to claim 8, characterized in that: The target nucleic acid includes any one of the following: extracted sample DNA containing rare mutations or wild-type genes, cDNA obtained by reverse transcription, synthesized plasmid DNA or single-stranded DNA.

Images