Gene marker related to fat content in pig muscle, primer, kit and application
Through transcriptome sequencing technology, PDZD9 genes related to pig muscle fat content were screened out, gene marker primers and kits were developed, which solved the problem of pork quality decline and achieved improvement of pork quality.
Patent Information
- Application Number
- CN202411498222.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-25
- Publication Date
- 2025-02-07
AI Technical Summary
During the genetic breeding process of pigs, long-term breeding of rapid growth and high lean meat rate has led to a decline in pork quality, and the high intramuscular fat content affects the tenderness, flavor and juiciness of pork.
The gene marker PDZD9 gene, which is related to the content of pig muscle fat, was screened through transcriptome sequencing technology, and related gene marker primers and kits were developed to detect whether the gene exists in pigs to assist in breeding.
The screened PDZD9 gene can be used as a molecular marker of pig muscle fat content, helping breeding to improve pork quality and meeting consumers' demand for high-quality pork.
Smart Images
Figure CN119391862A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of livestock genetic breeding and aquaculture, and specifically refers to gene markers, primers, kits and applications related to pig intramuscular fat content. Background Art
[0002] Pork quality is the sum of the histological, nutritional, hygienic and processing characteristics of meat. my country is rich in local pig breeds, and its meat has the advantages of bright red color, strong water holding capacity, high intramuscular fat content and small muscle fiber diameter. With the continuous improvement of living standards, consumers' demand for pork has shifted from the pursuit of quantity to the pursuit of quality. Intramuscular fat content is one of the main factors affecting pork quality, which can affect the tenderness, flavor, color, water holding capacity and juiciness of pork. There is a negative correlation between intramuscular fat content and lean meat rate. However, the long-term selection for rapid growth and high lean meat rate in the genetic breeding process of pigs has led to a decline in pork quality, and the taste and flavor of pork are not satisfactory. In order to improve the quality of pork, it is necessary to cultivate new high-quality pig breeds with appropriate intramuscular fat content to meet consumers' demand for high-quality pork.
[0003] Intramuscular fat content is a quantitative trait controlled by multiple genes. At the same time, animal intramuscular fat content is affected by many factors such as nutrition, breed, and internal environment. Although predecessors have successfully screened some candidate genes and regulatory elements involved in regulating intramuscular fat content, the formation of intramuscular fat is also regulated by multiple systems such as muscles, endocrine system, and nervous system. Therefore, the regulatory mechanism and influencing factors of animal intramuscular fat have not been fully elucidated and still need to be further explored. Summary of the invention
[0004] The purpose of the present invention is to provide a gene marker related to pig intramuscular fat content.
[0005] Another object of the present invention is to provide gene marker primers related to pig intramuscular fat content.
[0006] Another object of the present invention is to provide a kit for detecting gene markers related to pig intramuscular fat content.
[0007] The present invention also provides specific applications of the kit.
[0008] The present invention is achieved through the following technical scheme: a gene marker related to pig intramuscular fat content, wherein the gene marker is the PDZD9 gene.
[0009] The PDZD9 gene involved in this technical solution encodes PDZ domain protein 9, which is a PDZ domain protein. PDZ proteins can promote binding with target proteins such as membrane receptors to form functional microdomains. Some PDZ proteins are essential for the normal development of the body. However, there are no scientific and technological literature or patent reports on the correlation between pig intramuscular fat content and PDZD9 gene at home and abroad.
[0010] The present invention detects the intramuscular fat content of the longissimus dorsi muscle of a hybrid black pig (ZYH) containing 1 / 4 Wujin pig bloodline and a DLY triple hybrid pig, and uses the longissimus dorsi muscles of the two pigs as experimental materials, adopts transcriptome sequencing technology, screens differential genes, and calculates the Pearson correlation coefficient between the differential gene expression and the intramuscular fat content, thereby screening out genes related to the intramuscular fat content of pigs. These genes can be used as molecular markers related to the intramuscular fat content of pigs and play a role in assisted breeding.
[0011] Gene marker primers related to pig intramuscular fat content include an upstream primer and a downstream primer, wherein the sequence of the upstream primer is CGTGCTGGAGTGGAGAGAAC, and the sequence of the downstream primer is CGCTCCGAGGACCCTTTATT.
[0012] A nucleic acid molecule, wherein the nucleic acid molecule is amplified by PCR using the gene marker primer according to claim 2, and the genotype of the nucleic acid molecule is related to the intramuscular fat content of pigs.
[0013] A kit for detecting the above gene markers, comprising a reagent for detecting the PDZD9 gene.
[0014] In order to better realize the detection of the above gene markers, further, the reagent for detecting the PDZD9 gene includes the gene marker primers described in claim 2 and other reagents required for PCR amplification.
[0015] In order to better realize the detection of the above gene markers, further, the other reagents required for PCR amplification include SYBR qPCR SuperMix Plus and RNase Free Water.
[0016] In order to better realize the detection of the above gene markers, the kit further includes a tissue RNA extraction kit.
[0017] The method for detecting gene markers related to pig intramuscular fat content comprises using a kit to extract genomic RNA of the pig to be tested, performing PCR amplification using gene marker primers, and detecting whether the pig to be tested has the PDZD9 gene based on the amplified product.
[0018] The above kit is used to detect whether pigs have the PDZD9 gene using the above detection method, and then screen and breed pigs.
[0019] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0020] The present invention detects the intramuscular fat content of the longissimus dorsi muscle of a hybrid black pig (ZYH) containing 1 / 4 Wujin pig blood and a DLY triple hybrid pig, and uses the longissimus dorsi muscles of the two pigs as experimental materials, adopts transcriptome sequencing technology, screens differential genes, and calculates the Pearson correlation coefficient between the differential gene expression amount and the intramuscular fat content, so as to screen out genes related to the intramuscular fat content of pigs. The genes can be used as molecular markers related to the intramuscular fat content of pigs and play a role in assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments with reference to the following drawings:
[0022] Figure 1 The bar graph of intramuscular fat content of the longissimus dorsi muscle of the hybrid black pig (ZYH) containing 1 / 4 Wujin pig bloodline and the three-way hybrid pig (DLY) in the present invention;
[0023] Figure 2 The volcano diagram of differential genes between the longissimus dorsi muscle of the hybrid black pig (ZYH) containing 1 / 4 Wujin pig bloodline and the triple hybrid pig (DLY) in the present invention;
[0024] Figure 3 It is a bar graph of the gene quantity of the longissimus dorsi muscle of the hybrid black pig (ZYH) containing 1 / 4 Wujin pig bloodline and the three-way hybrid pig (DLY) in the present invention;
[0025] Figure 4 It is a bar graph of the relative expression of the PDZD9 gene in the longissimus dorsi muscle of the hybrid black pig (ZYH) containing 1 / 4 Wujin pig bloodline and the three-way hybrid pig (DLY) in the present invention;
[0026] Figure 5 This is a correlation analysis diagram between the PDZD9 gene expression level and the intramuscular fat content in the present invention. DETAILED DESCRIPTION
[0027] In order to better understand the present application but not to limit the scope of the present application, all the numbers used in the present application to express the amount, percentage, and other numerical values should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the attached claims are approximate values, which may be changed according to the different ideal properties attempted to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant figures and by conventional rounding methods.
[0028] The meat quality of the longissimus dorsi muscle of the Manor Black Pig and the Triple Crossbred Pig was measured, and it was found that the intramuscular fat content between the two breeds was quite different. The factors affecting the traits are mainly environmental factors and genetic factors. Under the current large-scale farming conditions, the environment is similar, so the genetic factors have the greatest impact. In order to explore the genetic differences that cause significant differences in fat content, transcriptome detection and association analysis were carried out. Finally, a gene significantly associated with pig intramuscular fat content was screened out—the PDZD9 gene.
[0029] To this end, the present invention provides a gene marker related to pig intramuscular fat content, wherein the gene marker is the PDZD9 gene.
[0030] The present invention also provides gene marker primers related to pig intramuscular fat content, comprising an upstream primer and a downstream primer, wherein the sequence of the upstream primer is CGTGCTGGAGTGGAGAGAAC, and the sequence of the downstream primer is CGCTCCGAGGACCCTTTATT.
[0031] The present invention also provides a nucleic acid molecule, wherein the nucleic acid molecule is amplified by PCR using the gene marker primers according to the claim, and the genotype of the nucleic acid molecule is related to the intramuscular fat content of pigs.
[0032] The present invention also provides a kit for detecting the above gene markers, including a reagent for detecting the PDZD9 gene.
[0033] Based on the kit, the reagents for detecting the PDZD9 gene include the gene marker primers described in claim 2 and other reagents required for PCR amplification.
[0034] Based on this kit, the other reagents required for PCR amplification include SYBR qPCRSuperMix Plus and RNase Free Water.
[0035] Based on the kit, the kit also includes a tissue RNA extraction kit.
[0036] Based on this kit, a method for detecting gene markers related to pig intramuscular fat content is provided, which uses the kit to extract genomic RNA of the pig to be tested, performs PCR amplification using gene marker primers, and detects whether the pig to be tested has the PDZD9 gene based on the amplified product.
[0037] Based on the kit, the present invention also provides an application of the kit, using the detection method of claim 8 to detect whether a pig has the PDZD9 gene, and then screening and breeding the pigs.
[0038] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. In addition, unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by technicians in the field to which the present invention belongs, and the materials publicly cited herein and those cited by them will be incorporated by reference. The experimental methods in the following examples are conventional methods unless otherwise specified. The instruments and equipment used in the following examples are conventional laboratory instruments and equipment unless otherwise specified; the test materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.
[0039] Example:
[0040] 1. Selection of research subjects
[0041] The hybrid black pig (ZYH) and the three-way hybrid pig (DLY) with 1 / 4 Wujin pig bloodline, which showed significant difference in intramuscular fat content, were selected as the research objects.
[0042] Among them, the intramuscular fat content of the longissimus dorsi muscle of 6 hybrid black pigs (ZYH) with 1 / 4 Wujin pig bloodline and 4 DLY three-way hybrid pigs (DLY) were 3.66% and 1.78% respectively. The intramuscular fat content of the longissimus dorsi muscle of the hybrid black pigs (ZYH) with 1 / 4 Wujin pig bloodline was 51.37% higher than that of the longissimus dorsi muscle of the three-way hybrid pigs (DLY). Figure 1 shown.
[0043] 2. Total RNA extraction of research subjects
[0044] The longissimus dorsi muscle tissues of hybrid black pigs (ZYH) and three-way hybrid pigs (DLY) containing 1 / 4 Wujin pig blood were collected, numbered and quickly placed in liquid nitrogen for preservation, and then stored in a -80°C refrigerator overnight.
[0045] Weigh 100 mg of tissue into a centrifuge tube, add 1 ml of MagZol Reagent, and immediately homogenize thoroughly with a homogenizer, and place at room temperature for 5 to 10 minutes. MagZol Reagent is a reagent for nucleic acid extraction, and its main components include guanidine isothiocyanate and phenol. It is improved on the basis of the acid phenol guanidine isothiocyanate RNA extraction scheme1. MagZol Reagent can quickly lyse cells / tissues, release RNA into the solution, and quickly inactivate nucleases to protect RNA from degradation. After chloroform extraction, a three-phase system is formed, in which RNA is distributed in the aqueous phase layer, and DNA and protein are distributed in the middle layer and the organic layer, thereby achieving the purpose of separating RNA.
[0046] Add 100 μl buffer, shake vigorously up and down by hand for 15 seconds, and leave at room temperature for 3 minutes. Centrifuge at 4°C, 12,000×g for 15 minutes. Transfer the supernatant to a new centrifuge tube, add 1.5 times the volume of anhydrous ethanol, and mix by inversion 6-8 times.
[0047] Place the HiPure RNA Mini Column in a 2 mL collection tube. Transfer the mixture to the column. Centrifuge at 12,000 × g for 60 seconds. Discard the filtrate and return the column to the collection tube. Transfer the remaining mixture to the column. Centrifuge at 12,000 × g for 60 seconds. Discard the filtrate and return the column to the collection tube. Add 600 μL of buffer RW2 to the column and centrifuge at 12,000 × g for 60 seconds. Discard the filtrate and return the column to the collection tube. Centrifuge at 12,000 × g for 2 minutes. HiPure RNA Mini Column is a high-purity RNA mini column.
[0048] Transfer the column to a 1.5mL centrifuge tube and add 50μL RNase Free Water to the center of the column membrane. RNase Free Water is enzyme-free sterile water, which is ultrapure deionized water treated with DEPC and then sterilized by high pressure. It has no nuclease and protease activity after testing, and is also called ultrapure water.
[0049] Let stand at room temperature for 2 minutes. Centrifuge at 12,000×g for 1 minute, collect RNA and test it, and then use NanoDrop ND-1000 to control the amount and purity of total RNA. Among them, NanoDrop ND-1000 is a full-wavelength spectrophotometer with a wavelength range of 220nm to 750nm, which can accurately and repeatedly measure samples with a minimum volume of 1ul. The instrument has a high absorption light detection capability, which is equivalent to 50 times that of traditional spectrophotometers, so that most samples can be tested in the full spectrum without dilution, without consumables, plug and play without preheating, and extremely convenient to operate.
[0050] The integrity of RNA was then tested by Bioanalyzer 2100 and verified by agarose electrophoresis. Bioanalyzer 2100 is an instrument used for bioanalysis and quality control. It is mainly used to analyze and evaluate the quality, concentration and size distribution of nucleic acid (DNA and RNA) and protein samples.
[0051] The final RNA concentration was >50ng / μL, RIN value >7.0, OD260 / 280 >1.8, and total RNA quality >1μg, which met the requirements for downstream library construction and sequencing experiments. RIN is the RNA integrity count, and OD is the absorbance.
[0052] 3. Library construction and high-throughput sequencing
[0053] Oligo(dT) magnetic beads are used to specifically capture mRNA with PolyA in total RNA. Oligo(dT) is a polythymine, T repeat oligonucleotide, which is a nucleotide chain composed of only thymine, and only produces the required cDNA; PolyA is polyadenylic acid, which is polymerized with adenosine diphosphate as a substrate and catalyzed by immobilized nucleotide phosphorylase, and the content is not less than 90%.
[0054] The captured mRNA was cut off by magnesium ion under high temperature conditions ( MagnesiumRNA Fragmentation Module) for fragmentation at 94°C for 5-7 minutes. The fragmented RNA is synthesized into cDNA under the action of reverse transcriptase.
[0055] Then, E.coli DNA polymerase I and RNase H are used to synthesize the second strand, converting the DNA and RNA composite double strands into DNA double strands, and at the same time, dUTP Solution is added to the second strand to fill the ends of the double-stranded DNA into blunt ends. Then, an A base is added to each end to enable it to connect to the adapter with a T base at the end, and then the size of its fragments is screened and purified using magnetic beads. Among them, E.coli DNA polymerase I is a DNA-dependent DNA polymerase of Escherichia coli; RNase H is a ribonuclease that can specifically degrade the RNA chain in the RNA-DNA hybrid to generate 5' phosphate-terminated oligoribonucleotides and single-stranded DNA; dUTP Solution is a highly stable nucleotide solution, mainly used in UDG / dUTP anti-pollution system: when preparing the PCR reaction solution, dUTP and dTTP are mixed in a certain ratio (usually 2:1) or dUTP is used instead of dTTP, so that the amplified products all contain deoxyuracil. Before PCR amplification, adding UDG enzyme to the PCR reaction solution and adding a 2-minute insulation step at 37°C to 50°C can eliminate residual contamination from previous PCR products.
[0056] The second strand is digested with UDG enzyme, and then PCR is used to form a sequencing library with a fragment size of 300bp±50bp. UDG enzyme is an enzyme in the human body, also known as uracil-DNA glycosylase. Its main function is to cut the N-glycosidic bond between the uracil base and the sugar backbone, thereby removing uracil from DNA containing dU. This enzyme has no effect on RNA and DNA that does not contain uracil.
[0057] Finally, using Illumina Novaseq TM 6000 for double-end sequencing, and the sequencing mode is PE150. TM 6000 is a gene sequencer developed by Illumina, a world-leading sequencer manufacturer. It has a data output throughput of more than 100 million, strong scalability, flexible performance and simple operation, and is suitable for high-depth, large-scale genomic clinical applications and scientific research. PE150 refers to sequencing the DNA sample twice to generate two reads of 150 bp in length. There is a certain gap between the two reads, which can be used for sequence alignment and splicing to obtain longer sequence information. PE150 is suitable for applications such as high-precision genome assembly and SNP detection.
[0058] 4. Conduct bioinformatics analysis
[0059] The format of the raw data is .fastq, and the .astp (https: / / github.com / OpenGene / fastp) software is used to perform quality control on the raw data, including removing adapters, duplicate sequences, and low-quality sequences. Fastp is a sequencing data quality control software, which is a fast tool for high-throughput sequencing data quality control and data preprocessing.
[0060] HISAT2 (https: / / ccb.jhu.edu / software / hisat2) was used to align the sequencing data to the genome (Sus_scrofa.Sscrofa11.1.108), and the alignment rates are shown in Table 1. Among them, HISAT2 is a software that uses the improved BWT algorithm for sequence alignment.
[0061] Table 1 Sequencing data and alignment rates of each sample
[0062] Sample No. Valid reads Comparison rate (%) DLY_A_LD 75,727,110 93.2 DLY_B_LD 73,896,994 93.36 DLY_C_LD 84,222,336 93.65 DLY_D_LD 78,614,204 92.96 ZYH_B_LD 79,896,514 91.48 ZYH_D_LD 85,767,872 94.72 ZYH_E_LD 76,319,410 94.42 ZYH_F_LD 80,147,504 94.65
[0063] The featureCounts function of the Rsubread package was used to quantify genes or transcripts. Then the R package edgeR was used to analyze the differentially expressed genes between the longissimus muscle of the hybrid black pig (ZYH) and the three-way hybrid pig (DLY) containing 1 / 4 Wujin pig bloodline. The differentially expressed genes were defined as those with a difference greater than two times or less than 0.5 times and a P-value < 0.05. Among them, p-value, also known as the assumed value or assumed probability, is an important concept in inferential statistics, which is used to determine whether the original hypothesis is correct.
[0064] A total of 11,595 mRNAs were identified in the transcriptome data. The edgeR software was used to perform differential expression analysis on the longissimus dorsi muscle of hybrid black pigs (ZYH) and three-way hybrid pigs (DLY) with 1 / 4 Wujin pig ancestry, with |log2(fold change)|≥1 and FDR<0.05 as the standard. A total of 53 differentially expressed genes (DEGs) were screened, including 23 up-regulated DEGs and 30 down-regulated DEGs, such as Figure 2 , Figure 3 shown.
[0065] The specific differential expression of PDZD9 gene in the longissimus dorsi muscle of hybrid black pigs and DLY triple hybrid pigs is shown in Table 2.
[0066] Table 2 Differential expression of PDZD9 gene in longissimus dorsi muscle of hybrid black pig and DLY triple hybrid pig
[0067] Gene name log2FoldChange(ZYH vs DLY) FDR Dene description PDZD9 2.18 ＜0.01 PDZ domain containing 9
[0068] According to the contents in Table 2, the expression abundance of PDZD9 gene in hybrid black pigs is 2.18 times that of DLY pigs, which is significantly upregulated.
[0069] 5. Verify transcriptome sequencing results using RT-qPCR
[0070] To further verify the transcriptome sequencing results, we performed qPCR experiments to validate the transcriptome data.
[0071] (1) Primer design: Primers were designed for the porcine PDZD9 gene and the internal reference gene GAPDH at NCBI (https: / / www.ncbi.nlm.nih.gov / ), the PCR product length was set between 150-250bp, and appropriate GC content, Tm and length quantitative primers were selected for synthesis. Among them, GC content refers to the total ratio of the two bases guanine and cytosine in the DNA sequence. It is usually expressed as a percentage; Tm refers to the temperature at which the double helix structure of DNA or RNA loses half during heating. This temperature point is usually determined when the ultraviolet absorbance reaches half of the maximum value, so it is also called the melting temperature or dissolution temperature.
[0072] The primer sequence of the target gene PDZD9 is as follows: (5′→3′)
[0073] F: CGTGCTGGAGTGGAGAGAAC
[0074] R:CGCTCCGAGGACCCTTTATT
[0075] The primer sequence of the internal reference gene GAPDH is as follows: (5′→3′)
[0076] F:GTCGGAGTGAACGGATTTGGC
[0077] R: GGAGGTCAATGAAGGGGTCA
[0078] (2) cDNA synthesis:
[0079] The reaction system was prepared as follows: Plus 1st Strand cDNASynthesisSuperMix 10μL; total RNA from longissimus dorsi muscle tissue of hybrid black pig or DLY pig 1μL; gDNA Purge 1μL; RNase FreeWater to 20μL. Plus 1st Strand cDNA Synthesis SuperMix is a ready-to-use premix for cDNA synthesis; gDNA Purge is a genomic DNA removal reagent. gDNA Purge is a component of the first-strand cDNA synthesis kit, used to remove genomic DNA contamination. When performing first-strand cDNA synthesis using mRNA or total RNA as a template, gDNA Purge can simultaneously remove genomic DNA to ensure the specificity of the reaction.
[0080] Reaction procedure: 50℃: 15min; 85℃: 5s.
[0081] (3) Real-time fluorescence quantitative PCR reaction:
[0082] System configuration: SYBR qPCR SuperMix Plus*5μL; upstream primer 0.5μL; downstream primer 0.5μL; template 1μL; RNase Free Water to 10μL.
[0083] Amplification program: 95°C: 1 min; (95°C: 20 s; 60°C: 1 min.) × 40; 95°C: 15 s.
[0084] (4) Result calculation: After the qPCR reaction, use -2 △△CT The relative expression of PDZD9 gene in the longissimus dorsi muscle of hybrid black pigs and DLY pigs was calculated by the method. The results are as follows Figure 4 shown.
[0085] according to Figure 4 The results were consistent with the transcriptome sequencing data.
[0086] 6. Correlation between PDZD9 gene expression and intramuscular fat content
[0087] Pearson's correlation analysis was performed using the abundance of PDZD9 gene expression in the longissimus dorsi muscle of hybrid black pigs and DLY pigs and the intramuscular fat content. Figure 5 As shown,
[0088] Figure 5 The results showed that the abundance of PDZD9 gene expression was significantly positively correlated with the intramuscular fat content, with an R2 of 0.5942 and a P value of less than 0.05.
[0089] Although the embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the claims and their equivalents.
Claims
1. Gene markers related to pig intramuscular fat content, characterized in that: The gene marker is the PDZD9 gene.
2. Gene marker primers related to pig intramuscular fat content, characterized in that: It comprises an upstream primer and a downstream primer, wherein the sequence of the upstream primer is CGTGCTGGAGTGGAGAGAAC, and the sequence of the downstream primer is CGCTCCGAGGACCCTTTATT.
3. A nucleic acid molecule, characterized in that The nucleic acid molecule is amplified by PCR using the gene marker primers according to claim 2, and the genotype of the nucleic acid molecule is related to the intramuscular fat content of pigs.
4. A kit for detecting the gene marker according to claim 1, characterized in that: Includes reagents for detecting the PDZD9 gene.
5. The kit according to claim 4, characterized in that: The reagent for detecting the PDZD9 gene comprises the gene marker primers according to claim 2 and other reagents required for PCR amplification.
6. The kit according to claim 5, characterized in that The other reagents required for PCR amplification include 2×NovoStart® SYBR qPCR SuperMix Plus and RNase Free Water.
7. The kit according to any one of claims 4 to 6, characterized in that The kit also includes a tissue RNA extraction kit.
8. A method for detecting gene markers related to pig intramuscular fat content, characterized in that: The kit is used to extract the genomic RNA of the pig to be tested, and PCR amplification is performed using gene marker primers. The amplified product is used to detect whether the pig to be tested has the PDZD9 gene.
9. The use of the kit according to claims 4 to 7, characterized in that: The detection method of claim 8 is used to detect whether pigs have the PDZD9 gene, and then the pigs are screened and bred.