A KASP molecular marker for identifying the sex of snakehead fish and its application

Abstract

The present invention belongs to the field of biotechnology. The present invention discloses a molecular marker closely linked to the sex gene of Channa argus, which can accurately identify the genetic sex of Channa argus. The present invention also provides a specific KASP primer for amplifying the molecular marker closely linked to the sex gene of Channa argus, which can detect the genetic sex of Channa argus, is simple and easy to use, has a high analysis throughput, high accuracy, and is suitable for the detection of a large number of samples. The molecular marker provided by the present invention has important practical significance for quickly and accurately screening pseudo-female Channa argus and super-male Channa argus, shortening the breeding time, and improving the breeding efficiency.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a KASP molecular marker for identifying the sex of Channa argus and its application. Background Art

[0002] Channa argus belongs to the genus Channa of the family Channidae in the order Anabantiformes. It is widely distributed in the water systems of the Yangtze River, Yellow River, Liaohe River, Heilongjiang River and other basins in China, and is commonly found in freshwater bodies such as ponds, rivers, lakes, and reservoirs. Channa argus has the characteristics of delicate and delicious meat, high protein content, and few fish bones. Moreover, it grows fast and has a high yield, and is a traditional edible and cultured fish in China. Since Channa argus is difficult to be tamed to eat artificial compound feed, the hybrid snakehead fish with the ability to eat artificial compound feed and significant hybrid advantages, namely Channa argus♀×Channa maculata♂ and Channa maculata♀×Channa argus♂, have become the main cultured objects of snakehead fish in China. However, as one of the parents of hybrid snakehead fish, it is still crucial to continuously improve and innovate the germplasm of Channa argus.

[0003] Both Channa argus and hybrid snakehead fish have significant sexual dimorphism, and there are significant differences in growth rate, individual size, and feed utilization rate between male and female individuals. Male individuals grow fast, are large in size, and have a low feed coefficient, while female fish grow slowly, are small in size, and the gonadal development leads to an increase in the feed coefficient and a low survival rate during transportation. To solve the problem that the difference between male and female affects the breeding efficiency, the all-male hybrid snakehead fish "Male Snakehead No. 1" (Channa argus♀XX×Channa maculata♂YY) has been successfully cultivated, with a male rate of over 93%. Under the same breeding conditions, its growth rate is over 25% higher than that of the common hybrid snakehead fish (Channa argus♀×Channa maculata♂), the feed coefficient is reduced by 0.2 - 0.35, the proportion of high-quality large-sized fish over 1 kg is increased by over 20%, and the comprehensive breeding efficiency is increased by over 40%. The successful cultivation of the hybrid snakehead fish "Male Snakehead No. 1" shows that all-male hybrid snakehead fish has excellent growth traits and broad market prospects. However, due to the differences in breeding models and the best breeding areas between Channa argus♀×Channa maculata♂ and Channa maculata♀×Channa argus♂, the hybrid snakehead fish "Male Snakehead No. 1" still cannot fully meet the demand, and there is a wide demand in the industry and market for the all-male Channa maculata♀XX×Channa argus♂YY.

[0004] One of the keys to cultivating all-male hybrid snakehead fish is to obtain molecular markers for identifying the sex of snakehead fish, so as to screen snakehead fish with genetic male sex and the super-male snakehead fish (YY) cultivated. At present, there are some molecular markers that can identify the genetic sex of snakehead fish, but the existing markers for identifying the genetic sex of snakehead fish are either dominant markers with low accuracy and poor stability, not suitable for large-scale marker-assisted selection breeding, or rely on specific instruments and reagents, with poor versatility, flexibility and ease of use, seriously affecting the purification speed of the all-male line and super-male line of snakehead fish and the variety breeding process. Summary of the Invention

[0005] The present invention aims to develop an identification technology for detecting the male, female and super-male genders of snakehead fish that is simple, accurate, high-throughput and suitable for a large number of samples.

[0006] The purpose of the first aspect of the present invention is to provide an InDel marker closely linked to the sex gene of snakehead fish.

[0007] The purpose of the second aspect of the present invention is to provide KASP primers for amplifying the InDel marker of the first aspect of the present invention.

[0008] The purpose of the third aspect of the present invention is to provide a reagent or a kit.

[0009] The purpose of the fourth aspect of the present invention is to provide the application of the InDel marker of the first aspect of the present invention, the KASP primer of the second aspect of the present invention, and the reagent or kit of the third aspect of the present invention.

[0010] The purpose of the fifth aspect of the present invention is to provide a method.

[0011] In order to achieve the above purposes, the technical solutions adopted by the present invention are as follows:

[0012] In the first aspect of the present invention, an InDel marker closely linked to the sex gene of snakehead fish is provided. The InDel marker is a nucleotide sequence located on chromosome 16 of the snakehead fish genome, with the polymorphism at positions 11556701 - 11556723 being "AGCTCTGATCACAGAAACAAGT / ----------------------"; where, - represents the deletion of the InDel.

[0013] The physical position of the InDel marker in the present invention is based on the snakehead fish genome (Channa argus Genome assembly ASM1899790v1).

[0014] In some embodiments of the present invention, the homozygous genotype with the polymorphic site base being "----------------------" corresponds to female snakehead fish, the heterozygous genotype with the polymorphic site base being "AGCTCTGATCACAGAAACAAGT / ----------------------" corresponds to male snakehead fish, and the homozygous genotype with the polymorphic site base being "AGCTCTGATCACAGAAACAAGT" corresponds to supermale snakehead fish.

[0015] In a second aspect of the present invention, there are provided KASP primers for amplifying the InDel markers of the first aspect of the present invention, including a forward primer X, a forward primer Y, and a reverse primer;

[0016] Among them, the forward primer X contains the nucleotide sequence shown in SEQ ID NO: 10 (5’-ATGACTGTTGCTACCACTACACAA-3’);

[0017] The forward primer Y contains the nucleotide sequence shown in SEQ ID NO: 11 (5’-ATGACTGTTGCTACCACTACACAG-3’);

[0018] The nucleotide sequence of the reverse primer is shown in SEQ ID NO: 7 (5’-CACAATCTTTACCAAACCACCATCAAACAACT-3’).

[0019] In some embodiments of the present invention, the forward primer X and the forward primer Y contain tag sequences of fluorescent groups, and the fluorescent groups of the forward primer X and the forward primer Y are different.

[0020] In some embodiments of the present invention, the tag sequences of the fluorescent groups are located at the 5’ ends of the forward primer X and the forward primer Y.

[0021] In some embodiments of the present invention, the fluorescent group is selected from any one of FAM, HEX, VIC, TAMRA, ROX, Texas-Red, CY5, MGB, BHQ1, BHQ2, and BHQ3.

[0022] In some embodiments of the present invention, the tag sequence with FAM fluorescence is added to the 5’ end of the forward primer X as shown in SEQID NO: 8.

[0023] In some embodiments of the present invention, the nucleotide sequence of the forward primer X is as shown in SEQ ID NO: 5.

[0024] In some embodiments of the present invention, a tag sequence with HEX fluorescence is added to the 5'-end of the forward primer Y as shown in SEQ ID NO:9.

[0025] In some embodiments of the present invention, the nucleotide sequence of the forward primer Y is as shown in SEQ ID NO:6.

[0026] The third aspect of the present invention provides a reagent or kit, comprising the KASP primers of the second aspect of the present invention.

[0027] In some embodiments of the present invention, the reagent or kit further contains DNA polymerase, dNTP and MgCl2.

[0028] In some embodiments of the present invention, the kit further includes TRET cassette fluorescent primers and ROX internal reference dyes.

[0029] The fourth aspect of the present invention provides the application of the InDel marker of the first aspect of the present invention, the KASP primers of the second aspect of the present invention, and the reagent or kit of the third aspect of the present invention in any of the following aspects:

[0030] 1) Identifying the sex of Channa argus;

[0031] 2) Molecular marker-assisted breeding related to the sex of Channa argus;

[0032] 3) Genotyping of Channa argus;

[0033] 4) Constructing a DNA fingerprint map of Channa argus.

[0034] The fifth aspect of the present invention provides a method, comprising the step of using the KASP primers of the second aspect of the present invention and the reagent or kit of the third aspect of the present invention to detect the InDel marker of the first aspect of the present invention in the genome of the to-be-detected Channa argus;

[0035] The method includes any one of 1) to 4):

[0036] 1) A method for identifying the sex of Channa argus;

[0037] 2) A method for the assisted breeding of Channa argus;

[0038] 3) A method for genotyping Channa argus;

[0039] 4) A method for constructing a DNA fingerprint map of Channa argus.

[0040] In some embodiments of the present invention, the method includes the following steps:

[0041] (1) Extracting the genomic DNA of the to-be-detected Channa argus;

[0042] (2) Using DNA as a template, perform PCR amplification using the KASP primers of the second aspect of the present invention or the reagents or kits of the third aspect of the present invention;

[0043] (3) Analyze the PCR amplification products to obtain the polymorphism of InDel markers in the genome of the snakehead fish to be tested.

[0044] In some embodiments of the present invention, when the homozygous genotype with the base of "----------------------" at the polymorphic site corresponds to a female snakehead fish; the heterozygous genotype with the bases of "AGCTCTGATCACAGAAACAAGT / ----------------------" corresponds to a male snakehead fish, and the homozygous genotype with the base of "AGCTCTGATCACAGAAACAAGT" corresponds to a supermale snakehead fish.

[0045] The beneficial effects of the present invention are as follows:

[0046] The present invention provides a molecular marker closely linked to the sex gene of snakehead fish, which can accurately identify the genetic sex of snakehead fish.

[0047] The present invention also provides specific KASP primers for amplifying the molecular marker closely linked to the sex gene of snakehead fish, which can detect the genetic sex of snakehead fish, is simple and easy to use, has a high analysis throughput, high accuracy, and is suitable for the detection of a large number of samples. The molecular marker provided by the present invention has important practical significance for quickly and accurately screening pseudo-female snakehead fish and supermale snakehead fish, shortening the breeding time, and improving the breeding efficiency. Description of the Drawings

[0048] Figure 1 Results of detecting 83 snakehead fish with the marker of Cmhen 5. Detailed Embodiments

[0049] The content of the present invention will be further described in detail below through specific examples.

[0050] It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.

[0051] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Those not specified in the embodiments are carried out according to conventional conditions or conditions recommended by the manufacturer. Those reagents or instruments not specified by the manufacturer are all conventional products that can be obtained through commercial purchase.

[0052] The features and performance of the present invention will be further described in detail below in combination with the embodiments.

[0053] The following examples are used to illustrate the present invention, but not to limit the scope of the present invention. Unless otherwise specified, the examples are all carried out under conventional experimental conditions, such as those described in the Molecular Cloning Experimental Manual by Sambrook et al. (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or according to the conditions recommended by the manufacturer's instructions. Example 1 Development of Molecular Markers Closely Linked to the Sex Genes of Snakehead Fish

[0054] 1. High-multiplier resequencing of female and male snakehead fish

[0055] The caudal fins of 20 female snakehead fish and 20 male snakehead fish were respectively taken, and DNA was extracted by the phenol-chloroform extraction method. The extracted DNA samples were subjected to paired-end resequencing by BGI Tech Solutions Co., Ltd. using the Illumina Xten platform. The read length of the sequencing sequence was 150 bp, and the sequencing depth was 10×.

[0056] 2. Analysis of female- and male-specific sequences

[0057] The sequencing data of 20 female snakehead fish and 20 male snakehead fish were respectively aligned to the reference genome of snakehead fish (Channa argus Genome assembly ASM1899790v1) using the bwa (v0.7.17-r1188) software. Based on the results of sequence alignment, the sequences unique to male snakehead fish (Chr 16:11556701-11556723) were screened out. Since the Y chromosome has an additional sequence compared to the X chromosome genome, by using the high-multiplier sequencing method and comparing the read coverage, this segment of the sequence was found. This segment of the sequence is unique to the Y gene. Based on this segment of the sequence, markers co-linked to this segment were found around it.

[0058] 3. Development of KASP markers

[0059] Based on the position of the male-specific sequence on the chromosome, Indel sites with differences between females and males (Chr 16:11556701-11556723) were searched around it. Analyses such as sequence copy number and sequence GC content were performed on this developed site to ensure that this site meets the high success rate of KASP markers, and then this site was designed as a KASP marker. ·

[0060] The Indel site information of marker Cahen 5 is as follows:

[0061] >C.agrus female

[0062] GTGCAACTCACAGCTGCTCCTCTCTTGTTTCCCGCTGCTTGGGGTGTGTGTGT TTGTGCGTGTGTGTGTGTGTGTGTGTCTGTGACAGTGTCATACTCCCAAATCAAAG ATGACTGTTGCTACCACTACAC(SEQ ID NO:1) ------------------ AAAGTTTATACAAAGAGAGTAAACATGAGTTTATATTCTACCTTTTAT GATTTAGTTGTTTGATGGTGGTTTGGTAAAGATTGTGAG(SEQ ID NO:2).

[0063] >C.agrus male

[0064] GTGCAACTCACAGCTGCTCCTCTCTTGTTTCCCGCTGCTTGGGGTGTGTGTGT TTGTGCGTGTGTGTGTGTGTGTGTGTCTGTGACAGTGTCATACTCCCAAATCAAAG ATGACTGTTGCTACCACTACAC AGCTCTGATCA CAGAAACAAGT (SEQ ID NO:3) / ------------------ AAAGTTTATACAAAGAGAGTAAACATGAGTTTATATTCTACCTTTTAT GATTTAGTTGTTTGATGGTGGTTTGGTAAAGATTGTGAG(SEQ ID NO:2).

[0065] >C.agrus super-male

[0066] GTGCAACTCACAGCTGCTCCTCTCTTGTTTCCCGCTGCTTGGGGTGTGTGTGTTTGTGCGTGTGTGTGTGTGTGTGTGTCTGTGACAGTGTCATACTCCCAAATCAAAGATGACTGTTGCTACCACTACAC AGCTCTGATCACA GAAACAAGT AAAGTTTATACAAAGAGAGTAAACATGAGTTTATATTCTACCTTTTATGATTTAGTTGTTTGATGGTGGTTTGGTAAAGATTGTGAG(SEQ ID NO:4).

[0067] The Indel positions in the sequence were determined based on the publicly released Channa argus whole-genome sequence GCA_018997905.1 (Channa argus Genome assembly ASM1899790v1).

[0068] According to the characteristics of Indel mutation information, a set of competitive allele-specific PCR primers was designed, including Primer X, Primer Y, and the reverse primer. The ends of the two forward primers are the allelic variant bases AGCTCTGATCACAGAAACAAGT / ------------------, and the sequence of the reverse primer is selected to ensure that the amplified fragment is 60 - 120 bp.

[0069] The sequences of Primer X, Primer Y, and the reverse primer are as follows:

[0070] Primer X:

[0071] 5’- GAAGGTGACCAAGTTCATGCT ATGACTGTTGCTACCACTACACAA-3’ (SEQ ID NO:5);

[0072] Primer Y:

[0073] 5’- GAAGGTCGGAGTCAACGGATT ATGACTGTTGCTACCACTACACAG-3’ (SEQ ID NO:6);

[0074] Reverse primer: 5’-CACAATCTTTACCAAACCACCATCAAACAACT-3’ (SEQ ID NO:7).

[0075] A fluorescent tag sequence is added to the 5’ end of the forward primers. Among them, the 5’ end of Primer X is linked with the FAM fluorescent tag sequence 5’-GAAGGTGACCAAGTTCATGCT-3’ (SEQ ID NO:8), and the 5’ end of Primer Y is linked with the HEX fluorescent tag sequence 5’-GAAGGTCGGAGTCAACGGATT-3’ (SEQ ID NO:9).

[0076] The above primer sequences were all synthesized by Tianyi Huiyuan Biotechnology Co., Ltd. The KASP genotyping provided by the present invention has a large throughput and is simple to operate. Only the specific KASP Primer mix and the general KASP Master mix need to be added to the PCR microwell reaction plate containing the DNA sample for PCR amplification. The final result can be analyzed using a fluorescence detector.

[0077] The KASP Master mix contains the following components: a universal TRET cassette fluorescent primer, ROX internal reference dye, KlearTaq DNA polymerase, dNTP, and MgCl2. The KASP Master mix is a product of LGC Company in the UK, with the product catalog number KBS-1016-002.

[0078] Example 2: The InDel marker Cmhen 5 is used for marker-assisted selection breeding

[0079] This example is used to verify whether the molecular markers in Example 1 can achieve marker-assisted selection breeding of snakehead fish. The specific experimental process is as follows:

[0080] 1. Extract the genomic DNA of 83 snakehead fish;

[0081] 2. Dilute the DNA concentration: Dilute the DNA to 18 - 22 ng / μL (preferably 20 ng / μL) as the template;

[0082] 3. PCR amplification reaction system: 5 μL of template DNA, 5 μL of KASP Primer mix (the concentrations of Primer X and Primer Y are 1 μM, and the concentration of the reverse primer is 3 μM), 0.14 μL of KASP Master mix;

[0083] 4. The PCR reaction program is as follows: 94°C for 15 minutes; 94°C for 20 seconds, 65°C - 56°C for 60 seconds, with the annealing and extension temperature decreasing by 0.8°C for each cycle, for 10 cycles; 94°C for 20 seconds, 57°C for 60 seconds, for 30 cycles;

[0084] 5. Fluorescence scanning of the PCR amplification product: Use ARAYA to scan the fluorescence signal of the reaction system; then use INTELLICS for data analysis and genotype typing.

[0085] 6. Result analysis: The genotype of female snakehead fish is XX, the genotype of male snakehead fish is XY, and the genotype of supermale snakehead fish is YY.

[0086] If fluorescence corresponding to Primer X is detected in the amplification product, the base at this locus is "----------------------" (denoted as A:A) homozygous genotype, corresponding to female Channa argus; if two different fluorescences are detected in the amplification product, the base at this locus is "AGCTCTGATCACAGAAACAAGT / ----------------------" (denoted as A:G) heterozygous genotype, corresponding to male Channa argus. If fluorescence corresponding to Primer Y is detected in the amplification product, the base at this locus is "AGCTCTGATCACAGAAACAAGT" (denoted as G:G) homozygous genotype, corresponding to supermale Channa argus.

[0087] The identification results of Cahen 5 are shown in Table 1. Among the 83 Channa argus, 31 female Channa argus, 31 male Channa argus and 21 supermale Channa argus were identified. Combining the sampling results of female, male and supermale Channa argus, the genotyping ( Figure 1 ) results of Cahen 5 are completely consistent with the results of gonad examination, and the detection accuracy is 100%. The results show that Cahen 5 marker can accurately distinguish female Channa argus, male Channa argus and supermale Channa argus, with high speed and accuracy, so it can be used for marker-assisted selection breeding.

[0088] Table 1 Identification results of Cahen 5

[0089]

[0090]

[0091] The embodiments of the present invention have been described in detail above in conjunction with the accompanying drawings. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those of ordinary skill in the art, various changes can be made without departing from the gist of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. An InDel marker closely linked to the sex gene of Channa argus, wherein the InDel marker is located on chromosome 16 of the Channa argus genome, and the nucleotide sequence at the polymorphic site of 11556701-11556723 is "AGCTCTGATCACAGAAACAAGT / ----------------------"; among them, - indicates the deletion of InDel; The reference genome of the snakehead fish is Channa argus Genome assembly ASM1899790v1; The homozygous genotype with the polymorphic site base of "----------------------” corresponds to a female snakehead fish, the heterozygous genotype with the polymorphic site base of "AGCTCTGATCACAGAAACAAGT / ----------------------” corresponds to a male snakehead fish, and the homozygous genotype with the polymorphic site base of "AGCTCTGATCACAGAAACAAGT” corresponds to a supermale.

2. KASP primers for amplifying the InDel marker according to claim 1, including forward primer X, forward primer Y and a reverse primer; Among them, The forward primer X contains the nucleotide sequence shown in SEQ ID NO:10; The forward primer Y contains the nucleotide sequence shown in SEQ ID NO:11; The nucleotide sequence of the reverse primer is shown in SEQ ID NO:

7.

3. The KASP primer according to claim 2, characterized in that, The forward primer X and the forward primer Y contain tag sequences of fluorescent groups, and the fluorescent groups of the forward primer X and the forward primer Y are different.

4. The KASP primer according to claim 3, wherein The tag sequences of the fluorescent groups are located at the 5' ends of the forward primer X and the forward primer Y.

5. The KASP primer according to claim 4, wherein The fluorescent group is selected from any one of FAM, HEX, VIC, TAMRA, ROX, Texas-Red, CY5, MGB, BHQ1, BHQ2 and BHQ3.

6. A reagent or kit, comprising the KASP primer according to any one of claims 3 to 5.

7. The reagent or kit according to claim 6, characterized in that, The reagent or kit further contains DNA polymerase, dNTP and MgCl2.

8. Application of the InDel marker according to claim 1, the KASP primer according to any one of claims 2 to 5, and the reagent or kit according to claim 6 or 7 in any of the following aspects: 1) Identifying the sex of snakehead fish; 2) For molecular marker-assisted breeding related to the sex of snakehead fish; 3) Genotyping of snakehead fish; 4) Constructing a DNA fingerprint map of snakehead fish.

9. A method, comprising the step of using the KASP primer according to any one of claims 2 to 5 or the reagent or kit according to claim 6 or 7 to detect the InDel marker according to claim 1 in the genome of the snakehead fish to be tested; The method includes any one of 1) to 4): 1) A method for identifying the sex of snakehead fish; 2) A method for the assisted breeding of snakehead fish; 3) A method for genotyping snakehead fish; 4) A method for constructing a DNA fingerprint map of snakehead fish.

10. The method according to claim 9, wherein, The method includes the following steps: (1) Extracting the genomic DNA of the snakehead fish to be tested; (2) Using the DNA as a template and performing PCR amplification with the KASP primer according to any one of claims 2 to 5 or the reagent or kit according to claim 6 or 7; (3) Analyzing the PCR amplification product to obtain the polymorphism of the InDel marker in the genome of the snakehead fish to be tested.

11. The method according to claim 10, wherein When the homozygous genotype with the polymorphic site base being "----------------------” corresponds to a female snakehead fish; the heterozygous genotype with the polymorphic site base being "AGCTCTGATCACAGAAACAAGT / ----------------------” corresponds to a male snakehead fish, and the homozygous genotype with the polymorphic site base being "AGCTCTGATCACAGAAACAAGT” corresponds to a supermale snakehead fish.

Images