A primer, kit and method for 7-fold detection of chicken coccidia based on PCR-CRISPR Cas12a technology

Through PCR-CRISPR Cas12a technology, combined with specific crRNA and PCR primers, rapid, specific, sensitive and visual detection of a variety of coccidiosis is achieved, solving the problem of cumbersome and time-consuming diagnosis methods in the prior art, and improving the diagnostic efficiency of coccidiosis.

CN119391886BActive Publication Date: 2025-08-08SHANXI AGRI UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411689453.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-25
Publication Date
2025-08-08
Estimated Expiration
2044-11-25

AI Technical Summary

Technical Problem

The diagnosis method of coccidiosis in the prior art is complicated and time-consuming, and lacks fast, specific, sensitive, simple and low-cost detection methods, making it difficult to accurately identify and diagnose a variety of coccidiosis.

Method used

Using PCR-CRISPR Cas12a technology, specific crRNA and PCR primers were designed, and through multiple PCR amplification and CRISPR/Cas12a reaction, the detection of stack-type, tender, giant, poisonous, gentle, precocious, and Emeria Brucea was achieved, and the fluorescent signal was used for visual judgment.

Benefits of technology

It realizes rapid, specific, sensitive and visual detection of a variety of coccidiosis, reduces detection costs, improves diagnostic efficiency, and is suitable for the prevention and vaccine development of coccidiosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119391886B_ABST
    Figure CN119391886B_ABST
Patent Text Reader

Abstract

The present invention discloses a primer, a kit and a method for seven-fold detection of chicken coccidia based on PCR-CRISPR Cas12a technology, belonging to the field of molecular biological identification technology. The present invention provides a PCR primer for seven-fold detection of chicken coccidia based on PCR-CRISPR Cas12a technology, the primer comprising an upstream primer PCR-F as shown in SEQ ID NO.1 and a downstream primer PCR-R as shown in SEQ ID NO.2. The detection method provided by the present invention is suitable for the detection of Eimeria acervulina, Eimeria tenella, Eimeria giant, Eimeria toxicophila, Eimeria mild, Eimeria precocious and Eimeria brucei oocysts, and is mainly used for the detection of seven types of coccidia infection in chickens, the diagnosis of chicken coccidiosis and the identification of chicken coccidiosis vaccines.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biological identification, and in particular relates to primers, a kit and a method for seven-fold detection of chicken coccidia based on PCR-CRISPR Cas12a technology. Background Art

[0002] Coccidiosis is a parasitic protozoan disease of chickens caused by mixed infection with one or more Eimeria species, resulting in significant economic losses to the global chicken industry. Naturally, chickens often experience mixed infection with two or more species, each with distinct site and host specificity, causing varying degrees of intestinal disease. Therefore, accurate identification of coccidia species is crucial for the diagnosis and prevention of coccidiosis.

[0003] Traditional methods for identifying chicken coccidia species are primarily based on the biological characteristics of the pathogens, making their implementation cumbersome, time-consuming, and labor-intensive. There is an urgent need to develop a rapid, specific, sensitive, simple, low-cost, and visual seven-step kit and method for detecting chicken coccidia in clinical diagnosis and vaccine production. This will provide a basis for the prevention, control, epidemiological investigation, and development of coccidiosis vaccines, and is a critical issue for those skilled in the art. Summary of the Invention

[0004] To address the above technical issues, the present invention proposes primers, a kit, and a method for seven-fold detection of chicken coccidia based on PCR-CRISPR Cas12a technology. This method is suitable for detecting oocysts of Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria toxicophila, Eimeria mitis, Eimeria precocious, and Eimeria brucei.

[0005] The present invention provides the following technical solutions:

[0006] Technical Solution 1: A PCR primer for 7-fold detection of chicken coccidia based on PCR-CRISPR Cas12a technology, comprising an upstream primer PCR-F as shown in SEQ ID NO.1 and a downstream primer PCR-R as shown in SEQ ID NO.2;

[0007] The chicken coccidia include Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria toxicophila, Eimeria mitis, Eimeria precocious and Eimeria brucei.

[0008] Technical solution 2: Use of the PCR primers in the preparation of a kit for 7-fold detection of chicken coccidia based on PCR-CRISPR Cas12a technology.

[0009] Technical Solution 3: A kit for 7-fold detection of chicken coccidia based on PCR-CRISPR Cas12a technology, the kit comprising the PCR primers, crRNA, Cas12a protein and ssDNA; the chicken coccidia include any one of Eimeria acervulina, Eimeria tenella, Eimeria giant, Eimeria toxicophila, Eimeria mitis, Eimeria precocious and Eimeria brucei.

[0010] Further, when the chicken coccidia is giant Eimeria, the nucleotide sequence of the crRNA is shown as SEQ ID NO.10; when the chicken coccidia is Eimeria acervulina, the nucleotide sequence of the crRNA is shown as SEQ ID NO.11; when the chicken coccidia is Eimeria toxicophila, the nucleotide sequence of the crRNA is shown as SEQ ID NO.12; when the chicken coccidia is Eimeria mild, the nucleotide sequence of the crRNA is shown as SEQ ID NO.13; when the chicken coccidia is Eimeria precocious, the nucleotide sequence of the crRNA is shown as SEQ ID NO.14; when the chicken coccidia is Eimeria brucella, the nucleotide sequence of the crRNA is shown as SEQ ID NO.15; when the chicken coccidia is Eimeria tenella, the nucleotide sequence of the crRNA is shown as SEQ ID NO.16.

[0011] Furthermore, the nucleotide sequence of the ssDNA is 5'-FAM-TTATT-BHQI-3'.

[0012] Furthermore, the kit also includes ddH2O, 10×NEBuffer 2.1 and RNase-free H2O.

[0013] Technical Solution 4: A seven-fold detection method for chicken coccidia for non-disease diagnosis and / or treatment purposes, comprising the following steps:

[0014] (1) extracting the chicken coccidia oocyst DNA template from the fecal sample to be tested;

[0015] (2) using the PCR primers in the kit and the chicken coccidia oocyst DNA as a template, performing a PCR amplification reaction to obtain an amplified product;

[0016] (3) Using the amplified product as a template, the kit is used to perform a CRISPR / Cas12a reaction to obtain a reaction product; if the reaction product exhibits green fluorescence, it is determined that the fecal sample to be tested contains chicken coccidia of the type corresponding to the crRNA, or, if the fluorescence value of the reaction product is ≥1390, it is determined that the fecal sample to be tested contains chicken coccidia of the type corresponding to the crRNA.

[0017] Furthermore, the reaction system of the PCR amplification reaction is: 12.5 μL 2×MightyAmp Buffer, 1 μL 10 μmol / L upstream primer PCR-F, 1 μL 10 μmol / L downstream primer PCR-R, 1 μL template, 0.5 μL MightyAmp DNA Polymerase and 9 μL ddH2O;

[0018] The amplification conditions of the PCR amplification reaction are 98° C. for 2 min; 98° C. for 10 s, 60.2° C. for 15 s, and 68° C. for 30 s, for a total of 35 cycles.

[0019] Furthermore, the reaction system of the CRISPR / Cas12a reaction includes: 10×NEBuffer 2.1, amplification product, crRNA, Cas12a protein, ssDNA, RNase-free H2O;

[0020] The temperature of the CRISPR / Cas12a reaction was 37° C. and the reaction time was 60 min.

[0021] Technical Solution 5: Application of the kit in non-diagnostic detection or auxiliary detection of chicken coccidiosis.

[0022] Compared with the prior art, the present invention has the following advantages and technical effects:

[0023] The present invention designs a pair of universal PCR amplification primers for Eimeria acervulina, Eimeria tenella, Eimeria giant, Eimeria toxicophila, Eimeria mild, Eimeria precocious and Eimeria brucella. The target fragment is amplified by a multiplex PCR amplification system and can be used for subsequent CRISPR / Cas12a reactions. Then, the specific crRNA designed by the present invention can be used to distinguish and judge 7 types of chicken coccidia, realizing real-time detection and visualization of multiple chicken coccidia. The fluorescence visualization result of the present invention is determined by observing and photographing the reaction product under ultraviolet light of a gel imager. If there is obvious visible green fluorescence, the species corresponding to the chicken coccidia crRNA contained in the sample is positive, otherwise it is negative. If the fluorescence value (FI) of the sample is ≥1390, it is determined to be positive, otherwise it is determined to be negative. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0025] Figure 1 The 1-443bp gene sequence of 18S rDNA of Eimeria gallinarum was analyzed;

[0026] Figure 2 is the result of Eb18S rDNA sequence alignment;

[0027] Figure 3 Verify the results of PCR primers;

[0028] Figure 4 Optimize the PCR annealing temperature results;

[0029] Figure 5 Optimize the concentration of PCR primers.

[0030] Figure 6 Optimize results for PCR cycle number;

[0031] Figure 7 Visual observation results of PCR-CRISPR / Cas12a reaction products of 7 chicken coccidia samples;

[0032] Figure 8 The specific fluorescence value results of the PCR-CRISPR / Cas12a 7-plex detection system for chicken coccidia;

[0033] Figure 9 The fluorescence value results were measured to determine the sensitivity of the PCR-CRISPR / Cas12a 7-plex system for detecting chicken coccidia;

[0034] Figure 10 Visualization results of the sensitivity test of the PCR-CRISPR / Cas12a 7-plex system for detecting chicken coccidia;

[0035] Figure 11 The fluorescence value results of the clinical validation test of the PCR-CRISPR / Cas12a 7-plex detection system for chicken coccidia;

[0036] Figure 12 Visualization of the clinical validation results of the PCR-CRISPR / Cas12a 7-plex system for detecting chicken coccidia; DETAILED DESCRIPTION

[0037] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0038] Example 17 Design and Synthesis of Chicken Coccidia PCR Universal Primers and Specific crRNA

[0039] 1 Test method

[0040] 1.1 Selection of gene sequences

[0041] Select all 7 species of Eimeria gallinarum published in Genbank in NCBI and select the conserved and specific 18S rDNA, the Genbank accession numbers of E. tenella were U40264, KT184354, and EU025113; the Genbank accession numbers of E. acervulina were U67115, EF210324, and DQ538351; the Genbank accession numbers of E. necatrix were DQ136185, U67119, and KT184349; the Genbank accession numbers of E. praecox were U67120, KT184352, and FJ23636; the Genbank accession numbers of E. mitis were U40262, FR775302, and FR775303; and the Genbank accession numbers of E. maxima were U67117, FJ236361, and FJ236360.1 as characteristic target genes, and the mRNA expression was detected by Clustal sequencing in MEGA11. The W program was used to perform multiple sequence alignments according to the corresponding parameters, and sequences common to all seven species of chicken coccidia were found in the 18S rDNA sequence. Sequences from 1 to 443 bp of the 18S rDNA of chicken coccidia included both sequences common to all seven species and sequences specific to each species. Sequences from 1 to 48 bp, 50 to 108 bp, and 280 to 443 bp were common to all seven species and served as reference sequences for designing universal primers for all seven coccidia. Sequences from 200 to 270 bp included sequences that were conserved within the species and specific to each species. See [ 1-48 bp ] for details. Figure 1 The other 7 interspecies-specific sequences of chicken coccidia were verified by NCBI and showed that they were all specific, so they could be used as target sequences for designing specific crRNAs for the 7 chicken coccidia species.

[0042] 1. Design of universal primers for PCR of 27 species of Eimeria gallinarum

[0043] According to the principles of PCR primer design, 7 universal PCR primers for amplifying the 18S rDNA gene (about 300 bp) of Eimeria gallinarum were designed using Primer 5 software. The primers are shown in Table 1.

[0044] Table 1 Universal primer sequences for PCR amplification of chicken coccidia

[0045]

[0046] The target sequences of 7 species of chicken coccidia are as follows:

[0047] Eimeria tenella target sequence:

[0048] 5’-TGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCTTTTATACGGTGAAACT GCGAATGGCTCATTAAAACAGTTATAGTTTATTTGATGGTCTCATTTTACATGGATAACCA TGGTAATTCTATGGCTAATACATGCGCAAAGGTCACCTCCTTTGGAGGGGCTGTGTTTATT AGATACAAAACCAACCCACT-TTGTAGTGGAGTCTTGGTGATTCATAGTAACCGAACGGA TCGCAGTTGGTTCTTTTGGGCCCGCGATGGATCATTCAAGTTTCTGACCTATCAGCTTTC GACGG-3’(SEQ ID NO.3);

[0049] Eimeria acervulina target sequence: 5’-TGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCTT TTATACGGTGAAACTGCGAATGGCTCATTAAAACAGTTATAGTTTATTTGATGGTCTC-TTT TACATGGATAACCATGGTAATTCTATGGCTAATACATGCGCAAGGGCCTCCTCCTCTGGA GGGGCTGTGTTTATTAGATACAAAACCAACCCAC--CTTGTGTGGAGTCTTGGTGATTCAT AGTAACCGAACGGATCGCAGTTGG--CTTTCGGGCCCGCGATGGATCATTCAAGTTTCTG ACCTATCAGCTTTCGACGG-3’(SEQ ID NO.4);

[0050] Target sequence of Eimeria maxima: 5’-TGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAACTT TTATACGGTGAAACTGCGAATGGCTCATTAAAACAGTTATAGTTTATTTGATGGTCATTTTTACATGGATAACCATGGTAATTCTATGGCTAATACATGCGCAAAGGCTACCTTCTTTGGAGGAGCTGTGTTTATTAGATACAAAGCCAACCCACAATTCTTGTGGAGTCTTGGTGATTCATAGTAACCGAACGGATCGCAGTTGGCTTTCGTGCCCGCGATGGATCATTCAAGTTTCTGACCTATCAGCTTTCGACGGTAAAGGATGCAAAAGTCGTAACACGGTTT-3’, (SEQ ID NO.5);

[0051] Target sequence of Eimeria necatrix: 5’-TGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCTT TTATACGGTGAAACTGCGAATGGCTCATTAAAACAGTTATAGTTTATTTGATGGTCTCATTTTACATGGATAACCATGGTAATTCTATGGCTAATACATGCGCAAAGGTCACCTCCTTTGGAGGGGCTGTGTTTATTAGATACAAAACCAACCCACTTAACGGTGGAGCCTTGGTGATTCATAGTAACCGAACGGATCGCAGTTGGTTCTTTTGGACCCGCGATGGATCATTCAAGTTTCTGACCTATCAGCTTTCGACGG-3’(SEQ ID NO.6);

[0052] Target sequence of Eimeria brunetti: 5’-TGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAACTT TTATACGGTGAAACTGCGAATGGCTCATTAAAACAGTTATAGTTTATTTGATGGTCATTTTTACATGGATAACCATGGTAATTCTATGGCTAATACATGCGCATAGGCTTCCTTCTTTGAAGGGGCTGTGTTTATTAGATACAAAACCAACCCACCTTGTGGAGTCTTGGTGATTCATAGTAACCGAACGGATCGCAGTTGGCTTTCGGGCCCGCGATGGATCATTCAAGTTTCTGACCTATCAGCTTTCGACGG-3’ (SEQ ID NO.7);

[0053] Target sequence of Eimeria mitis: 5’-TGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCT TTTATACGGTGAAACTGCGAATGGCTCATTAAAACAGTTATAGTTTATTTGATGGTCTTTTTTACATGGATAACCATGGTAATTCTATGGCTAATACATGCGCATAGGCCTCCTCCTCTGGAGGGGCTGTGTTTATTAGATACAAAACCAACCCACTTTGTGGAGCCTTGGTGATTCATAGTAACCGAACGGATCGCAGTTGGCTTTCGGGCCCGCGATGGATCATTCAAGTTTCTGACCTATCAGCTTTCGACGG-3’ (SEQ ID NO.8);

[0054] Eimeria precoccus target sequence: 5'-TGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCTT TTATACGGTGAAACTGCGAATGGCTCATTAAAACAGTTATAGTTTATTTGATGGTCTTTTTTTACATGGATAACCATGGTAATTCTATGGCTAATACATGCGCAAAGGCTACCTTCTCTGGAGGGGCTGTGT TTATTAGATACAAAACCAACCCACTTTTGTGGAGTCATGGTGATTCATAGTAACCGAACGGATCGCAGTTGGCTTTCGGGCCCGCGATGGATCATTCAAGTTTCTGACCTATCAGCTTTCGACGG-3'(SEQ ID NO.9).

[0055] 1.37 Design of Eimeria gallinarum-specific crRNA

[0056] Based on the conserved and interspecies specific target sequences of the 7 species of chicken coccidia screened above, the CRISPOR website was designed. http: / / crispor.gi.ucsc.edu / crRNA was designed for 7 chicken coccidia-specific gene sequences, see Table 2 for details.

[0057] 1.4 Primer synthesis

[0058] The above-mentioned PCR primers and crRNA gene sequences were commissioned to be synthesized by Sangon Biotechnology Co., Ltd.

[0059] 2 Test results

[0060] The crRNA sequences specific to Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria necatrix, Eimeria mitis, Eimeria precocious, and Eimeria brunetti are shown in Table 2.

[0061] Table 2 Coccidia-specific crRNA sequences

[0062]

[0063] Note: The underlined sequence is the stem-loop structure required for Cas12a to recognize crRNA.

[0064] Example 2 Establishment and feasibility verification of chicken coccidia PCR amplification reaction system

[0065] 1 Test method

[0066] 1.1 DNA extraction

[0067] 1.1.1 Fecal chicken coccidia oocyst samples

[0068] Take 1 g of fresh fecal sample and put it into a centrifuge tube. Add 5 mL of saturated saline to each tube of feces, mix well, centrifuge at 1200 r / min for 5 min, transfer the supernatant to a new centrifuge tube, add ten times the amount of dH2O and mix well, centrifuge at 2500 r / min for 10 min, and take the precipitate. Add 100 μL of coccidia lysis solution (5% chicken bile, 0.375% trypsin, 1% Triton X-100 and 10 mmol / EDTA) and 0.15 g of 0.05 mm diameter glass beads to the oocyst pellet, and shake on a shaker at 200 r / min for 45 min; then add 5 μL of 0.25 mol / L NaOH, immediately invert upside down to mix, and let it stand for 2 min to digest; then add 10 μL of 0.25 mol / L acetic acid, immediately invert upside down to mix, and centrifuge instantly; add 1 μL of proteinase K, shake and mix, digest in a 60°C water bath for 20 min (shake every 5 min), boil for 2 min, and ice bath for 5 min. Transfer the supernatant to a new PCR tube, centrifuge instantly for 60 s, and obtain the supernatant as the DNA template.

[0069] 1.1.2 Purified chicken coccidia oocyst samples

[0070] Purified oocysts + coccidia lysate + 0.15g 0.5mm glass beads → shake on a shaker at 200r / min for 45min + 5μL 0.25mol / LNaOH → mix well and let stand to digest for 2min + 10μL 0.25mol / L acetic acid (immediately invert upside down to mix, and centrifuge briefly) + 1μL proteinase K → digest in a 60℃ water bath for 20min → boil for 2min → ice bath for 5min → transfer the supernatant to another centrifuge tube → centrifuge briefly for 60s and take the supernatant.

[0071] 1.1.3 Preparation of E. brunetti recombinant plasmid DNA template

[0072] 1.1.3.1 Construction of E. brunetti recombinant plasmids

[0073] A target gene sequence (431 bp) that was conserved within species and specific between species was selected from the Eb18S rDNA gene (accession number: U67116) in GeneBank, commissioned to Sangon Biotech (Shanghai) Co., Ltd. for synthesis, and ligated into the pUC57 cloning vector to construct an E. brunetti recombinant plasmid, which was then transferred into E. coli DH5α.

[0074] 1.1.3.2 Extraction of recombinant plasmid DNA from E. brunetti

[0075] The plasmid was extracted according to the instructions of the plasmid DNA minipreparation kit (TAKARA).

[0076] 1.1.3.3 Identification of E. brunetti recombinant plasmids

[0077] The E. brunetti recombinant plasmid was activated and sent to Sangon Biotech for sequencing to verify whether the synthetic sequence was correct.

[0078] 1.2 PCR amplification and gel electrophoresis

[0079] PCR amplification and gel electrophoresis were performed on the templates of Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria toxicophila, Eimeria mitis, Eimeria precocious and Eimeria brucei using the primers in Table 1. The reaction system, reaction procedure and gel electrophoresis are as follows.

[0080] Reaction system: 2× MightyAmp Buffer 12.5 μL, 10 μmol / L upstream and downstream primers 0.75 μL each, DNA template 1 μL, MightyAmp DNA Polymerase 0.5 μL and ddH2O 9.5 μL.

[0081] Reaction procedure: ① Pre-denaturation at 98°C for 2 min; ② Denaturation at 98°C for 10 s; ③ Annealing at 60°C for 15 s; ④ Extension at 68°C for 30 s, 29 cycles. Agarose gel electrophoresis: Samples were spotted onto a 1.2% agarose gel. 1.25 μL of 5× Loading Dye and 5 μL of PCR product were aspirated, along with a marker (5.0 μL) control well. Electrophoresis was performed at 120 V for 30 min. Immediate observation was made on a gel analysis system to detect the appearance of the target bands for each insect species.

[0082] 1.3 PCR product sequencing

[0083] The PCR products were sent to Beijing BGI for sequencing, and the sequencing results were compared with the target sequences using the NCBI BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) function.

[0084] 2 Test results

[0085] 2.1 Construction and identification of E. brunetti recombinant plasmids

[0086] The sequencing results were verified by NCBI BLAST, and the results showed that the sequencing results of the E. brunetti recombinant plasmid were 100% similar to those of U67116.1. Figure 2 Therefore, the E. brunetti recombinant plasmid was successfully constructed.

[0087] 2. Identification of 37 species of chicken coccidia by gel electrophoresis of PCR products

[0088] The single-plex PCR products of E. tenella, E. maxima, E. acervulina, E. necatrix, E. praecox, E. brunetti, and E. mitis showed target bands around 300 bp in gel electrophoresis, and no non-target bands were amplified. Figure 3 .

[0089] 2.4 PCR product sequencing and identification

[0090] The PCR products of the seven species of chicken coccidia were sequenced by BGI Co., Ltd., and the sequencing results of the seven species of chicken Eimeria in NCBI BLAST were all consistent with the designed target sequence, with the following results: the sequencing result of Eimeria tenella was 99.67% similar to DQ136178; the sequencing result of Eimeria maxima was 99.70% similar to DQ538350.1; the sequencing result of Eimeria toxicophila was 99.34% similar to U67119.1; the sequencing result of Eimeria brucei was 100% similar to U67116.1; the sequencing result of Eimeria mildae was 99.67% similar to FR775303.1; and the sequencing result of Eimeria precocious was 100% similar to FJ236365.1.

[0091] The results showed that the target sequences (about 300 bp) of the 18S rDNA genes of seven species of Eimeria gallinarum could be accurately amplified using the above-mentioned universal PCR primers (PCR-F and PCR-R), reaction system and reaction procedure, and the primers and PCR amplification reaction system for Eimeria gallinarum were feasible.

[0092] Example 3 Optimization of the PCR amplification reaction system for Eimeria gallinarum

[0093] The three reaction conditions and parameters that have the greatest impact on PCR amplification effect, namely annealing temperature, primer concentration, and number of cycles, were adjusted and optimized to determine the optimal reaction conditions. The specific product bands of gradient PCR gradually brightened with the increase of annealing temperature. The target fragment at 60.2℃ was the brightest, and there were no non-specific bands. Then, the bands gradually dimmed. Figure 4 Therefore, the annealing temperature of 60.2℃ was selected as the optimal annealing temperature for this PCR. The amount of PCR product increased with the increase of primer concentration. However, when the primer concentration was ≥0.4μmol / L, the amount of PCR product no longer increased. Figure 5 Therefore, the primer concentration of 0.4 μmol / L was selected as the optimal primer concentration for this PCR. The amount of PCR product increased with the increase of cycle number, and no non-specific bands appeared. When the cycle number was ≥35, the amount of PCR product no longer increased. Figure 6 Therefore, 35 cycles were selected for PCR. In summary, the optimal annealing temperature for the PCR amplification reaction system of Eimeria gallinarum was 60.2°C, the primer concentration was 0.4 μmol / L, and the number of cycles was 35 (Table 3).

[0094] Table 3 PCR amplification system and conditions

[0095]

[0096] Example 4 Construction of PCR-CRISPR / Cas12a 7-plex detection system for chicken coccidia

[0097] 1 Test method

[0098] Based on the trans-cleavage principle of Cas12a, a PCR-CRISPR-Cas12a detection system was established.

[0099] The specific steps are as follows: 7 types of Eimeria gallinarum oocyst DNA were prepared according to the method of Example 2, and PCR amplification and gel electrophoresis were performed according to the optimal PCR reaction system and reaction procedure screened in Example 3. According to Table 5, 2 sets of CRISPR-Cas12a reaction systems (7 tubes / set of samples, 7 tubes / set of negative controls) were prepared, and the crRNAs therein were added with the crRNAs of the 7 types of coccidia in Table 2, and the groups were detailed in Table 4, and the reactions were carried out according to the reaction procedure in Table 5.

[0100] Table 4 CRISPR-Cas12a reaction system establishment group

[0101] Group DNA template crRNA Group DNA template crRNA ET1 E. tenella ET1 TN — ET1 EM1 E.maxima EM1 MN — EM1 EA1 E. acervulina EA1 AN — EA1 EN1 E. necatrix EN1 NN — EN1 EI1 E.mitis EI1 IN — EI1 EP1 E.praecox EP1 PN — EP1 EB1 E. brunetti EB1 BN — EB1

[0102] Table 5 CRISPR-Cas12a reaction system and conditions

[0103]

[0104]

[0105] Determination of fluorescence visualization results: Place each CRISPR / Cas12a reaction final product tube under the ultraviolet light (254nm) of the gel imaging analysis system for observation and photography. If green fluorescence is visible to the naked eye, it is positive, and the tube contains the coccidia corresponding to the crRNA.

[0106] Determination of fluorescence values and positive judgment criteria for PCR-CRISPR / Cas12a 7-plex detection of chicken coccidia samples: There are certain differences in naked eye observation between different observers, and the qualitative results of the critical value are prone to errors. Take 3 tubes of E. mitis CRISPR / Cas12a reaction products and perform a 2-fold gradient dilution to 2 -7 Fluorescence values were read using a fluorescence quantitative PCR instrument, and three people simultaneously observed the results using a gel image analysis system with UV light (254 nm). This was repeated three times. The mean and standard deviation of the fluorescence values of the lowest concentration of samples with visible fluorescence were selected as the criterion for positive results.

[0107] 2 Test results

[0108] 2.1 Results of the establishment of a 7-plex PCR-CRISPR / Cas12a system for detecting chicken coccidia

[0109] The final products of the PCR-CRISPR / Cas12a reaction of the seven chicken coccidia samples all emitted green fluorescent signals of varying intensities, visible to the naked eye, while the negative control had no visible fluorescent signal, indicating that the target DNA could be recognized by the Cas12a-crRNA complex and activated the trans-cleavage activity of Cas12a, cleaving the ssDNA probe and causing the separation of the fluorophore and the quencher. This increased the fluorescence intensity and was visible to the naked eye ( Figure 7 ), indicating that the PCR-CRISPR-Cas12a detection system for chicken coccidia was established.

[0110] 2.2 Determination of fluorescence values and positive judgment criteria for chicken coccidia samples

[0111] Three people observed the final PCR-CRISPR / Cas12a reaction product under ultraviolet light. The lowest fluorescence value of the fluorescent sample visible to the naked eye was 1000-1588, with an average of 1261. The judgment standard for the fluorescence value test result of the PCR-CRISPR / Cas12a reaction product should be the average of the lowest fluorescence values of the positive sample reaction product (obvious green fluorescence visible to the naked eye). and standard error (SE), that is, the fluorescence value of the sample If green fluorescence is visible to the naked eye, it is judged as positive, otherwise it is judged as negative. Calculation shows that the sample fluorescence value (FI) of 1390 is used as the judgment standard, that is, FI ≥ 1390 is judged as positive.

[0112] Example 5 Optimization of the PCR-CRISPR / Cas12a 7-plex Detection System for Chicken Coccidia

[0113] 1 Test method

[0114] 1.1Cas12a / crRNA concentration ratio screening

[0115] According to the optimized Eimeria gallinarum PCR amplification reaction system in Example 3, PCR amplification was performed on 7 kinds of Eimeria gallinarum oocyst DNA. According to the PCR-CRISPR / Cas12a detection system established in Example 4, the crRNA dosage of various coccidia was 50 nmol / L, and the concentrations of Cas12a were set to 0, 25, 50, 100, 150, and 200 nmol / L, that is, 6 groups of different Cas12a:crRNA ratios (0:1, 0.5:1, 1:1, 2:1, 3:1, and 4:1) were designed to prepare CRISPR / Cas12a reaction systems. The FAM fluorescence intensity was observed in a fluorescent quantitative PCR instrument, and the reaction was carried out at 37°C for 60 min. The Cas12a to crRNA concentration ratio with the highest fluorescence value was selected.

[0116] 1.2 ssDNA concentration screening

[0117] According to the optimized Eimeria gallinarum PCR amplification reaction system of Example 3, PCR amplification was performed on 7 kinds of Eimeria gallinarum oocyst DNA. According to the optimal Cas12a and crRNA concentration ratio screened in 1.1 above, ssDNA with a final concentration of 125, 250, 500, 1000 and 2000 nmol / L was selected to prepare CRISPR / Cas12a reaction systems of 6 kinds of coccidia, including E.tenella, E.maxima, E.acervulina, E.necatrix, E.mitis and E.brunetti, respectively. At the same time, ssDNA with a final concentration of 250, 500, 1000, 2000 and 4000 nmol / L was selected to prepare CRISPR / Cas12a reaction systems of E.praecox. FAM fluorescence intensity was observed in a fluorescent quantitative PCR instrument, the reaction was carried out at 37°C for 60 min, the fluorescence value was detected, and the optimal ssDNA reporter gene concentration was selected.

[0118] 2 Test results

[0119] When the crRNA concentration was 50 nmol / L, E. tenella, E. acervulina, and E. mitis selected 100 nmol / L of Cas12a protein; E. maxima, E. necatrix, and E. brunetti selected 150 nmol / L of Cas12a protein, and E. praecox selected 200 nmol / L of Cas12a protein. The fluorescence value of the CRISPR / Cas12a reaction system product was the highest, indicating that this was the optimal Cas12a / crRNA concentration ratio. The optimal ssDNA reporter gene concentration for the CRISPR / Cas12a reaction system for E. tenella, E. maxima, E. acervulina, E. necatrix, E. mitis, and E. brunetti was 1000 nmol / L, and the optimal ssDNA reporter gene concentration for E. praecox was 2000 nmol / L.

[0120] Example 6 Specificity Verification of the PCR-CRISPR / Cas12a 7-plex Detection System for Chicken Coccidia

[0121] 1 Test method

[0122] To determine that the PCR-CRISPR / Cas12a 7-fold rapid detection method for detecting 7 kinds of coccidia established by the present invention has no cross-reaction between 7 kinds of chicken coccidia or with other common chicken intestinal pathogens, 7 kinds of chicken Eimeria oocyst DNAs are prepared according to the method of Example 2, and PCR amplification of DNA templates is performed on 7 kinds of chicken coccidia according to the amplification system and conditions of Example 3. And according to the reaction system and reaction procedure of Table 7, 7 kinds of chicken coccidia, Escherichia coli (Escherichiacoli), Salmonella (Salmonella) and three negative feces (Negative stool) sample genomes are respectively detected by CRISPR / Cas12a with the crRNA of 7 kinds of chicken coccidia, see Table 6 for details, verify its specificity, and set up ddHO as a negative control. Its fluorescence value is measured using a fluorescent quantitative PCR instrument, and the fluorescence of each group of products is observed and photographed under a gel imager UV lamp to determine whether the established detection method is specific and whether there is cross-reactivity with related species.

[0123] Table 6 PCR-CRISPR / Cas12a specificity verification test grouping

[0124]

[0125] Table 7 CRISPR / Cas12a reaction system preparation and reaction conditions (μL)

[0126]

[0127]

[0128] 2 Test results

[0129] The fluorescence values of the chicken coccidia samples corresponding to the crRNA groups of E. tenella, E. maxima, E. acervulina, E. necatrix, E. mitis, E. praecox, and E. brunetti were all >1390 and significantly higher than the negative control (P < 0.05). The fluorescence values of the remaining groups were all <1390 and had no significant differences from the negative control (P ≥ 0.05). Figure 8 Under ultraviolet light, the final product of the reaction of each insect species with the corresponding crRNA emitted obvious fluorescence visible to the naked eye, while the other groups had no visible fluorescence. Figure 9 .

[0130] Example 7 Sensitivity Determination of the PCR-CRISPR / Cas12a 7-plex Detection System for Chicken Coccidia

[0131] 1 Test method

[0132] 1.1 Preparation and dilution of chicken coccidia DNA template

[0133] According to the method of Example 2, the number of oocysts of E. tenella, E. maxima, E. acervulina, E. necatrix, E. mitis, and E. praecox was 10 6 DNA extraction of coccidia oocysts was performed on 10 4 The coccidia DNA extract was diluted 10-fold with ddH2O. The number of oocysts corresponding to each concentration of DNA after dilution was 10 3 , 10 2 , 10 1 , 10 0 , 10 -1 , 10 -2 / μL; NanoDropOneC was used to determine the concentration of E. brunetti plasmid and calculate the copy number, and a ten-fold serial dilution was performed. The plasmid DNA concentration was 10 4 , 10 3 , 10 2 , 10 1 , 10 0 , 10 -1 , 10 -2 copies / μL range.

[0134] 1.27-fold detection of chicken coccidia system sensitivity determination group

[0135] Use 10 in Example 7 4 -10 -2 The DNA templates of the recombinant plasmids of E. tenella, E. maxima, E. acervulina, E. necatrix, E. mitis, E. praecox, and E. brunetti after continuous gradient dilution were PCR amplified according to the reaction system and reaction procedure in Table 3, and the CRISPER-Cas12a system-mediated nucleic acid detection color reaction was performed using the reaction system and reaction procedure in Table 7. The fluorescence value of the FAM channel was measured using a fluorescence quantitative PCR instrument, and the gel was observed and photographed under ultraviolet light under a gel imager. The minimum DNA concentration or plasmid copy number at which a significant fluorescence signal could be observed by the naked eye was recorded in each group of experiments. Each dilution gradient sample was tested in triplicate.

[0136] 2 Test results

[0137] The concentration of DNA template (oocyst) of E.tenella, E.maxima, E.acervulina, E.necatrix, E.mitis, E.praecox was 10 4 ~10 -2 In the range of oocysts / μL, the fluorescence values decreased with the decrease of oocyst concentration. The fluorescence values of the groups with DNA template (oocysts) concentration ≥100 / μL were significantly higher than those of the negative control (p < 0.05), and the fluorescence was visible to the naked eye (positive). 4 ~10 -2 In the range of 10 copies / μL, the fluorescence intensity decreased with the decrease of DNA concentration (oocysts), and the concentration of DNA template (oocysts) was ≥10 0 The fluorescence values of the 100 μL / μL group were significantly higher than those of the negative control (p < 0.05), and the fluorescence was visible to the naked eye (positive) ( Figure 10 The results showed that the PCR-CRISPR / Cas12a 7-plex chicken coccidia detection system could detect 1 coccidia oocyst / μL for E. tenella, E. maxima, E. acervulina, E. necatrix, E. mitis, and E. praecox, and 1 copy / μL of plasmid DNA (i.e., 1 coccidia oocyst / μL) for E. brunetti.

[0138] Example 8 Repeatability Test of PCR-CRISPR / Cas12a 7-plex Detection System for Chicken Coccidia

[0139] 1 Test method

[0140] According to the Technical Guidelines for Veterinary Diagnostic Product Testing and Research, reproducibility is generally expressed as the coefficient of variation. This means that the test kit is used to perform three replicates between batches, and at least four replicates within a batch, on known negative, weakly positive (with concentrations near the cutoff), and strongly positive samples. The coefficient of variation of the test results is calculated to determine the reproducibility of the test. The coefficient of variation must be within an acceptable range.

[0141] Select the strong positive (10 4 oocysts / μL), weakly positive (10 1 and 10 0 oocysts / μL) of E.tenella, E.maxima, E.acervulina, E.necatrix, E.mitis, E.praecox and DNA concentration was 10 4 , 10 1 and 10 0 The positive template of the E. brunetti recombinant plasmid with a concentration of 10 copies / μL was used, and PCR amplification was performed in three batches and four times according to the reaction system and reaction procedure in Table 3. The CRISPER-Cas12a system-mediated nucleic acid detection color development reaction was performed using the reaction system and reaction procedure in Table 7. The fluorescence value of the FAM channel was determined using a fluorescence quantitative PCR instrument, and the gel was observed and photographed under ultraviolet light on a gel imager. The coefficient of variation was calculated to evaluate the repeatability of the method.

[0142] 2 Test results

[0143] Repeatability of the PCR-CRISPR / Cas12a 7-plex chicken coccidia detection system: The intra-assay coefficient of variation (CRV) for the PCR-CRISPR / Cas12a 7-plex chicken coccidia detection system was less than 5% for strongly positive, weakly positive, and negative samples of E. tenella, E. maxima, E. acervulina, E. necatrix, E. mitis, E. praecox, and E. brunetti, and the inter-assay coefficient of variation (CRV) was less than 10%. This met the requirements for intra-assay precision (CRV < 10%) and inter-assay precision (CRV < 15%) in the "Quality Requirements for Analytical Key Routine Items in Clinical Qualitative Immunoassays." This demonstrates that the PCR-CRISPR / Cas12a 7-plex chicken coccidia detection system exhibits excellent repeatability. See Table 8 for details.

[0144] Table 8 Repeatability test results of PCR-CRISPR / Cas12a detection of 7 coccidia species

[0145]

[0146]

[0147] Example 9 Clinical Validation Test of the PCR-CRISPR / Cas12a 7-plex Detection System for Chicken Coccidia

[0148] 1 Test method

[0149] Coccidia samples in Table 9 were prepared using the method of Example 2 as coccidia oocyst DNA templates. PCR amplification was performed according to the reaction system and reaction procedure in Table 3, and a nucleic acid detection color reaction mediated by the CRISPER-Cas12a system was performed using the sample detection and control settings in Table 10 and the reaction system and reaction procedure in Table 7. The fluorescence value of the FAM channel was measured using a fluorescent quantitative PCR instrument, and the gel imager was observed and photographed under ultraviolet light to detect the species and purity of these chicken coccidia. Result judgment criteria: a reaction product fluorescence value > 1390 or obvious fluorescence visible to the naked eye under ultraviolet light was considered positive; otherwise, it was considered negative.

[0150] Table 9 Chicken coccidia samples

[0151]

[0152] Table 10 Sample test and control settings

[0153]

[0154] 2 Test results

[0155] The reaction products of the corresponding crRNA systems of E. acervulina, E. mitis, E. tenella, E. maxima, E. necatrix, E. brunetti, and E. praecox samples and the positive control group all showed green fluorescence, and the fluorescence values were all > 1390. However, the fluorescence values of the reaction products of the non-corresponding crRNA of the samples and the negative control group were all < 1390, and no visible fluorescence was observed. For details, see Figure 11 and Figure 12 . In summary, the vaccine strains of samples Msd (202310), Msh (202303), PAsx (202312), ASx (202313) Nsx (202307), PNsx (202305), Psx (202315) and Missx (202306) were identified as E. maxima, E. acervulina, E. mitis, E. necatrix and E. praecox species, respectively, and were pure strains. That is, the positive coincidence rate was 100%, and the negative coincidence rate was also 100%. Therefore, the PCR-CRISPR / Cas12a 7-plex detection system for chicken coccidiosis established in the present invention can be applied to the diagnosis of chicken coccidiosis and the identification of insect species for vaccine production.

[0156] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A kit for detecting chicken coccidia based on PCR-CRISPR Cas12a technology, characterized in that: The kit includes PCR primers, crRNA, Cas12a protein and ssDNA; the chicken coccidia include Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria toxicophila, Eimeria mitis, Eimeria precocious and Eimeria brucei; When the chicken coccidia is Eimeria maxima, the nucleotide sequence of the crRNA is shown in SEQ ID NO.10; when the chicken coccidia is Eimeria acervulina, the nucleotide sequence of the crRNA is shown in SEQ ID NO.11; when the chicken coccidia is Eimeria toxicophila, the nucleotide sequence of the crRNA is shown in SEQ ID NO.12; when the chicken coccidia is Eimeria mild, the nucleotide sequence of the crRNA is shown in SEQ ID NO.13; when the chicken coccidia is Eimeria precocious, the nucleotide sequence of the crRNA is shown in SEQ ID NO.14; when the chicken coccidia is Eimeria brucei, the nucleotide sequence of the crRNA is shown in SEQ ID NO.15; when the chicken coccidia is Eimeria tenella, the nucleotide sequence of the crRNA is shown in SEQ ID NO.16; the nucleotide sequence of the ssDNA is 5'-FAM-TTATT-BHQI-3'; The PCR primers include an upstream primer PCR-F as shown in SEQ ID NO.1 and a downstream primer PCR-R as shown in SEQ ID NO.

2.

2. The kit according to claim 1, wherein The kit also includes ddH2O, 10×NEBuffer 2.1 and RNase-free H2O.

3. A seven-fold detection method for chicken coccidia for purposes other than disease diagnosis and / or treatment, characterized in that: The steps include: (1) extracting the chicken coccidia oocyst DNA template from the fecal sample to be tested; (2) using PCR primers and chicken coccidia oocyst DNA as a template to perform a PCR amplification reaction to obtain an amplified product; the PCR primers include an upstream primer PCR-F as shown in SEQ ID NO.1 and a downstream primer PCR-R as shown in SEQ ID NO.2; (3) Using the amplified product as a template, a CRISPR / Cas12a reaction is performed using the kit described in claim 1 to obtain a reaction product; if the reaction product exhibits green fluorescence, it is determined that the fecal sample to be tested contains chicken coccidia of the type corresponding to the crRNA, or, if the fluorescence value of the reaction product is ≥1390, it is determined that the fecal sample to be tested contains chicken coccidia of the type corresponding to the crRNA.

4. The seven-fold detection method for chicken coccidia according to claim 3, characterized in that: The reaction system of the PCR amplification reaction is: 12.5 μL 2× MightyAmp Buffer, 1 μL 10 μmol / L upstream primer PCR-F, 1 μL 10 μmol / L downstream primer PCR-R, 1 μL template, 0.5 μL MightyAmp DNA Polymerase and 9 μL ddH2O; The amplification conditions of the PCR amplification reaction are 98° C. for 2 min; 98° C. for 10 s, 60.2° C. for 15 s, and 68° C. for 30 s, for a total of 35 cycles.

5. The seven-fold detection method for chicken coccidia according to claim 3, characterized in that: The reaction system of the CRISPR / Cas12a reaction includes: 10×NEBuffer 2.1, amplification product, crRNA, Cas12a protein, ssDNA, RNase-free H2O; The temperature of the CRISPR / Cas12a reaction was 37° C. and the reaction time was 60 min.

6. Use of the kit according to claim 1 or 2 in detecting or assisting in detecting chicken coccidia for non-diagnostic purposes.

Citation Information

Patent Citations

  • 5,6-Dihydro-1,2,4,6-thiatriazin(5)on-1.1-dioxides, process for their preparation and herbicides containing them

    EP0025113A1

  • vehicle comprising two running wheels placed one behind the other, one of which can be steered

    FR775302A

  • double-walled tubular element system

    FR775303A

  • Biosensor for rapidly detecting multi-drug resistant acinetobacter baumannii by combining multiple PCR and CRISPR-Cas

    CN112029839A