Primers, kit and detection method for seven-fold detection of chicken coccidia based on RAA-CRISPR / Cas12a technology

Through the primers and kits of RAA-CRISPR/Cas12a technology, multiple detection of coccidiosis is achieved, and the cumbersome and time-consuming identification in the prior art is solved. It provides a fast, sensitive and visual detection method, which is suitable for the diagnosis and vaccine development of coccidiosis.

CN119391887BActive Publication Date: 2025-07-11SHANXI AGRI UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411689517.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-25
Publication Date
2025-07-11
Estimated Expiration
2044-11-25

AI Technical Summary

Technical Problem

The prior art is cumbersome, time-consuming and labor-intensive in the identification of coccidiacea species, and relies on manual identification, making it difficult to achieve fast, specific, sensitive and low-cost multiple detection.

Method used

The primers and kits based on RAA-CRISPR/Cas12a technology, including specific crRNA, are used to achieve multiple detections of heap-type, tender, giant, poisonous, gentle, precocious, and Emeria Brucea through RAA amplification and CRISPR/Cas12a reaction.

Benefits of technology

It realizes instant and visual detection of coccidiosis, with high sensitivity, can detect 1 coccidiosis oocyst/μL, and has no cross-reaction, good repeatability, and is suitable for the diagnosis and vaccine development of coccidiosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119391887B_ABST
    Figure CN119391887B_ABST
Patent Text Reader

Abstract

The present invention discloses primers, kits and detection methods for seven-fold detection of chicken coccidia based on the RAA-CRISPR / Cas12a technology, belonging to the technical field of chicken coccidia detection. The RAA primers for seven-fold detection of chicken coccidia based on the RAA-CRISPR / Cas12a technology of the present invention include an upstream primer F3 and a downstream primer R2, which can achieve multiplex RAA amplification of Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria necatrix, Eimeria mitis, Eimeria praecox and Eimeria brunetti. The amplification products can be used for CRISPR / Cas12a reactions, and specific sequences of crRNA are used to achieve immediate detection and visual detection of various chicken coccidia.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of chicken coccidia detection, in particular to primers, kits and detection methods for detecting chicken coccidia by 7 - fold based on the RAA - CRISPR / Cas12a technology. Background Art

[0002] Chicken coccidiosis is a parasitic protozoal disease of chickens caused by mixed infection of one or several species of Eimeria, which causes huge economic losses to the global chicken farming industry. Currently, there are 7 recognized species of chicken coccidia in the world, namely Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria necatrix, Eimeria mitis, Eimeria precocious and Eimeria brunetti. Under natural conditions, chicken coccidia often infect in a mixed form of 2 or more species. Each Eimeria species has site and host specificity and causes different degrees of intestinal diseases. The accurate identification of chicken coccidia species is of great significance for the diagnosis and prevention of coccidiosis.

[0003] Currently, the traditional and classical method for identifying chicken coccidia species uses characteristics such as the morphological size of oocysts, latent period, parasitic intestinal segments, and intestinal lesions as identification indicators. However, this method requires steps such as single - oocyst purification of coccidia, propagation, observation and determination of parasitic sites and damaged sites, which takes about more than 1 month. It mainly relies on visual identification by humans, not only with a large workload but also greatly affected by the experience and professional level of staff. The traditional method for identifying chicken coccidia species is mainly based on pathogenic biological characteristics, which is cumbersome, time - consuming and laborious in specific implementation. In recent years, gene - editing technology has developed rapidly. Based on the cleavage characteristics of Cas12a, the combination of PCR technology, RPA technology with CRISPR / Cas12a and fluorescence probe technology contributes to the development of pathogen visualization detection technology. Therefore, it is an urgent problem for those skilled in the art to establish a set of rapid, specific, sensitive, simple, low - cost and visual 7 - fold rapid detection kits and methods for chicken coccidia in the clinical diagnosis of chicken coccidia and vaccine production, so as to provide a basis for the prevention, control, epidemiological investigation of chicken coccidiosis and the development of coccidia vaccines. Summary of the Invention

[0004] The purpose of the present invention is to provide primers, kits and detection methods for detecting chicken coccidia by 7 - fold based on the RAA - CRISPR / Cas12a technology to solve the problems existing in the above - mentioned prior art.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides RAA primers for 7-fold detection of chicken coccidia based on the RAA-CRISPR / Cas12a technology. The primers include an upstream primer F3 as shown in SEQ ID NO.10 and a downstream primer R2 as shown in SEQ ID NO.12;

[0007] The chicken coccidia include Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria necatrix, Eimeria mitis, Eimeria praecox, and Eimeria brunetti.

[0008] The present invention also provides the application of the above RAA primers in the preparation of a kit for 7-fold detection of chicken coccidia based on the RAA-CRISPR / Cas12a technology.

[0009] The present invention also provides a kit for 7-fold detection of chicken coccidia based on the RAA-CRISPR / Cas12a technology. The kit includes the above RAA primers, crRNA, Cas12a protein, and ssDNA;

[0010] The chicken coccidia include any one of Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria necatrix, Eimeria mitis, Eimeria praecox, and Eimeria brunetti.

[0011] Preferably, when the chicken coccidia is Eimeria tenella, the nucleotide sequence of the crRNA is as shown in SEQ ID NO.14; when the chicken coccidia is Eimeria maxima, the nucleotide sequence of the crRNA is as shown in SEQ ID NO.15; when the chicken coccidia is Eimeria acervulina, the nucleotide sequence of the crRNA is as shown in SEQ ID NO.16; when the chicken coccidia is Eimeria necatrix, the nucleotide sequence of the crRNA is as shown in SEQ ID NO.17; when the chicken coccidia is Eimeria mitis, the nucleotide sequence of the crRNA is as shown in SEQ ID NO.18; when the chicken coccidia is Eimeria praecox, the nucleotide sequence of the crRNA is as shown in SEQ ID NO.19; when the chicken coccidia is Eimeria brunetti, the nucleotide sequence of the crRNA is as shown in SEQ ID NO.20.

[0012] Preferably, the nucleotide sequence of the ssDNA is 5'-FAM-TTATT-BHQI-3'.

[0013] Preferably, the kit further includes A Buffer, B Buffer, ddH2O, 10×NEBuffer 2.1, and RNase-free H2O.

[0014] The present invention also provides a method for detecting 7 species of Eimeria in chickens for non-diagnostic and / or non-therapeutic purposes, comprising the following steps:

[0015] (1) Extract the DNA template of Eimeria oocysts from the fecal sample to be tested;

[0016] (2) Using the RAA primers in the above kit, with the DNA of Eimeria oocysts as the template, perform RAA amplification reaction to obtain an amplification product;

[0017] (3) Using the amplification product as the template, perform CRISPR / Cas12a reaction with the above kit to obtain a reaction product; if the reaction product shows green fluorescence, it is determined that the fecal sample to be tested contains the corresponding type of Eimeria of crRNA, or, if the fluorescence value of the reaction product ≥ 1390, it is determined that the fecal sample to be tested contains the corresponding type of Eimeria of crRNA.

[0018] Preferably, the reaction system of the RAA amplification reaction includes: 12.5 μL A Buffer, 1 μL 10 μmol / L upstream primer F3, 1 μL 10 μmol / L downstream primer R2, 1 μL template, 1.25 μL B Buffer, 8.25 μL ddH2O;

[0019] The temperature of the RAA amplification reaction is 40 °C and the time is 30 min.

[0020] Preferably, the reaction system of the CRISPR / Cas12a reaction includes: 2.5 μL 10×NEBuffer 2.1, 2 μL amplification product, 1 μL 1 μmol / L crRNA, 2.0 - 4.0 μL 1 μmol / L Cas12a protein, 2.0 - 4.0 μL 10 μmol / L ssDNA, supplemented with RNase-free H2O to 20 μL;

[0021] The temperature of the CRISPR / Cas12a reaction is 37 °C and the time is 60 min.

[0022] Preferably, in the reaction system of the CRISPR / Cas12a reaction, when the crRNA is SEQ ID NO.14, SEQ ID NO.16 or SEQ ID NO.18, the volume of Cas12a protein is 2.0 μL and the volume of ssDNA is 2.0 μL;

[0023] When the crRNA is SEQ ID NO.15, SEQ ID NO.17 or SEQ ID NO.20, the volume of Cas12a protein is 3.0 μL and the volume of ssDNA is 2.0 μL;

[0024] When the crRNA is SEQ ID NO.19, the volume of Cas12a protein is 4.0 μL and the volume of ssDNA is 4.0 μL.

[0025] The present invention discloses the following technical effects:

[0026] The present invention designs a pair of universal RAA amplification primers for Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria necatrix, Eimeria mitis, Eimeria praecox and Eimeria brunetti. The target fragment is amplified through a multiplex RAA amplification system and can be used for subsequent CRISPR / Cas12a reaction. Then, using the specific crRNA designed by the present invention, 7 kinds of chicken coccidia can be distinguished and judged, realizing the instant detection and visual detection of multiple chicken coccidia.

[0027] The detection method of the present invention has a sensitivity of up to 1 oocyst / μL for Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria necatrix, Eimeria mitis, Eimeria praecox, and a sensitivity of up to 1 copy / μL of plasmid DNA, that is, 1 oocyst / μL for Eimeria brunetti. It has no cross-reaction with pathogenic bacteria such as Escherichia coli and Salmonella, has good clinical detection effect, high repeatability, and simple operation. It provides technical guidance for the clinical diagnosis and treatment of chicken coccidiosis, and lays a foundation for the prevention, control, epidemiological investigation of chicken coccidiosis and the development of coccidia vaccines. Description of the Drawings

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0029] Figure 1 It is the analysis result of the 1-443bp gene sequence of 18S rDNA of Eimeria gallinarum;

[0030] Figure 2 It is the RAA amplification result of different primer combinations;

[0031] Figure 3 It is the gel electrophoresis result of RAA products of 7 kinds of chicken coccidia;

[0032] Figure 4 Visual results of the RAA-CRISPR / Cas12a reaction products for 7 chicken coccidia samples

[0033] Figure 5 Screening results of the Cas12a / crRNA concentration ratio for the RAA-CRISPR / Cas12a 7-plex rapid detection system for chicken coccidia

[0034] Figure 6 Screening results of the ssDNA concentration for the RAA-CRISPR / Cas12a 7-plex detection system for chicken coccidia

[0035] Figure 7 Fluorescence value detection results of the specificity for the RAA-CRISPR / Cas12a 7-plex detection system for chicken coccidia

[0036] Figure 8 Specificity visualization results for the RAA-CRISPR / Cas12a 7-plex detection system for chicken coccidia

[0037] Figure 9 Fluorescence value detection results of the sensitivity determination for the RAA-CRISPR / Cas12a 7-plex detection system for chicken coccidia

[0038] Figure 10 Sensitivity determination visualization results for the RAA-CRISPR / Cas12a 7-plex detection system for chicken coccidia

[0039] Figure 11 Visualization results of the clinical validation test for the RAA-CRISPR / Cas12a 7-plex detection system for chicken coccidia

[0040] Figure 12 Fluorescence value detection results of the clinical validation test for the RAA-CRISPR / Cas12a 7-plex detection system for chicken coccidia Detailed implementation manners

[0041] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0042] Example 1 Design and synthesis of RAA universal primers and specific crRNAs for 7 coccidia

[0043] 1. Selection of gene sequences

[0044] Select the 18S rDNA that is conserved within and specific between all 7 species of Eimeria in chickens published in GenBank of NCBI. The GenBank accession numbers of E. tenella (Eimeria tenella) are U40264, KT184354, and EU025113 respectively; those of E. acervulina (Eimeria acervulina) are U67115, EF210324, and DQ538351 respectively; those of E. brunetti (Eimeria brunetti) are U67116 and KT184337 respectively; those of E. necatrix (Eimeria necatrix) are DQ136185, U67119, and KT184349 respectively; those of E. praecox (Eimeria precocious) are U67120, KT184352, and FJ236365 respectively; those of E. mitis (Eimeria mitis) are U40262, FR775302, and FR775303 respectively; those of E. maxima (Eimeria maxima) are U67117, FJ236361, and FJ236360.1 respectively. These are used as characteristic target genes, and sequence multiple alignment is performed according to the corresponding parameters through the Clustal W program in MEGA11. Sequences that include both the sequences common to the 7 species of chicken coccidia and the sequences specific to each of the 7 species of chicken coccidia are found from the 18S rDNA sequences. The results are as follows:

[0045] The 1 - 443bp sequence of the 18S rDNA of chicken coccidia includes both the sequences common to the 7 species of coccidia and the sequences specific to each of the 7 species of coccidia. Among them, 1 - 48bp, 50 - 108bp, and 280 - 443bp are the sequences common to the 7 species of coccidia and are used as reference sequences for designing universal primers for the 7 species of coccidia; 200 - 270bp includes the sequences that are conserved within and specific between the 7 species of coccidia. For details, see Figure 1 。In addition, the sequences specific between the 7 species of chicken coccidia are all verified to be specific by NCBI, so they can be used as target sequences for designing specific crRNAs for the 7 species of chicken coccidia.

[0046] 2. Design of universal primers for RAA of 7 species of Eimeria in chickens

[0047] According to the RAA primer design principle and based on the crRNA binding site, 3 pairs of RAA universal primers for amplifying the 18S rDNA gene (about 250 bp) of 7 Eimeria species in chickens were designed using Primer5.0 software. The primer sequences are shown in Table 1 and were synthesized by Shanghai Sangon Biotech Co., Ltd. Among them, the amplification target sequences of the 7 Eimeria species in chickens are as follows:

[0048] Target sequence of Eimeria tenella: (5'-3')

[0049] AATGGCTCATTAAAACAGTTATAGTTTATTTGATGGTCTCATTTTACATGGATAACCAT

[0050] GGTAATTCTATGGCTAATACATGCGCAAAGGTCACCTCCTTTGGAGGGGCTGTGTTTATT

[0051] AGATACAAAACCAACCCACTTTGTAGTGGAGTCTTGGTGATTCATAGTAACCGAACGGA

[0052] TCGCAGTTGGTTCTTTTGGGCCCGCGATGGATCATTCAAGTTTCTGACCTATCAGCTTTC

[0053] GACGGTAG (SEQ ID NO.1);

[0054] Target sequence of Eimeria maxima: (5'-3')

[0055] AATGGCTCATTAAAACAGTTATAGTTTATTTGATGGTCTTTTTTACATGGATAACCATGGTAATTCTATGGCTAATACATGCGCAAAAGCTACCTTCTTTGGAGGAGCTGTGTTTATTAGATACAAAACCAACCCACAATTCTTGTGGAGTCTTGGTGATTCATAGTAACCGAACGGATCGCAGTTGGCTTTCGGGCCCGCGATGGATCATTCAAGTTTCTGACCTATCAGCTTTCGACGGTAG (SEQ ID NO.2);

[0056] Target sequence of Eimeria acervulina: (5'-3')

[0057] AATGGCTCATTAAAACAGTTATAGTTTATTTGATGGTCTCTTTTACATGGATAACCATGGTAATTCTATGGCTAATACATGCGCAAGGGCCTCCTCCTCTGGAGGGGCTGTGTTTATTAGATACAAAACCAACCCACCTTGTGTGGAGTCTTGGTGATTCATAGTAACCGAACGGATCGCAGTTGGCTTTCGGGCCCGCGATGGATCATTCAAGTTTCTGACCTATCAGCTTTCGACGGTAG(SEQ ID NO.3);

[0058] Target sequence of Eimeria necatrix: (5'-3')

[0059] AATGGCTCATTAAAACAGTTATAGTTTATTTGATGGTCTCATTTTACATGGATAACCATGGTAATTCTATGGCTAATACATGCGCAAAGGTCACCTCCTTTGGAGGGGCTGTGTTTATTAGATACAAAACCAACCCACTTAACGGTGGAGCCTTGGTGATTCATAGTAACCGAACGGATCGCAGTTGGTTCTTTTGGACCCGCGATGGATCATTCAAGTTTCTGACCTATCAGCTTTCGACGGTAG(SEQ ID NO.4);

[0060] Target sequence of Eimeria mitis: (5'-3')

[0061] AATGGCTCATTAAAACAGTTATAGTTTATTTGATGGTCTTTTTTACATGGATAACCATGGTAATTCTATGGCTAATACATGCGCATAGGCCTCCTCCTCTGGAGGGGCTGTGTTTATTAGATACAAAACCAACCCACTTTGTGGAGCCTTGGTGATTCATAGTAACCGAACGGATCGCAGTTGGCTTTCGGGCCCGCGATGGATCATTCAAGTTTCTGACCTATCAGCTTTCGACGGTAG(SEQ ID NO.5);

[0062] Target sequence of Eimeria praecox: (5'-3')

[0063] AATGGCTCATTAAAACAGTTATAGTTTATTTGATGGTCTTTTTTACATGGATAACCATGGTAATTCTATGGCTAATACATGCGCAAAAGCTACCTTCTCTGGAGGGGCTGTGTTTATTAGATACAAAACCAACCCACTTTTGTGGAGTCATGGTGATTCATAGTAACCGAACGGATCGCAGTTGGCTTTCGGGCCCGCGATGGATCATTCAAGTTTCTGACCTATCAGCTTTCGACGGTAG(SEQ ID NO.6);

[0064] Eimeria brunetti target sequence: (5'-3')

[0065] AATGGCTCATTAAAACAGTTATAGTTTATTTGATGGTCATTTTTACATGGATAACCATGGTAATTCTATGGCTAATACATGCGCATAGGCTTCCTTCTTTGAAGGGGCTGTGTTTATTAGATACAAAACCAACCCACCTTGTGGAGTCTTGGTGATTCATAGTAACCGAACGGATCGCAGTTGGCTTTCGGGCCCGCGATGGATCATTCAAGTTTCTGACCTATCAGCTTTCGACGGTAG(SEQ ID NO.7).

[0066] Table 1 RAA primer sequence information

[0067] Primer Name Sequence(5'->3') Primer length F1 CTTTTATACGGTGAAACTGCGAATGGCTCA(SEQ ID NO.8) 35 F2 GGTGAAACTGCGAATGGCTCATTAAAACAG(SEQ ID NO.9) 35 F3 AATGGCTCATTAAAACAGTTATAGTTTATT(SEQ ID NO.10) 32 R1 CCAATACCCTACCGTCGAAAGCTGATAG(SEQ ID NO.11) 32 R2 CTACCGTCGAAAGCTGATAGGTCAGAAACT(SEQ ID NO.12) 30 R3 GAAAGCTGATAGGTCAGAAACTTGAATGAT(SEQ ID NO.13) 30

[0068] 3. Design of 7 Eimeria-specific crRNAs

[0069] Based on the 7 sequences that are conserved within species and specific between species of the above-screened coccidia, the CRISPOR design website http: / / crispor.gi.ucsc.edu / was used to design crRNAs for the 7 coccidia-specific gene sequences. The crRNA sequences are shown in Table 2 and were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0070] Table 2 Coccidia-specific crRNA sequences

[0071]

[0072] Note: The underlined sequences are the stem-loop structures essential for Cas12a to recognize crRNAs.

[0073] Example 2 Establishment of the RAA amplification reaction system for chicken coccidia and screening of the best primers

[0074] 1. Experimental method

[0075] 1.1 DNA extraction

[0076] 1.1.1 Fecal chicken coccidia oocyst samples

[0077] Take 1 g of fresh fecal sample into a centrifuge tube, add 5 mL of saturated saline to each tube of feces, mix well, centrifuge at 1200 r / min for 5 min, transfer the supernatant to a new centrifuge tube, add ten-fold amount of ddH2O and mix well, centrifuge at 2500 r / min for 10 min, and take the precipitate. Add 100 μL of coccidia lysis solution (5% chicken bile, 0.375% trypsin, 1% TritonX-100, and 10 mol / L EDTA) and 0.15 g of glass beads with a diameter of 0.05 mm to the oocyst precipitate, shake on a shaker at 200 r / min for 45 min; then add 5 μL of 0.25 mol / L NaOH, immediately invert the tube up and down to mix well, and let it stand for digestion for 2 min; then add 10 μL of 0.25 mol / L acetic acid, immediately invert the tube up and down to mix well, and centrifuge briefly; add 1 μL of proteinase k, shake and mix well, digest in a water bath at 60 °C for 20 min (shake it once every 5 min), boil for 2 min, and ice-bath for 5 min. Transfer the supernatant to a new PCR tube, centrifuge briefly for 60 s, and take the supernatant to obtain the DNA template.

[0078] 1.1.2 Purified chicken coccidia oocyst samples

[0079] Purified oocysts + coccidia lysis solution + 0.15 g of 0.5 mm glass beads → shake on a shaker at 200 r / min for 45 min + 5 μL of 0.25 mol / L NaOH → mix well and let it stand for digestion for 2 min + 10 μL of 0.25 mol / L acetic acid (immediately invert the tube up and down to mix well, and centrifuge briefly) + 1 μL of proteinase k → digest in a water bath at 60 °C for 20 min → boil for 2 min → ice-bath for 5 min → transfer the supernatant to another centrifuge tube → centrifuge briefly for 60 s, and take the supernatant as the DNA sample for standby.

[0080] 1.1.3 Preparation of E. brunetti recombinant plasmid DNA template

[0081] 1.1.3.1 Construction of E. brunetti recombinant plasmid

[0082] Select the target gene sequence (431bp) that is conserved within the species and specific between species from the Eb18S rDNA gene (accession number: U67116) in GeneBank, entrust Sangon Biotech (Shanghai) Co., Ltd. to synthesize it, and ligate it into the pUC57 cloning vector to construct the E. brunetti recombinant plasmid. Transfer the E. brunetti recombinant plasmid into E. coli DH5α to obtain the E. brunetti recombinant plasmid bacteria.

[0083] 1.1.3.2 Extraction of E. brunetti Recombinant Plasmid DNA

[0084] Extract the plasmid according to the instructions of the plasmid DNA miniprep kit (TAKARA).

[0085] 1.1.3.3 Identification of E. brunetti Recombinant Plasmid

[0086] Activate the E. brunetti recombinant plasmid bacteria by the methods of streak plating and bacterial liquid amplification, send them to Sangon Biotech for sequencing, and verify whether the synthesized sequence is correct.

[0087] 1.2 Screening of the Optimal Primers for the RAA Amplification Technique

[0088] Combine the 3 pairs of universal primers in Table 1 in pairs respectively, use the reagents (A Buffer, B Buffer, reaction dry powder) in the basic type crowd-sourced RAA nucleic acid amplification reagent kit (Hangzhou Crowd-sourced Biotechnology Co., Ltd.) to perform RAA amplification and gel electrophoresis on the Eimeria tenella template, observe the electrophoresis results of each primer combination, screen out the optimal primers, and the grouping details are shown in Table 3. The reaction system, reaction program and gel electrophoresis are as follows.

[0089] (1) According to the number of reactions, prepare a reaction system containing 8.25 μL of water, 12.5 μL of A Buffer, 1 μL of upstream primer (10 μmol / L), 1 μL of downstream primer (10 μmol / L) for each reaction system. After mixing evenly, add it to the detection unit tube containing the reaction dry powder;

[0090] (2) Add 1 μL of the DNA sample to be tested to the detection unit tube;

[0091] (3) Then add 1.25 μL of B Buffer to the lid of the detection unit tube, cover the tube lid, invert it up and down, gently flick it 5 - 6 times to mix well, and centrifuge at low speed for 10 s; place the detection unit tube in a 39°C constant temperature metal bath and incubate for 30 min.

[0092] (4) After the reaction, add 25 μL of DNA extraction solution (phenol:chloroform:isoamyl alcohol 25:24:1) to the detection unit tube, mix well thoroughly, centrifuge at 12000 r / min for 5 min, and take the supernatant for electrophoresis.

[0093] (5) Agarose gel electrophoresis: Load the sample onto a 1.2% agarose gel, pipette 1.25 μL of 5× Loading Dye and 5 μL of the RAA product, and at the same time set a well for Marker (5.0 μL) as a control. Electrophorese at a constant voltage of 120 V for 30 min, and immediately image on a gel analysis system to observe whether the target band appears.

[0094] Table 3 Grouping and treatment

[0095]

[0096] 1.3 Sequencing of RAA products

[0097] The RAA amplification products of the best primers were sent to BGI in Beijing for sequencing. The sequencing results were used to perform a homology comparison between the RAA products and the target sequences using the NCBI BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) function.

[0098] 1.4 Verification of the feasibility of 7 coccidia RAA universal primers

[0099] The screened best RAA universal primers were used to perform RAA amplification on the oocyst DNA templates of Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria mitis, Eimeria praecox, and Eimeria brunetti prepared according to the method in item 1.1.2. The preparation of the RAA reaction system, the reaction procedure, and agarose gel electrophoresis were carried out according to item 1.2.

[0100] 2. Experimental results

[0101] 2.1 Construction and identification of E. brunetti recombinant plasmid

[0102] The sequencing results were verified by NCBI BLAST. The results showed that the sequencing results of the E. brunetti recombinant plasmid had 100% similarity with U67116.1. Therefore, the E. brunetti recombinant plasmid was successfully constructed.

[0103] 2.2 Screening of the best primers for RAA amplification technology

[0104] The results were as Figure 2 shown. The RAA product yields of the primer groups F2 / R3 and F3 / R2 were the largest, but non-specific bands appeared in F2 / R3. Therefore, the primer group F3 / R2 was selected as the universal primer for 7 coccidia RAA amplification technology.

[0105] 2.3 Sequencing and Identification of RAA Products

[0106] After sequencing, the sequencing results of the RAA products of Eimeria tenella were consistent with SEQ ID NO.1, indicating that the target sequence (about 250bp) of the 18S rDNA gene of Eimeria tenella could be accurately amplified using the F3 / R2 primer set, reaction system, and reaction program. This preliminarily verified that the primer could be used for the RAA amplification reaction of Eimeria tenella.

[0107] 2.4 Feasibility Verification of RAA Universal Primers for 7 Species of Coccidia

[0108] 2.4.1 Gel Electrophoresis Identification of RAA Products

[0109] The results were as Figure 3 shown. Target bands appeared at around 250bp in the gel electrophoresis of single RAA products of E.tenella, E.maxima, E.acervulina, E.necatrix, E.praecox, E.brunetti, and E.mitis, and no non-target bands were amplified. This indicates that the target sequence (about 250bp) of the 18S rDNA gene of 7 species of Eimeria gallinarum could be accurately amplified using the F3 / R2 primer set, reaction system, and reaction program.

[0110] 2.4.2 Sequencing and Identification of RAA Products

[0111] The RAA products of 7 species of chicken coccidia were sequenced by BGI Genomics Co., Ltd., and the sequencing results were consistent with SEQ ID NO.1 - 7. The results showed that the F3 / R2 primer set, reaction system, and reaction program could accurately amplify the target sequence (about 250bp) of the 18S rDNA gene of 7 species of Eimeria gallinarum, and the primer and the RAA amplification reaction system for chicken coccidia were feasible.

[0112] Example 3 Preliminary Construction of a RAA-CRISPR / Cas12a 7-Fold Rapid Detection System for Chicken Coccidia

[0113] 1. Experimental Method

[0114] 1.1 Preliminary Establishment of a RAA-CRISPR / Cas12a 7-Fold Rapid Detection System for Chicken Coccidia

[0115] According to the trans-cleavage principle of Casl2a, a RAA-CRISPR-Cas12a detection system was established. The specific steps are as follows:

[0116] (1) RAA Amplification of DNA Template

[0117] By optimizing the RAA amplification reaction system, the optimal RAA reaction system and reaction procedure recorded in Table 4 were obtained. Seven Eimeria gallinarum oocyst DNAs prepared according to the method described in item 1.1.2 of Example 2 were subjected to RAA amplification according to Table 4.

[0118] Table 4 RAA Amplification System and Conditions

[0119]

[0120]

[0121] (2) Preparation of CRISPR-Cas12a Reaction System and Reaction Procedure

[0122] Two sets of CRISPR-Cas12a reaction systems were prepared according to Table 5. One set was for samples (7 tubes), and the other set was for negative controls (7 tubes). The crRNAs of the 7 species of coccidia in Table 2 were added to the crRNAs respectively. The grouping details are shown in Table 6, and the reaction was carried out according to the reaction procedure in Table 5. Among them, the sequence of ssDNA was: 5'-FAM-TTATT-BHQI-3'.

[0123] Table 5 CRISPR-Cas12a Reaction System and Conditions

[0124]

[0125] Table 6 Grouping for Establishing CRISPR-Cas12a Reaction System

[0126] Group DNA Template crRNA Group DNA Template crRNA ET1 E.tenella ET1 TN — ET1 EM1 E.maxima EM1 MN — EM1 EA1 E.acervulina EA1 AN — EA1 EN1 E.necatrix EN1 NN — EN1 EI1 E.mitis EI1 IN — EI1 EP1 E.praecox EP1 PN — EP1 EB1 E.brunetti EB1 BN — EB1

[0127] (3) Fluorescent Visualization Result Judgment: Place each tube of the CRISPR / Cas12a reaction end product under the ultraviolet lamp (254 nm) of the gel imaging analysis system to observe and take pictures. If green fluorescence is visible to the naked eye, it is positive, and the tube contains the coccidia corresponding to the crRNA contained.

[0128] 1.2 Determination of Fluorescence Values and Positive Judgment Criteria for RAA-CRISPR / Cas12a 7-Fold Detection of Chicken Coccidia Samples

[0129] There are certain differences in the naked-eye observations of different observers, and qualitative errors are likely to occur in the critical value results. Take 3 tubes of the CRISPR / Cas12a reaction products of E. mitis and perform 2-fold serial dilutions to 2 -7 , read the fluorescence values with a fluorescence quantitative PCR instrument, and at the same time, irradiate them with a ultraviolet lamp (254 nm) of the gel image analysis system by 3 people respectively for observation, and repeat three times. Select the average value and standard deviation of the fluorescence values of the samples with the lowest concentration with visible fluorescence to the naked eye as the positive judgment criteria.

[0130] 2. Test Results

[0131] 2.1 Preliminary establishment results of the RAA-CRISPR / Cas12a 7-plex detection system for chicken coccidia

[0132] The final reaction products of RAA-CRISPR / Cas12a for 7 chicken coccidia samples all emitted green fluorescence signals of different intensities, which were visible to the naked eye, while the negative controls (TN, MN, AN, NN, IN, PN, BN) had no visible fluorescence signals to the naked eye. See Figure 4 , indicating the preliminary establishment of the chicken coccidia RAA-CRISPR-Cas12a detection system.

[0133] 2.2 Determination of fluorescence values of chicken coccidia samples and positive judgment criteria

[0134] Three people observed the final reaction products of RAA-CRISPR / Cas12a under ultraviolet light with the naked eye. The lowest fluorescence value of the samples with visible fluorescence was 1000 - 1588, with an average of 1261. See Table 7. The judgment criteria for the fluorescence value detection results of the RAA-CRISPR / Cas12a reaction products should be the average value of the lowest fluorescence value of the reaction products of positive samples (obvious green fluorescence visible to the naked eye) and the standard error (SE), that is, the fluorescence value of the sample If obvious green fluorescence is visible to the naked eye, it is judged as positive, otherwise it is judged as negative. After calculation, it is obtained that: with the fluorescence value (FI) of 1390 of the sample as the judgment criterion, that is, FI≥1390, it is judged as positive.

[0135] Table 7 Comparison of fluorescence values of critical samples of 7 coccidia detected by RAA-CRISPR / Cas12a and results of naked-eye observation

[0136]

[0137] Example 4 Optimization of the RAA-CRISPR / Cas12a 7-plex rapid detection system for chicken coccidia

[0138] 1. Test method

[0139] 1.1 Screening of the Cas12a / crRNA concentration ratio

[0140] Perform RAA amplification on the DNA of 7 species of Eimeria tenella according to the RAA amplification reaction system recorded in Table 4. According to the RAA-CRISPR / Cas12a detection system established in Example 3, with the crRNA concentration of various coccidia in the system being 50 nmol / L, set the Cas12a concentrations to 0, 25, 50, 100, 150, and 200 nmol / L respectively, that is, design 6 groups of different Cas12a:crRNA ratios (0:1, 0.5:1, 1:1, 2:1, 3:1, 4:1) to prepare the CRISPR / Cas12a reaction system. Select to observe the FAM fluorescence intensity in a fluorescence quantitative PCR instrument, and react at 37 °C for 60 min. Select the Cas12a and crRNA concentration ratio with the highest fluorescence value.

[0141] 1.2 Screening of ssDNA concentration

[0142] Perform RAA amplification on the oocyst DNA of 7 species of Eimeria tenella according to the RAA amplification reaction system recorded in Table 4. According to the optimal Cas12a and crRNA concentration ratio screened in item 1.1 of this example, select ssDNA with final concentrations of 125, 250, 500, 1000, and 2000 nmol / L to prepare the CRISPR / Cas12a reaction systems for 6 species of coccidia, namely E. tenella, E. maxima, E. acervulina, E. necatrix, E. mitis, and E. brunetti respectively. At the same time, select ssDNA with final concentrations of 250, 500, 1000, 2000, and 4000 nmol / L to prepare the CRISPR / Cas12a reaction system for E. praecox. Select to observe the FAM fluorescence intensity in a fluorescence quantitative PCR instrument, and react at 37 °C for 60 min, detect the fluorescence value, and select the optimal ssDNA reporter gene concentration.

[0143] 2. Test results

[0144] 2.1 Screening of Cas12a / crRNA concentration ratio

[0145] The concentration of crRNA was 50 nmol / L. The fluorescence values of the products in each group increased with the increase in the concentration of Cas12a. When the ratio of Cas12a / crRNA in the CRISPR / Cas12a reaction system of E. tenella was 2:1, the fluorescence value of the product (14249.2223 ± 1279.4518 AU) was significantly higher than that of the 1:1 group (2956.4727 ± 496.52442 AU) (P < 0.05). When the ratio of Cas12a / crRNA ≥ 3:1, the fluorescence values of each group were not significantly different from those of the 2:1 group (P > 0.05). In the CRISPR / Cas12a reaction system of E. maxima, when the ratio of Cas12a / crRNA was 3:1, the fluorescence value of the product (17927.71100 ± 565.803264 AU) was significantly higher than that of the 2:1 group (16202.15200 ± 577.350269 AU) (P < 0.05). When the ratio of Cas12a / crRNA increased to 4:1, the fluorescence value of the group was not significantly different from that of the 3:1 group (P > 0.05). In the CRISPR / Cas12a reaction system of E. acervulina, when the ratio of Cas12a / crRNA was 2:1, the fluorescence value of the product (18647.3130 ± 823.30148 AU) was significantly higher than that of the 1:1 group (16653.4330 ± 224.58925 AU) (P < 0.05). When the ratio of Cas12a / crRNA ≥ 3:1, the fluorescence values of each group were not significantly different from those of the 2:1 group (P > 0.05). In the CRISPR / Cas12a reaction system of E. necatrix, when the ratio of Cas12a / crRNA was 3:1, the fluorescence value of the product (20929.1780 ± 986.69161 AU) was significantly higher than that of the 2:1 group (16956.6310 ± 582.54642 AU) (P < 0.05). When the ratio of Cas12a / crRNA increased to 4:1, the fluorescence value of the group was not significantly different from that of the 3:1 group (P > 0.05). In the CRISPR / Cas12a reaction system of E. mitis, the fluorescence value was the highest when the ratio of Cas12a / crRNA was 4:1. There was no significant difference in the fluorescence values among the 2:1 group, 3:1 group, and 4:1 group (P > 0.05), but they were all significantly higher than those of the 1:2 group (P < 0.05). In the CRISPR / Cas12a reaction system of E. praecox, when the ratio of Cas12a / crRNA was 4:1, the fluorescence value of the product was the highest and significantly higher than those of the 1:1 group, 2:1 group, and 3:1 group (P < 0.05). In the CRISPR / Cas12a reaction system of E. brunetti, when the ratio of Cas12a / crRNA was 3:1, the fluorescence value of the product (17141.58200 ± 269.The fluorescence value of the 622576AU) was significantly higher than that of the 2:1 group (15534.30200 ± 339.481958) (P < 0.05). There was no significant difference in the fluorescence values between the 3:1 group and the 4:1 group (P > 0.05). For details, see Figure 5 . Therefore, when the crRNA concentration was 50 nmol / L, 100 nmol / L of Cas12a protein was selected for E. tenella, E. acervulina, and E. mitis, 150 nmol / L of Cas12a protein was selected for E. maxima, E. necatrix, and E. brunetti, and 200 nmol / L of Cas12a protein was selected for E. praecox. The fluorescence value of the product of the CRISPR / Cas12a reaction system was the highest. Therefore, it was the optimal concentration ratio of Cas12a / crRNA.

[0146] 2.2 Screening of ssDNA concentration

[0147] The fluorescence values of the products of the CRISPR / Cas12a reaction system for 7 species of chicken coccidia all increased with the increase in the concentration of the ssDNA reporter gene. For the groups with the ssDNA reporter gene concentration ≥ 1000 nmol / L in the CRISPR / Cas12a reaction systems of E. tenella, E. maxima, E. acervulina, E. necatrix, E. mitis, and E. brunetti, there was no significant difference in the fluorescence values among different concentrations within the group (P > 0.05), but they were all significantly higher than the fluorescence values of the groups with the ssDNA reporter gene concentration < 1000 nmol / L (P < 0.05). For the groups with the ssDNA reporter gene concentration ≥ 2000 nmol / L in the CRISPR / Cas12a reaction system of E. praecox, there was no significant difference in the fluorescence values among different concentrations within the group (P > 0.05), but they were all significantly higher than the fluorescence values of the groups with the ssDNA reporter gene concentration < 2000 nmol / L (P < 0.05). For details, see Figure 6 . Therefore, the optimal ssDNA reporter gene concentration for the CRISPR / Cas12a reaction systems of E. tenella, E. maxima, E. acervulina, E. necatrix, E. mitis, and E. brunetti was 1000 nmol / L, and the optimal ssDNA reporter gene concentration for E. praecox was 2000 nmol / L.

[0148] Example 5 Specificity verification of the RAA-CRISPR / Cas12a 7-fold rapid detection system for chicken coccidia

[0149] 1. Test method

[0150] To determine whether the established RAA-CRISPR / Cas12a 7-plex rapid detection method of the present invention has cross-reactivity among 7 species of chicken coccidia or with other common chicken intestinal pathogens, DNA of 7 species of Eimeria chicken oocysts was prepared according to the method described in item 1.1.2 of Example 2. RAA amplification of DNA templates of 7 species of chicken coccidia was performed according to the reaction system and reaction program shown in Table 4, and CRISPR / Cas12a detection of the genomic DNA of 7 species of chicken coccidia, Escherichia coli, Salmonella, and three negative stool (Negative stool 1-3) samples was carried out respectively using the crRNAs of 7 species of chicken coccidia according to the reaction system and reaction program shown in Table 9. See Table 8 for details. Its specificity was verified, and ddH2O was set as a negative control. The fluorescence value was measured using a fluorescence quantitative PCR instrument, and the fluorescence of each group of products was observed and photographed under ultraviolet light of a gel imager to determine whether the established detection method is specific and whether there is cross-reactivity with related species.

[0151] Table 8 Grouping of RAA-CRISPR / Cas12a Specificity Verification Test

[0152]

[0153] Table 9 Preparation of CRISPR / Cas12a Reaction System and Reaction Conditions (μL)

[0154]

[0155] 2. Test Results

[0156] The fluorescence values of each group of chicken coccidia samples corresponding to the crRNA groups of E. tenella, E. maxima, E. acervulina, E. necatrix, E. mitis, E. praecox, and E. brunetti were all > 1390, and were significantly higher than those of the negative control (P < 0.05). The fluorescence values of the remaining groups were all < 1390, and there was no significant difference from the negative control (P ≥ 0.05). See Figure 7 for details. Under ultraviolet light, obvious visible fluorescence was emitted by the final reaction products of each worm species sample added with the corresponding crRNA, while no visible fluorescence was observed in other groups. See Figure 8 for details.

[0157] Example 6 Determination of the Sensitivity of the RAA-CRISPR / Cas12a 7-Plex Detection System for Chicken Coccidia

[0158] 1. Test Method

[0159] 1.1 Preparation and Dilution of Chicken Coccidia DNA Template

[0160] According to the method described in item 1.1.2 of Example 2, the oocysts of E. tenella, E. maxima, E. acervulina, E. necatrix, E. mitis, and E. praecox were counted as 10 6 per species for extraction of coccidian oocyst DNA, that is, the number of oocysts corresponding to the DNA was 10 4 per μL. The coccidian DNA extract was serially diluted 10-fold with ddH2O. The number of oocysts corresponding to the DNA at each diluted concentration was 10 3 、10 2 、10 1 、10 0 、10 -1 、10 -2 per μL; The concentration of the recombinant plasmid of E. brunetti was measured using NanoDrop One C and the copy number was calculated. Serial ten-fold dilutions were performed, and the plasmid DNA concentrations were in the range of 10 4 、10 3 、10 2 、10 1 、10 0 、10 -1 、10 -2 copies / μL.

[0161] 1.27 Determination of the sensitivity of the rapid instant detection system for chicken coccidia - Grouping

[0162] Using the DNA templates of E. tenella, E. maxima, E. acervulina, E. necatrix, E. mitis, E. praecox, and the recombinant plasmid of E. brunetti after serial dilution from 10 4 -10 -2 as described in item 1.1 of Example 6, RAA amplification was performed according to the reaction system and reaction procedure in Table 4, and the colorimetric reaction for nucleic acid detection mediated by the CRISPER-Cas12a system was performed according to the reaction system and reaction procedure in Table 9. The fluorescence value in the FAM channel was measured using a fluorescence quantitative PCR instrument, and photographs were taken under ultraviolet light using a gel imager. The lowest DNA concentration or plasmid copy number at which a significant fluorescence signal could be visually observed in each group of experiments was recorded. Each diluted sample was tested in triplicate.

[0163] 2. Test results

[0164] The concentrations of the DNA templates (oocysts) of E. tenella, E. maxima, E. acervulina, E. necatrix, E. mitis, and E. praecox were in the range of 10 4 -10 -2Within the range of [number] / μL, the fluorescence value decreased as the oocyst concentration decreased. The fluorescence values of the DNA template (oocyst) concentration ≥ 10 0 [number] / μL groups were significantly higher than those of the negative control (p < 0.05), and fluorescence (positive) was visible to the naked eye; when the concentration of E. brunetti plasmid DNA was within 10 4 -10 -2 copies / μL, the fluorescence intensity decreased as the DNA concentration (oocyst) decreased. The fluorescence values of the DNA template (oocyst) concentration ≥ 10 0 [number] / μL groups were significantly higher than those of the negative control (p < 0.05), and fluorescence (positive) was visible to the naked eye. See Figure 9 and Figure 10 . The results showed that the RAA-CRISPR / Cas12a 7-plex detection system for chicken coccidia could detect 1 Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria mitis, Eimeria praecox oocyst / μL, and E. brunetti could detect 1 copy / μL of plasmid DNA, that is, 1 Eimeria oocyst / μL.

[0165] Example 7 Repeatability test of the RAA-CRISPR / Cas12a 7-plex detection system for chicken coccidia

[0166] 1. Test method

[0167] Select the strongly positive (10 4 oocysts / μL), weakly positive (10 1 and 10 0 oocysts / μL) Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria mitis, Eimeria praecox, and the positive templates of E. brunetti recombinant plasmid with DNA concentrations of 10 4 , 10 1 and 10 0 copies / μL. Perform 3 batches of 4 RAA amplifications according to the reaction system and reaction procedure in Table 4, and perform the nucleic acid detection color reaction mediated by the CRISPER-Cas12a system according to the reaction system and reaction procedure in Table 9. Use a fluorescence quantitative PCR instrument to measure the fluorescence value in the FAM channel, and observe and photograph under ultraviolet light with a gel imager. Calculate the coefficient of variation to evaluate the repeatability of this method.

[0168] Repeatability evaluation criteria: According to the requirements of the within-run precision in the "Analytical Quality Requirements for Important Routine Items in Clinical Qualitative Immunoassays", the within-run coefficient of variation should be < 10%, and at the same time, it should not be greater than 10% of the within-run CV indicated in the kit instructions; for the between-run precision requirements, the between-run coefficient of variation should be less than 15%.

[0169] 2. Test results

[0170] The within-run coefficients of variation for detecting strongly positive, weakly positive, and negative samples of E. tenella, E. maxima, E. acervulina, E. necatrix, E. mitis, E. praecox, and E. brunetti by the RAA-CRISPR / Cas12a 7-plex rapid detection method for chicken coccidia were all less than 5%, and the between-run coefficients of variation were all less than 10%. It meets the requirements of within-run precision (the within-run coefficient of variation should be < 10%) and between-run precision (the between-run coefficient of variation should be less than 15%) in the "Analytical Quality Requirements for Important Routine Items in Clinical Qualitative Immunoassays". This indicates that the RAA-CRISPR / Cas12a 7-plex detection method for chicken coccidia has good repeatability, as shown in Table 10 for details.

[0171] Table 10 Repeatability test results of RAA-CRISPR / Cas12a for detecting 7 coccidia

[0172]

[0173]

[0174] Example 8 Clinical validation test of the RAA-CRISPR / Cas12a 7-plex detection system for chicken coccidia

[0175] 1. Test method

[0176] Prepare the oocyst DNA of coccidia samples in Table 11 according to the method in item 1.1.2 of Example 2. Conduct RAA amplification according to the reaction system in Table 4 and the reaction program, and conduct the nucleic acid detection color reaction mediated by the CRISPER-Cas12a system according to the reaction system in Table 12 and the reaction program in Table 9. Use a fluorescence quantitative PCR instrument to measure the fluorescence value in the FAM channel, and observe and take pictures under ultraviolet light with a gel imager to detect the species and purity of these chicken coccidia. Result judgment criteria: If the fluorescence value of the reaction product > 1390 or obvious fluorescence is visible to the naked eye under ultraviolet light, it is positive; otherwise, it is negative.

[0177] Table 11 Chicken coccidia samples

[0178]

[0179]

[0180] Table 12 Sample Detection and Control Setting Table

[0181]

[0182] 2. Test Results

[0183] In the reaction products of the corresponding crRNA systems of E. acervulina, E. mitis, E. tenella, E. maxima, E. necatrix, E. brunetti, E. praecox samples and the positive control group, green fluorescence appeared, and the fluorescence values were all > 1390. However, the fluorescence values of the non-corresponding crRNA of the samples and the reaction products of the negative control group were all < 1390, and no visible fluorescence appeared to the naked eye. For details, see Figure 11 and Figure 12 . In summary, the parasite strains of samples Tsx, PTsx, PMsd, PMsx, Msh, Msx, Msd, Asx, PAsx, Nsx, PMisx, Misx, and Prsx were respectively identified as E. maxima, E. acervulina, E. mitis, E. necatrix, and E. praecox species, and they were pure parasite strains. That is, the positive coincidence rate was 100%, and the negative coincidence rate was also 100%. Therefore, the established RAA-CRISPR / Cas12a 7-fold rapid detection system for chicken coccidia of the present invention can be applied to the diagnosis of chicken coccidiosis and the identification of parasite species for vaccine production.

[0184] The above-described embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of an RAA primer in preparing a kit for seven-fold detection of chicken coccidia based on the RAA-CRISPR / Cas12a technology, characterized in that, The primer includes the upstream primer F3 shown in SEQ ID NO.10 and the downstream primer R2 shown in SEQ ID NO.12; The chicken coccidia include Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria necatrix, Eimeria mitis, Eimeria praecox and Eimeria brunetti.

2. A method for detecting Eimeria in chickens for non-diagnostic and / or non-therapeutic purposes, characterized in that, It includes the following steps: (1) Extract the chicken coccidia oocyst DNA template from the fecal sample to be tested; (2) Using the RAA primer and the chicken coccidia oocyst DNA as the template, carry out the RAA amplification reaction to obtain the amplification product; The RAA primer includes the upstream primer F3 shown in SEQ ID NO.10 and the downstream primer R2 shown in SEQ ID NO.12; (3) Using the amplification product as the template, carry out the CRISPR / Cas12a reaction to obtain the reaction product; if the reaction product shows green fluorescence, it is determined that the fecal sample to be tested contains the chicken coccidia of the corresponding type of crRNA, or, if the fluorescence value of the reaction product ≥ 1390, it is determined that the fecal sample to be tested contains the chicken coccidia of the corresponding type of crRNA; When the chicken coccidia is Eimeria maxima, the nucleotide sequence of the crRNA is shown in SEQ ID NO.14; when the chicken coccidia is Eimeria acervulina, the nucleotide sequence of the crRNA is shown in SEQ ID NO.17; when the chicken coccidia is Eimeria necatrix, the nucleotide sequence of the crRNA is shown in SEQ ID NO.22; when the chicken coccidia is Eimeria mitis, the nucleotide sequence of the crRNA is shown in SEQ ID NO.25; when the chicken coccidia is Eimeria praecox, the nucleotide sequence of the crRNA is shown in SEQ ID NO.26; when the chicken coccidia is Eimeria brunetti, the nucleotide sequence of the crRNA is shown in SEQ ID NO.30; when the chicken coccidia is Eimeria tenella, the nucleotide sequence of the crRNA is shown in SEQ ID NO.

32.

3. The chicken coccidia detection method according to claim 2, characterized in that, The reaction system of the RAA amplification reaction includes: 12.5 μL A Buffer, 1 μL 10 μmol / L upstream primer F3, 1 μL 10 μmol / L downstream primer R2, 1 μL template, 1.25 μL B Buffer, 8.25 μL ddH2O; The temperature of the RAA amplification reaction is 40 °C and the time is 30 min.

4. The chicken coccidia detection method according to claim 2, characterized in that, The reaction system of the CRISPR / Cas12a reaction includes: 2.5 μL 10×NEBuffer 2.1, 2 μL amplification product, 1 μL 1 μmol / L crRNA, 2.0 - 4.0 μL 1 μmol / L Cas12a protein, 2.0 - 4.0 μL 10 μmol / L ssDNA, and RNase-free H2O is added to make up to 20 μL; The temperature of the CRISPR / Cas12a reaction is 37 °C and the time is 60 min.

5. The chicken coccidia detection method according to claim 4, characterized in that, In the reaction system of the CRISPR / Cas12a reaction, when the crRNA is SEQ ID NO.14, SEQ ID NO.17 or SEQ ID NO.32, the volume of the Cas12a protein is 2.0 μL and the volume of the ssDNA is 2.0 μL; when the crRNA is SEQ ID NO.22, SEQ ID NO.25 or SEQ ID NO.26, the volume of the Cas12a protein is 3.0 μL and the volume of the ssDNA is 2.0 μL; when the crRNA is SEQ ID NO.30, the volume of the Cas12a protein is 4.0 μL and the volume of the ssDNA is 4.0 μL.

Citation Information

Patent Citations

  • 5,6-Dihydro-1,2,4,6-thiatriazin(5)on-1.1-dioxides, process for their preparation and herbicides containing them

    EP0025113A1

  • vehicle comprising two running wheels placed one behind the other, one of which can be steered

    FR775302A

  • double-walled tubular element system

    FR775303A

  • Primer group for detecting influenza A virus based on multiple RAA-CRISPR system, crRNA sequence and application

    CN116970742A