An indel marker for identifying dry matter yield of puccinellia distans and application thereof

By using pan-genome analysis and the PGLA1534527 locus marker, the problem of insufficient genetic information coverage in single reference genome analysis was solved, enabling efficient identification of dry matter yield of American foxtail grass and providing breeding guidance.

CN119391893BActive Publication Date: 2025-12-12SICHUAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411558847.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-04
Publication Date
2025-12-12
Estimated Expiration
2044-11-04

AI Technical Summary

Technical Problem

Existing technologies for cultivating American foxtail grass rely on a single reference genome and single nucleotide polymorphism analysis, which are insufficient to fully cover genetic information, leading to the loss of genetic code information and affecting the efficiency of dry matter yield identification.

Method used

Using pan-genome analysis, the PGLA1534527 site on chromosome 5 was identified and used as a structural variation marker. Specific primers were designed for PCR amplification to detect the genotype of *Nymphoides gracilis*. Dry matter yield characteristics were determined through association analysis.

Benefits of technology

This enables more accurate identification of dry matter yield in American foxtail grass, provides efficient breeding directions, and improves planting efficiency and dry matter yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119391893B_ABST
    Figure CN119391893B_ABST
Patent Text Reader

Abstract

The application provides an indel marker for identifying dry matter yield of puccinellia distans and application thereof, relates to a variation site related to the dry matter yield of puccinellia distans, and particularly relates to a SV site PGLA1534527 of the dry matter yield of puccinellia distans, and the nucleotide sequence is shown in SEQ ID No:1. The application also provides a detection primer of the site PGLA1534527 in puccinellia distans. The method provided by the application can improve the accuracy of the per mu yield prediction of the dry matter yield of puccinellia distans within a certain limit, so as to quickly screen out puccinellia distans materials or strains with high dry matter yield for breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to molecular biology and crop genetic breeding, and in particular to a SV variation site related to dry matter yield of American tall fescue and application of the site. BACKGROUND

[0002] Dry matter quality refers to the content and composition of plant matter in a dry state, including the concentration and proportion of nutrients such as cellulose, lignin, protein, and carbohydrates. Dry matter quality is a key indicator for measuring plant production performance, nutritional value, and economic benefits, and is particularly important in grassland agriculture and pasture planting. Plants with high dry matter quality not only provide more nutrients, but also improve soil quality and ecosystem stability. Plants with high dry matter quality generally have higher accumulation of nutrients such as protein and carbohydrates. These nutrients are essential for plant growth and development, and can support plant growth and physiological activities under adverse conditions. Plants with high dry matter quality can more effectively convert photosynthetic products into dry matter, thereby increasing overall biomass, and the increase in dry matter quality can enhance plant resistance to environmental stress such as drought, salinity, and disease. For example, plants with high dry matter quality generally have stronger water retention capacity and disease resistance, and can better adapt to harsh environmental conditions.

[0003] In pasture planting, dry matter quality directly affects the nutritional value of forage. Pasture with high dry matter quality generally contains higher protein and energy, which is crucial for animal health and production performance. High-quality forage can improve the growth rate, milk yield, and meat quality of livestock. And plant residues with high dry matter quality have a positive impact on soil fertility. Plant residues release a large amount of organic matter and nutrients during decomposition, which can improve soil structure, increase soil organic matter content, and promote microbial activity, thereby improving soil productivity. It can also enhance the stability of the ecosystem. For example, good vegetation cover can prevent soil erosion, reduce water and soil loss, and maintain biodiversity. Dry matter quality has a profound impact on plant growth, nutritional value, and ecosystem function. Therefore, in agricultural and ecological environment management, it is of great practical significance and application prospect to focus on the improvement of dry matter quality.

[0004] Pennisetum americanum is an important warm-season annual grass and one of the six major cereal crops in the world. It has the characteristics of high protein, high seed, and high grass yield, and has strong stress resistance. It can grow and bear fruit in hot and dry areas and poor land, so it is considered a high-quality forage grass resource and potential energy plant that can be planted in arid regions of northwest China. At present, the planting area of P. americanum in the world is about 29 million hm2 (2017). In recent years, the per capita available land has decreased, and how to harvest more high-quality forage on limited land to meet the survival needs of a large number of livestock has become the key to alleviate this contradiction. The amount of dry matter is a very important indicator and has attracted widespread attention from scientists. In-depth analysis of the molecular mechanisms that affect plant dry matter regulation will help breed new varieties of forage grass and support the grassland livestock industry.

[0005] In recent years, with the development of a large number of molecular markers and the rapid development of bioinformatics, the application of association analysis methods to explore plant quantitative traits has become one of the hotspots in international plant genomics research. Association analysis is based on linkage disequilibrium (LD), which is the non-random combination of alleles at different loci. It is a method of direct analysis of phenotypic and genotypic variation, and further positioning of certain genes. However, this method has some drawbacks, as it mainly analyzes a single reference genome and single nucleotide polymorphism (SNP). The intraspecific polymorphism of plants is high, and a single reference genome of an individual cannot cover all the genetic information of the species. If only a single reference genome is used to study genetic domestication variation, etc., a lot of intended genetic code information may be lost, as many unique sequences are not on the reference genome. At the same time, with the continuous development of genome sequencing technology, the application of pan-genome has gradually become widespread. Pan-genome refers to the total set of genes of a species, and has great advantages in studying different subspecies or varieties of the same species that differ greatly. In addition to providing SNPs (single nucleotide polymorphisms, SNP), pan-genome also provides a large amount of SV (structural variation, SV) information. SV has a greater impact on the genome than SNP, and can be used to better explain the characteristics of population diversity of agronomic traits. SUMMARY

[0006] The application provides an SV variation marker for identifying the dry matter yield of P. americanum, characterized in that the marker is located at a structural variation site on chromosome 5, and the sequence is shown as SEQ ID No: 1.

[0007] The application provides a method for detecting dry matter yield of puccinellia distans, comprising the following steps: detecting the genotype of PGLA1534527 site in the genome of puccinellia distans, when the PGLA1534527 site is present, the puccinellia distans to be detected is a candidate germplasm with low dry matter yield characteristic, and when the PGLA1534527 site is absent, the puccinellia distans to be detected is a candidate germplasm with high dry matter yield characteristic.

[0008] The application provides a set of primer groups for identifying target genotypes of puccinellia distans:

[0009] PGL1534527_5: TGGGTCGTCCACCAAACTAATACAGTGTCTTGTGTTGGTGTG

[0010] The application also provides a method for identifying dry matter yield of puccinellia distans, comprising the steps of PCR amplification products of the above-mentioned 11 corresponding primers:

[0011] (1) Extracting genomic DNA of puccinellia distans.

[0012] (2) Designing specific primers for PGLA1534527 site for subsequent PCR amplification.

[0013] (3) Using the extracted genomic DNA as a template, using the designed specific primers for PCR amplification, ensuring that the amplified fragments contain SV sites. Optimizing PCR conditions, such as annealing temperature and cycle number, to ensure amplification efficiency and specificity. And using PCR amplification products for genotyping.

[0014] (4) Collecting and analyzing the genotype data of the germplasm, focusing on the genotype distribution of SV sites; correlating the genotype data with the dry matter yield trait data to determine the relationship between different genotypes and dry matter yield.

[0015] The application can also provide a product for detecting the genotype of PGLA1534527 site in the genome of puccinellia distans. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 Distribution of dry matter yield of different genotypes.

[0017] Figure 2 PCR detection of PGLA1534527_5. In this figure, SEQ NO. 1 is genotype I, and SEQ NO. 2 is genotype II. DETAILED DESCRIPTION

[0018] The following examples are used to illustrate the application, but not to limit the scope of the application. If not specifically indicated, the examples are in accordance with the conventional experimental conditions.

[0019] Example 1, PGLA1534527 site is a SV associated with dry matter yield of Puccinellia distans

[0020] 1, Basic information of PGLA1534527 variation site

[0021] Through pan-genome sequencing analysis of Puccinellia distans germplasm, a gene site associated with dry matter yield of Puccinellia distans is obtained, named PGLA1534527, which is located in PI537069 genome chromosome 5, downstream of gene PMA5G01397.1, and belongs to large fragment deletion variation. The basic information is shown in Table 1.

[0022] Table 1, basic information of PGLA1534527 variation site

[0023] SV marker Chromosome Sequence number Chromosomal location PGLA1534527 5 SEQ ID No: 1 23,145,977

[0024] Example 2, genotype detection and dry matter yield determination of Puccinellia distans germplasm

[0025] The dry matter yield of 215 Puccinellia distans germplasms shown in Table 2 was detected. Combined with the results of pan-genome sequencing and reference genome alignment, it is shown (Table 2) that the varieties with PGLA1534527 site of Puccinellia distans have the characteristics of low dry matter yield, which is genotype I, and the varieties lacking PGLA1534527 site have the characteristics of high dry matter yield, which is genotype II. The various varieties of Puccinellia distans of the application can be obtained from the Sichuan Agricultural University Germplasm Repository.

[0026] Table 2, genotype of 215 Puccinellia distans germplasms based on PGLA1534527 site

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035] The results of Table 2 are as follows Figure 1Among the 215 germplasm, 142 varieties were identified as type I based on the genotype of PGLA1534527, and the average dry matter yield of the 117 germplasm was 3695.85; 73 varieties were identified as type II based on the genotype of PGLA1534527, and the average dry matter yield was 4144.99. It is shown that the genotype of type II is a high dry matter yield genotype. The discovery of this site provides a new research direction for the study and breeding of dry matter yield of American tall fescue.

[0036] Example 3, PCR detection based on PGLA1534527_5 marker combination

[0037] The genotype of the PGLA1534527 site of the American tall fescue germplasm was detected. Randomly selected American tall fescue varieties were detected (based on the genotype of PGLA1534527 site type I or genotype type II), and the 5th group of markers was randomly selected for PCR detection. The primers were combined considering the CG content and Tm value of the primers. The primer sequences are as follows:

[0038] Table 3, PGLA1534527 variation site detection primer sequence

[0039]

[0040] The results are shown in Figure 2 The PCR detection based on the marker combination PGLA1534527_5 successfully identified the target genotype in the American tall fescue sample, showing good specificity and stability. The marker combination can be used as an effective tool for identifying grain yield-related traits in American tall fescue, and has application potential in high-yield breeding.

Claims

1. A method for detecting dry matter yield in Puccinellia distans, characterized by, The method comprises the following steps: detecting the genotype of PGLA1534527 site in the genome of Puccinellia distans, wherein the sequence of the site is shown as SEQ ID No: 1; when the PGLA1534527 site is present, the Puccinellia distans to be detected is a candidate germplasm with the characteristic of low dry matter yield; when the PGLA1534527 site is absent, the Puccinellia distans to be detected is a candidate germplasm with the characteristic of high dry matter yield; and the PGLA1534527 site is located on chromosome 5 of the genome of Puccinellia distans PI537069.

2. A method of identifying a dry matter yield in a Puccinellia distans, characterized in that, The method comprises the following steps: (1) extracting the genomic DNA of Puccinellia distans; (2) designing specific primers for the PGLA1534527 site in claim 1 for subsequent PCR amplification; and the PGLA1534527 site is located on chromosome 5 of the genome of Puccinellia distans PI537069; the primers are PGL1534527_5: TGGGTCGTCCACCAAACTAATACAGTGTCTTGTGTTGGTGTG; (3) using the extracted genomic DNA as a template, performing PCR amplification by using the designed specific primers, ensuring that the amplified fragment contains the PGLA1534527 site, optimizing the PCR conditions to ensure the amplification efficiency and specificity, and using the PCR amplification product for genotyping; when the PGLA1534527 site is present, the Puccinellia distans to be detected is a candidate germplasm with the characteristic of low dry matter yield; and when the PGLA1534527 site is absent, the Puccinellia distans to be detected is a candidate germplasm with the characteristic of high dry matter yield.