Development and application of eQTL of oilseed rape oil content key transcription factor and molecular marker closely linked with eQTL

Abstract

The invention relates to development and application of an eQTL of a rape oil content key transcription factor and a molecular marker closely linked with the eQTL. The invention provides application of a QTL (Quantitative Trait Loci) qlec1.C03.1 of a C03 chromosome with high oil content of Brassica napus L.. The major QTL of the C03 chromosome with high oil content of the Brassica napus L. is located between the fourth 235th bp and the 655bp and the fourth 535th bp and the 655bp of the C03 chromosome. The molecular marker can be used for detecting and predicting the oil content of the brassica napus, can also be used for molecular marker-assisted breeding of the high-oil-content brassica napus, can effectively accelerate the high-oil-content breeding process of the brassica napus, is suitable for large-scale popularization and application, and has a wide application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant molecular breeding, and in particular relates to the development and application of eQTL of a key transcription factor of rapeseed oil content and its tightly linked molecular markers. Background Art

[0002] Rapeseed is the largest oil crop in my country, and rapeseed oil accounts for more than 55% of the country's oil crop production. At present, my country's rapeseed imports are more than 1 million tons. Rapeseed oil production depends on oil content. For every 1% increase in oil content, oil production can increase by 36.6kg / hm 2 .

[0003] Triacylglycerols are biosynthesized as energy reserves during seed maturation to support seed germination and seedling development. Currently, a large number of studies have focused on elucidating the complex transcriptional regulatory balance between seed development and seed oil content. However, seed oil content is an intricate trait, and the transcriptional regulation of its biosynthesis is affected by developmental and environmental signals. The accumulation of seed oil is regulated by multiple transcription factors, including WRINKLED1 (WRI1) and the seed-specific LAFL gene regulatory network, including LEAFY COTYLEDON1 (LEC1), LEAFY COTYLEDON2 (LEC2), FUSCA3 (FUS3), and ABSCISIC ACID INSENSITIVE3 (ABI3). These transcription factors play a core role in seed development and have an important impact on the accumulation of seed oil content. Through reverse genetics, some core transcription factors have been reported in rapeseed and their important effects on seed oil content have been clarified. Therefore, exploring the upstream regulatory genes of these core regulatory factors will enhance the understanding of the regulatory mechanism of oil metabolism and provide new gene resources for breeding rapeseed with high oil content.

[0004] Therefore, forward genetics was used to identify the eQTLs of key transcription factors in the oil accumulation process of Brassica napus, and molecular markers were developed, which can be used for molecular marker-assisted breeding of high oil content. Summary of the invention

[0005] The present invention provides an eQTLqlec1.C03.1 site of a key regulatory factor for oil content on the C03 chromosome of Brassica napus, which affects the expression of the Brassica napus oil content regulatory factor BnaA09.LEC1 and plays a key role in the accumulation of oil content in Brassica napus. Molecular markers tightly linked to the QTL site can be used for positional cloning and molecular marker-assisted breeding, and are suitable for large-scale promotion and application.

[0006] To achieve the above purpose, the present invention provides an application of a C03 chromosome QTL site qlec1.C03.1 of high oil content in Brassica napus, wherein the main effect QTL site on the C03 chromosome of the Brassica napus high oil content is between 4,235,655bp and 4,535,655bp of the C03 chromosome. It can be used to detect and predict the oil content of Brassica napus, and can also be used for molecular marker-assisted breeding of Brassica napus with high oil content, accelerating the process of breeding of Brassica napus with high oil content, and is suitable for large-scale promotion and application.

[0007] The invention provides a SNP molecular marker combination closely linked to the oil content gene BnaA09.LEC1 of Brassica napus, the molecular marker combination comprising: SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465. The reference genome version is: Zhongshuang 11 (ZS11.v0).

[0008] Further, the molecular marker SNP_Bna_C0304512029 is located at 4512029bp on the C03 chromosome of Brassica napus, and the base at 4512029bp on the C03 chromosome is A or T, and the mutation causes polymorphism;

[0009] The molecular marker SNP_Bna_C0304512083 is located at the 4512083 bp position on the C03 chromosome of Brassica napus. The base at the 4512083 bp position on the C03 chromosome is T or C, and the mutation leads to polymorphism.

[0010] The molecular marker SNP_Bna_C0304512236 is located at the 451223 bp position on the C03 chromosome of Brassica napus. The base at the 451223 bp position on the C03 chromosome is C or T, and the mutation leads to polymorphism.

[0011] The molecular marker SNP_Bna_C0304513037 is located at the 4513037bp position on the C03 chromosome of Brassica napus. The base at the 4513037bp position on the C03 chromosome is T or G, and the mutation leads to polymorphism.

[0012] The molecular marker SNP_Bna_C0304513324 is located at the 4513324 bp position on the C03 chromosome of Brassica napus. The base at the 4513324 bp position on the C03 chromosome is G or A, and the mutation leads to polymorphism.

[0013] The molecular marker SNP_Bna_C0304513788 is located at the 4513788 bp position on the C03 chromosome of Brassica napus. The base at the 4513788 bp position on the C03 chromosome is C or T, and the mutation leads to polymorphism.

[0014] The molecular marker SNP_Bna_C0304514134 is located at the 4514134 bp position on the C03 chromosome of Brassica napus. The base at the 4514134 bp position on the C03 chromosome is T or C, and the mutation leads to polymorphism.

[0015] The molecular marker SNP_Bna_C0304514465 is located at the 4514465 bp position on the C03 chromosome of Brassica napus. The base at the 4514465 bp position on the C03 chromosome is G or A, and the mutation leads to polymorphism.

[0016] Furthermore, the primer or probe of the molecular marker SNP_Bna_C0304512029 is designed based on a DNA fragment of 400 bp sequence before and after 4512029 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO: 1;

[0017] The primer or probe of the molecular marker SNP_Bna_C0304512083 is designed based on a DNA fragment of 400 bp sequence before and after 4512083 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO: 2;

[0018] The primer or probe of the molecular marker SNP_Bna_C0304512236 is designed based on a DNA fragment of 400 bp sequence before and after 4512236 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO: 3;

[0019] The primer or probe of the molecular marker SNP_Bna_C0304513037 is designed based on a DNA fragment of 400 bp sequence before and after 4513037 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO: 4;

[0020] The primer or probe of the molecular marker SNP_Bna_C0304513324 is designed based on a DNA fragment of 400 bp sequence before and after 4513324 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO: 5;

[0021] The primer or probe of the molecular marker SNP_Bna_C0304513788 is designed based on a DNA fragment of 400 bp sequence before and after 4513788 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO: 6;

[0022] The primer or probe of the molecular marker SNP_Bna_C0304514134 is designed based on a DNA fragment of 400 bp sequence before and after 4514134 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO: 7;

[0023] The primer or probe of the molecular marker SNP_Bna_C0304514465 is designed based on a DNA fragment of 400 bp sequence before and after 4514465 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO:8.

[0024] Furthermore, by detecting the base sequences of SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465, Brassica napus was divided into haplotypes hap.A, hap.B or hap.C, among which hap.A was a high oil content haplotype, and hap.B or hap.C was a low oil content haplotype.

[0025] Further, the base sequences detected by SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465 in the hap.A haplotype are AA, TT, CC, TT, GG, CC, TT and GG, the base sequences detected in the hap.B haplotype are TT, CC, TT, GG, AA, TT, CC and AA, and the base sequences detected in the hap.C haplotype are TT, CC, TT, GG, AA, CC, CC and AA.

[0026] The present invention also provides the use of any of the above-mentioned molecular marker combinations in any of the following:

[0027] (1) Application in the breeding of high-oil-content Brassica napus;

[0028] (2) Application in whole genome breeding of Brassica napus;

[0029] (3) Application in the evaluation of high oil content in Brassica napus;

[0030] (4) Application in the screening of varieties related to high oil content in Brassica napus;

[0031] (5) Application in identification of varieties related to high oil content of Brassica napus;

[0032] (6) Application in molecular-assisted breeding of varieties related to high oil content in Brassica napus;

[0033] (7) Application in the protection of germplasm resources of varieties related to high oil content of Brassica napus;

[0034] (8) Application in the improvement of germplasm resources of Brassica napus varieties with high oil content.

[0035] Furthermore, by detecting the base sequences of SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465 in Brassica napus, Brassica napus was divided into haplotypes hap.A, hap.B or hap.C, among which hap.A was a high oil content haplotype, and hap.B or hap.C was a low oil content haplotype.

[0036] Further, the base sequences detected by SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465 in the hap.A haplotype are AA, TT, CC, TT, GG, CC, TT and GG, the base sequences detected in the hap.B haplotype are TT, CC, TT, GG, AA, TT, CC and AA, and the base sequences detected in the hap.C haplotype are TT, CC, TT, GG, AA, CC, CC and AA.

[0037] The present invention also provides a method for detecting the oil content of Brassica napus, identifying or assisting in identifying the oil content of Brassica napus, predicting the oil content of Brassica napus and assisting in breeding high-oil-content Brassica napus, and detecting SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C030451332 in Brassica napus. 4, the base sequences of SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465, wherein when the polymorphism of the molecular marker combination is AA, TT, CC, TT, GG, CC, TT and GG, it corresponds to high oil content, and when the polymorphism of the molecular marker combination is TT, CC, TT, GG, AA, TT, CC or TT, CC, TT, GG, AA, CC, CC, it corresponds to low oil content.

[0038] The present invention also provides a method for identifying high-oil-content Brassica napus, wherein the above-mentioned molecular marker combination is detected, and when the polymorphism of the molecular marker combination is AA, TT, CC, TT, GG, CC, TT and GG, it corresponds to high oil content.

[0039] The present invention also provides a method for identifying Brassica napus with low oil content, wherein the above-mentioned molecular marker combination is detected, and when the polymorphism of the molecular marker combination is TT, CC, TT, GG, AA, TT, CC or TT, CC, TT, GG, AA, CC, CC, it corresponds to low oil content. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0041] Figure 1 Schematic diagram of the eQTL qlec1.C03.1 site.

[0042] Figure 2 is the expression level of BnaA09.LEC1 in different haplotype materials. DETAILED DESCRIPTION

[0043] The following examples are only used to more clearly illustrate the technical scheme of the present invention, and are therefore only used as examples, and cannot limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise stated, the reagents and materials used in the following examples are commercially available.

[0044] Example 1 Expression data of BnaA09.LEC1, a key transcription factor for oil content in Brassica napus seeds

[0045] 273 core germplasm materials of Brassica napus (from Huazhong Agricultural University) were planted in the experimental field of Huazhong Agricultural University. In the field trial, each material was planted in 2 rows, with 10 plants in each row and a plant spacing of about 20 cm.

[0046] The siliques of each material were marked at flowering, and seed samples were collected for transcriptome sequencing at 40 days after flowering (40 DAF). Total RNA was extracted using the TIANGEN RNAprep pure plant kit, and a sequencing library was constructed using 1.5 μg RNA. The sequencing library was constructed using the UltraTM RNA library preparation kit and sequenced on the Illumina HiSeq4000 platform to generate 150 bp paired-end reads. FastQC software was used to control the quality of the reads. The filtered reads were aligned to the ZS11.v0 reference genome (Brassica napus) using STAR software (Dobin et al., 2013) for deep segment sequencing extraction. The gene expression matrix was obtained using Salmon software (Patro et al., 2017) and tximport (Soneson et al., 2015). The genome was divided into 500 bp windows, slid every 250 bp, and the reads of each window were calculated using pysam, and then divided by the average number of reads of the variety for LOG2 (TPM) normalization. The expression data of BnaA09.LEC1, a key transcription factor regulating the oil content of Brassica napus seeds, are shown in Table 1.

[0047] Table 1 Expression of transcription factor BnaA09.LEC1 in 273 rapeseed seeds at 40 DAF

[0048]

[0049]

[0050]

[0051] Example 2: Genome-wide association analysis using the expression level of BnaA09.LEC1 to locate the eQTL qlec1.C03.1

[0052] The genotype data for whole-genome association analysis were sampled from young leaf tissues. First, they were rinsed in 10% ethanol, then placed in a mortar and ground quickly into powder using liquid nitrogen; 700 μL of preheated DNA extraction solution was added; after mixing, the mixture was placed in a 65°C water bath for 1 hour, and mixed once every 10-15 minutes; 700 μL of mixed solution (phenol: chloroform: isoamyl alcohol = 25:24:1) was added, and the mixture was gently inverted and mixed for 10 minutes; at room temperature, centrifuged at 10,000×g for 15 minutes; the supernatant was aspirated into a new 2mL centrifuge tube; an equal volume of mixed solution (chloroform: isoamyl alcohol = 24:1) was added, the mixture was inverted and mixed, and the mixture was allowed to stand for 5 minutes, centrifuged at 10,000×g for 15 minutes, and the supernatant was aspirated into a new centrifuge tube with a gun; 2 times the volume of anhydrous ethanol was added, mixed, and centrifuged at -20°C After standing for 1 hour, centrifuge at 10000×g for 10 minutes, discard the supernatant; add 500μL pre-cooled 75% ethanol to wash the precipitate, and remove the supernatant; after washing the precipitate twice in a row, dry it; add 100μL of 2% RNaseA solution, stand at 37℃ for 1 hour, and then stand at 4℃ overnight; extract the DNA solution again with an equal volume of mixed solution (chloroform: isoamyl alcohol = 24:1), mix it by inversion, stand for 10 minutes, centrifuge at 10000×g for 15 or 20 minutes, remove RNaseA, draw the supernatant (about 60μL), centrifuge again for 1 minute; use agarose gel electrophoresis (0.8%) and UV spectrophotometer to detect DNA concentration, quality and integrity; determine that the absorbance 260 / 280 ratio of all DNA samples is between 1.8-2.0. Then transport the DNA samples to the sequencing company on dry ice, and the sequencing depth of each material is about 9×.

[0053] The genotype data were preprocessed by using FastQC software to evaluate the sequencing quality, and then filtering the sequencing sequences for adapters and low-quality reads. The clean data of the double-end sequencing of each material was obtained, and then the bwa software was used for mapping and the GATK software was used for variation detection. After obtaining the total SNP data set of the associated population, the SNP data set quality was filtered according to the minimum allele frequency ≥ 0.05, the missing rate ≤ 0.1 and the heterozygosity rate ≤ 0.15, and finally a high-quality population SNP data set was obtained for subsequent analysis.

[0054] In the whole genome association analysis, the mixed analysis model of 3VmrMLM was used, using 10,836,767 SNPs and InDel markers, where the group structure matrix parameter was set to k = 4, and the kinship matrix was calculated by 3VmrMLM. The svpal threshold parameter was set to 0.01, the threshold of the second step marker screening P was 4.27e-09 (= 0.05 / m, where m is the number of markers) and the threshold of LOD was ≥ 3.0, and QTL loci associated with the expression of BnaA09.LEC1 were identified on the whole genome. Among them, an eQTL qlec1.C03.1 locus was identified on chromosome C03, located between 4,235,655bp and 4,535,655bp of chromosome C03, and the LOD value of this locus was 7.52 ( Figure 1 ).

[0055] Example 3 Haplotype analysis of linkage variation of qlec1.C03.1 and oil content and expression of BnaA09.LEC1 and development of molecular markers

[0056] The lead SNP in the major QTL locus of BnaA09.LEC1 on chromosome C03 (4513037 on chromosome C03, SNP_Bna_C0304513037) was used as the benchmark, and the 150 kb range upstream and downstream was defined as the QTL interval. In this QTL interval, linkage disequilibrium (LD) analysis was performed on each SNP and InDel marker, and the LD between each SNP marker in the QTL interval and SNP_Bna_C0304513037 was calculated. R 2 The loci with a p value greater than 0.6 were identified as 8 SNP molecular markers.

[0057] According to these markers, 273 materials in the population were divided into haplotypes, of which hap.A, hap.B and hap.C accounted for more than 80% of the materials. Further haplotype analysis of BnaA09.LEC1 expression in materials corresponding to the three haplotypes was performed, and significant differences were found ( Figure 2 ). It was also found that the lead SNP site (SNP_Bna_C0304513037) within the qlec1.C03.1 major effect QT L site was located within the BnaC03.MYB56 gene interval, and the gene expression level was significantly correlated with BnaA09.LEC1 ( Figure 2). Among them, when SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304 When the sequence of the bases detected by 514465 is a combination of AA, TT, CC, TT, GG, CC, TT and GG, the Brassica napus sample is a homozygous high oil content haplotype (haplotype: hap.A), and the molecular markers SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037 , SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465 detected base sequences of TT, CC, TT, GG, AA, TT, CC and AA and TT, CC, TT, GG, AA, CC, CC and AA (i.e., haplotypes: hap.B and hap.C), the Brassica napus sample was a homozygous low-oil haplotype. Table 2 lists the 8 SNP molecular marker detection results and oil content of some materials and BnaA09.LEC1 gene expression data. The oil content detection method is as follows: 6 free-pollinated plants with uniform growth were harvested from each material, and the whole plant was threshed after natural air drying in the seed hanging room. About 5 grams of seeds were weighed from each plant after impurities were removed, and the oil content of each plant was detected by NIRSy The seed oil content was determined using the stems 5000 near-infrared instrument, which was provided by the public platform of the Rapeseed Engineering Technology Research Center of Huazhong Agricultural University.

[0058] Table 2 Detection results of 8 SNP molecular markers and oil content and BnaA09.LEC1 gene expression data of some materials

[0059]

[0060]

[0061] Phenotypic grouping of the eight markers in the population: when the eight markers were combined as ATCTGCTG, the average oil content of the material was 51.94%, and the average expression of BnaA09.LEC1 was 2.67; when the eight markers were combined as TCTGATCA, the average oil content of the material was 41.65%, and the average expression of BnaA09.LEC1 was 0.87; when the eight markers were combined as TCTGACCA, the average oil content of the material was 44.67%, and the average expression of BnaA09.LEC1 was 0.96 (Table 2). Therefore, the above SNP molecular markers can be screened individually or in pairs, and combined for screening and breeding of rapeseed seed oil content, which has good application prospects.

[0062] Specifically, for the above SNP molecular marker combination, corresponding primers or probes can be designed for high oil content molecular marker-assisted breeding, wherein the primer or probe of the molecular marker SNP_Bna_C0304512029 is designed based on a DNA fragment of 400 bp sequence before and after 4512029 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO: 1;

[0063] The primer or probe of the molecular marker SNP_Bna_C0304512083 is designed based on a DNA fragment of 400 bp sequence before and after 4512083 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO: 2;

[0064] The primer or probe of the molecular marker SNP_Bna_C0304512236 is designed based on a DNA fragment of 400 bp sequence before and after 4512236 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO: 3;

[0065] The primer or probe of the molecular marker SNP_Bna_C0304513037 is designed based on a DNA fragment of 400 bp sequence before and after 4513037 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO: 4;

[0066] The primer or probe of the molecular marker SNP_Bna_C0304513324 is designed based on a DNA fragment of 400 bp sequence before and after 4513324 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO: 5;

[0067] The primer or probe of the molecular marker SNP_Bna_C0304513788 is designed based on a DNA fragment of 400 bp sequence before and after 4513788 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO: 6;

[0068] The primer or probe of the molecular marker SNP_Bna_C0304514134 is designed based on a DNA fragment of 400 bp sequence before and after 4514134 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO: 7;

[0069] The primer or probe of the molecular marker SNP_Bna_C0304514465 is designed based on a DNA fragment of 400 bp sequence before and after 4514465 bp of the C03 chromosome of Brassica napus as a template, and the DNA fragment is shown in SEQ ID NO:8.

[0070] Further, for example, the following primer set can be used:

[0071] The invention discloses a reagent for detecting the base 4512029 of the C03 chromosome of Brassica napus in the breeding of Brassica napus with high oil content. The reagent is a primer set: F: ACCATCAAGCTCTCAAGAAG, R: ACGAAAACTACTTACATTTTGAA.

[0072] The invention discloses an application of a reagent for detecting the 4512083rd base of the C03 chromosome of Brassica napus in the breeding of Brassica napus with high oil content. The reagent is a primer set: F: TGTTTTTGTTTCAAAATGTAAGT, R: AGTTTTGGCTAAAATGACGAA.

[0073] The invention discloses a reagent for detecting the 4512236th base of the C03 chromosome of Brassica napus in the breeding of Brassica napus with high oil content. The reagent is a primer set: F: ATTGAATACAGTGTGACCAATC, R: ATATGTCACTGACGTTAGCTC.

[0074] The invention discloses an application of a reagent for detecting the 4513037th base of the C03 chromosome of Brassica napus in the breeding of Brassica napus with high oil content. The reagent is a primer set: F: GCCTTCTTCAACTCATCAGC, R: TCACTCGTTGTCGGTTGTAT.

[0075] The invention discloses an application of a reagent for detecting the 4513324th base of the C03 chromosome of Brassica napus in the breeding of Brassica napus with high oil content. The reagent is a primer set: F: TGCTATACAACCGACAACGA, R: AAAGCCACTCTTCGTCTTCA.

[0076] The invention discloses an application of a reagent for detecting the 4513788th base of the C03 chromosome of Brassica napus in the breeding of Brassica napus with high oil content. The reagent is a primer set: F: CGGGTTATTTCTAGCCATGT, R: GTTTGTTTGTTGTGCAATGC.

[0077] The invention discloses a reagent for detecting the 4514134th base of the C03 chromosome of Brassica napus in the breeding of Brassica napus with high oil content. The reagent is a primer set: F: ACATCCTCCATATTAGACCAGC, R: CAATGCTTTCTTCAAACGTCAG.

[0078] The invention discloses a reagent for detecting the 4514465th base of the C03 chromosome of Brassica napus in the breeding of Brassica napus with high oil content. The reagent is a primer set: F: TTCTCCTGATTTGACCAGCA, R: ATTAGTTTGGCACGTTTCCC.

[0079] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. A SNP molecular marker combination tightly linked to the oil content gene BnaA09.LEC1 of Brassica napus, characterized in that: The molecular marker combination includes: SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465.

2. The molecular marker combination according to claim 1, characterized in that: The molecular marker SNP_Bna_C0304512029 is located at the 4512029 bp position on the C03 chromosome of Brassica napus. The base at the 4512029 bp position on the C03 chromosome is A or T, and the mutation leads to polymorphism. The molecular marker SNP_Bna_C0304512083 is located at the 4512083 bp position on the C03 chromosome of Brassica napus. The base at the 4512083 bp position on the C03 chromosome is T or C, and the mutation leads to polymorphism. The molecular marker SNP_Bna_C0304512236 is located at the 451223 bp position on the C03 chromosome of Brassica napus. The base at the 451223 bp position on the C03 chromosome is C or T, and the mutation leads to polymorphism. The molecular marker SNP_Bna_C0304513037 is located at the 4513037bp position on the C03 chromosome of Brassica napus. The base at the 4513037bp position on the C03 chromosome is C or T, and the mutation leads to polymorphism. The molecular marker SNP_Bna_C0304513324 is located at the 4513324 bp position on the C03 chromosome of Brassica napus. The base at the 4513324 bp position on the C03 chromosome is T or G, and the mutation leads to polymorphism. The molecular marker SNP_Bna_C0304513788 is located at the 4513788 bp position on the C03 chromosome of Brassica napus. The base at the 4513788 bp position on the C03 chromosome is C or T, and the mutation leads to polymorphism. The molecular marker SNP_Bna_C0304514134 is located at the 4514134 bp position on the C03 chromosome of Brassica napus. The base at the 4514134 bp position on the C03 chromosome is T or C, and the mutation leads to polymorphism. The molecular marker SNP_Bna_C0304514465 is located at the 4514465 bp position on the C03 chromosome of Brassica napus. The base at the 4514465 bp position on the C03 chromosome is G or A, and the mutation leads to polymorphism.

3. The molecular marker combination according to any one of claims 1-2, characterized in that: By detecting the base sequences of SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465, Brassica napus was divided into haplotypes hap.A, hap.B or hap.C, among which hap.A was a high oil content haplotype, and hap.B or hap.C was a low oil content haplotype.

4. The molecular marker composition according to claim 3, characterized in that: The base sequences detected by SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465 in the hap.A haplotype are AA, TT, CC, TT, GG, CC, TT and GG, the base sequences detected in the hap.B haplotype are TT, CC, TT, GG, AA, TT, CC and AA, and the base sequences detected in the hap.C haplotype are TT, CC, TT, GG, AA, CC, CC and AA.

5. Use of the molecular marker combination according to any one of claims 1 to 4 in any of the following: (1) Application in the breeding of high-oil-content Brassica napus; (2) Application in whole genome breeding of Brassica napus; (3) Application in the evaluation of high oil content in Brassica napus; (4) Application in the screening of varieties related to high oil content in Brassica napus; (5) Application in identification of varieties related to high oil content of Brassica napus; (6) Application in molecular-assisted breeding of varieties related to high oil content in Brassica napus; (7) Application in the protection of germplasm resources of varieties related to high oil content of Brassica napus; (8) Application in the improvement of germplasm resources of Brassica napus varieties with high oil content.

6. The use according to claim 5, characterized in that: By detecting the base sequences of SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465 in Brassica napus, Brassica napus was divided into haplotypes hap.A, hap.B or hap.C, among which hap.A was a high oil content haplotype, and hap.B or hap.C was a low oil content haplotype.

7. The use according to claim 6, characterized in that: The base sequences detected by SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465 in the hap.A haplotype are AA, TT, CC, TT, GG, CC, TT and GG, the base sequences detected in the hap.B haplotype are TT, CC, TT, GG, AA, TT, CC and AA, and the base sequences detected in the hap.C haplotype are TT, CC, TT, GG, AA, CC, CC and AA.

8. A method for detecting the oil content of Brassica napus, identifying or assisting in identifying the oil content of Brassica napus, predicting the oil content of Brassica napus, and assisting in breeding high-oil-content Brassica napus, characterized in that: The base sequences of SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465 in Brassica napus were detected, wherein, when the polymorphism of the molecular marker combination was AA, TT, CC, TT, GG, CC, TT and GG, it corresponded to high oil content, and when the polymorphism of the molecular marker combination was TT, CC, TT, GG, AA, TT, CC or TT, CC, TT, GG, AA, CC, CC, it corresponded to low oil content.

9. A method for identifying high-oil-content Brassica napus, characterized in that: The molecular marker combination described in claim 1 is detected, and when the polymorphism of the molecular marker combination is AA, TT, CC, TT, GG, CC, TT and GG, it corresponds to high oil content.

10. A method for identifying low-oil-content Brassica napus, characterized in that: The molecular marker combination described in claim 1 is detected, and when the polymorphism of the molecular marker combination is TT, CC, TT, GG, AA, TT, CC or TT, CC, TT, GG, AA, CC, CC, it corresponds to low oil content.

Images