Method for judging sabina chinensis polyploidy and application thereof
By developing a method based on SSR molecular labeling primer composition, the problem of pheropolytic pheropolytic pheropolytic pheropolytic analysis is solved, and efficient and accurate pheropolytic analysis is achieved, filling the gap in the prior art.
Patent Information
- Application Number
- CN202411880557.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-19
- Publication Date
- 2025-02-07
AI Technical Summary
There is a lack of an efficient and simple method to determine the ploidy of cypress, especially for tree species with weak seed germination ability.
A method based on SSR molecular labeling primer composition was developed, including 7 pairs of SSR labeling primers, and the ploidy of the cypress was determined by PCR amplification and electrophoresis detection.
The accurate determination of ploidy of cypress germplasm resources is achieved, an efficient ploidy analysis method is provided, and the technical methods for ploidy analysis of forest species are enriched.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for determining juniper polyploidy and an application thereof. Background Art
[0002] Juniperus Sabina chinensis (L.) Ant.) is an evergreen tree species of the genus Juniperus of the Cupressaceae family. It is also known as juniper, juniper, red heart cypress, pearl cypress, etc. It is widely distributed in more than 20 provinces (regions and municipalities) in North my country, Northwest China, Central China, Southeast China, Southwest China, etc. It is also cultivated in Beijing and Tibet, and is also distributed in North Korea and Japan (Flora of China). According to the survey, there are more than 6,000 ancient juniper trees in Beijing, accounting for about 14.40% of the total number of ancient trees and famous trees in the city. Juniperus is an important ecological stress-resistant tree species in my country. It is drought-resistant and barren-resistant, and is a common greening tree species in limestone mountains. At the same time, Juniperus is also an important timber tree species. Its wood is light yellow-brown to reddish-brown, the material is fine and solid, and it has strong corrosion resistance. It is suitable for the production of construction, furniture, handicrafts, etc. In addition, Juniperus is also an important Chinese medicinal tree species in my country. Its branches, leaves and bark can all be used as medicine. In short, Juniperus has important ecological, economic, cultural and social values.
[0003] Polyploidization is the main way of plant evolution and variation, and is also an important method of forest tree breeding. There are various polyploid tree species in nature, such as Robinia, Eucommia, Poplar, etc. Most Cupressaceae plants are diploid, with chromosome 2n=22, only the genus Sabina or Juniperus has chromosome 2n=22, 44, among which the known Sabina chinensis ( Sabina vulgaris Ant.) is diploid, but the ploidy of Chinese juniper has not yet been determined.
[0004] At present, the main methods for determining plant ploidy are karyotype analysis and flow cytometry (FCM). Flow cytometry is a high-throughput technology that can quickly and accurately determine the size of plant genomes and analyze ploidy, but it requires a high level of technical skills in sample processing and instrument operation; karyotype analysis is a basic method for studying plant chromosomes, but for recalcitrant seed plants, it is difficult to obtain root tip materials and the operation cycle is long. For tree species with weak seed germination ability such as juniper, there is a lack of an efficient and simple method for determining ploidy. As an important method for analyzing plant genetic variation, SSR molecular marker technology is mainly used in genetic diversity and kinship analysis, fingerprint map and linkage genetic map construction. Analysis of genetic variation in juniper plants found that some SSR primers had significant differences in the number of sites in juniper plants, suggesting that juniper may have polyploidy. Flow cytometry and karyotype analysis confirmed that juniper is a tetraploid tree species, indicating that using SSR primer combinations to determine juniper polyploidy is indeed an efficient ploidy analysis method. Summary of the invention
[0005] The main problem to be solved by the present invention is how to analyze and determine the ploidy of Sabina varieties.
[0006] In order to solve the above problems, the present invention provides a SSR molecular marker primer composition of Sabina.
[0007] The SSR molecular marker primer composition based on juniper provided by the present invention includes at least 2 pairs of 7 pairs of primers, the names of the 7 pairs of primers are SACp34, SACp46, SACp57, SACp69, SACp165, SACp231, and SACp237, and the nucleotide sequences of the 7 pairs of primers are shown in SEQ ID No: 1-SEQ ID No: 14.
[0008] The repeat sequence of the SSR marker primer numbered SACp34 in this article is (ATAG) 6, the repeat sequence of the SSR marker primer numbered SACp46 is (TG) 7, the repeat sequence of the SSR marker primer numbered SACp57 is (CT) 21, the repeat sequence of the SSR marker primer numbered SACp69 is (AC) 12, the repeat sequence of the SSR marker primer numbered SACp165 is (TA) 7, the repeat sequence of the SSR marker primer numbered SACp231 is (AG) 11, and the repeat sequence of the SSR marker primer numbered SACp237 is (CA) 10.
[0009] The nucleotide sequence of the primer SACp34 is: Forward primer sequence F1: 5′- GGTAGGAAAGTTTTGTTGCACCT -3′ ( SEQ ID No: 1 ); Reverse primer sequence R1: 5'-CTCGGTAGCTTCTGGATTGAACT -3' (SEQ ID No: 2).
[0010] The nucleotide sequence of the primer SACp46 is: Forward primer sequence F2: 5′- TCAGATCAATAGCAATCAGAGGA-3′ ( SEQ ID No: 3); Reverse primer sequence R2: 5′-ACTATCCTTGTGCGACAATGTCTT-3′ (SEQ ID No: 4).
[0011] The nucleotide sequence of the primer SACp57 is: Forward primer sequence F3: 5′- CCCATGCAGAAAAGCTTGAT-3′ ( SEQ ID No: 5); Reverse primer sequence R3: 5′-CTGATCAATGTCAAGCCATCTAA-3′ (SEQ ID No: 6).
[0012] The nucleotide sequence of the primer SACp69 is: Forward primer sequence F4: 5′-GAGACCTGCTGAGATTTGTGTGT-3′ (SEQ ID No: 7); Reverse primer sequence R4: 5′- ATCTCTATCTGTCTCTCCCCGTC-3′ (SEQ ID No: 8).
[0013] The nucleotide sequence of the primer SACp165 is: Forward primer sequence F5: 5′- GGTCTTTTGAGATGCACAGCAAT -3′ ( SEQ ID No: 9); Reverse primer sequence R5: 5′-AGGCAATTGTGACTATCGTTGTT-3′ (SEQ ID No: 10).
[0014] The nucleotide sequence of the primer SACp231 is: Forward primer sequence F6: 5′- TTGGCACACTTTGTTTTGTTTTT-3′ ( SEQ ID No: 11 ); Reverse primer sequence R6: 5′-TCAGTTTGTGGGTTTCTTGAAT-3′ (SEQ ID No: 12).
[0015] The nucleotide sequence of the primer SACp237 is: Forward primer sequence F7: 5′- GCATGATGATAAGGAGCATGATT -3′ ( SEQ ID No: 13); Reverse primer sequence R7: 5′- CTTCGATCCCTCACTTTTGTTTA -3′ (SEQ ID No: 14).
[0016] Furthermore, the 5' end of the forward primer sequence F1-F7 can be modified with a 6-FAM fluorescent group to synthesize 7 pairs of fluorescent SSR primers for subsequent experiments.
[0017] In this article, if the above-mentioned SSR molecular marker primer combination is used, if the variety to be tested has 2 or more loci with three or more alleles, the variety to be tested can be determined to be polyploid, otherwise the variety to be tested is diploid.
[0018] The composition is an SSR molecular marker composition developed based on the complete genome sequence of juniper.
[0019] The present invention also provides a kit, which comprises the SSR molecular marker primer complex described above.
[0020] The present invention also provides a DNA chip, which comprises the SSR molecular marker primer complex described above.
[0021] The present invention also provides the use of the above-mentioned SSR molecular marker primer complex, and / or the kit, and / or the DNA chip in any of the following: m1) Ploidy analysis, identification and / or classification of the genus Sabina; m2) Analysis of genetic diversity and / or genetic structure of Sabina; m3) Analysis and identification of the relationship between the genus Sabina; m4) Molecular marker-assisted breeding of Sabina; m5) Protection and utilization of Sabina germplasm resources; m6) Preparation of products for identification and / or classification of the genus Sabina; m7) Preparation of products for analysis of genetic diversity and / or genetic structure of the genus Sabina; m8) Preparation of products for analysis and identification of phylogenetic relationships of the genus Sabina; m9) Preparation of products for molecular marker-assisted breeding of Sabina; m10) Preparation of products for the protection and utilization of Sabina germplasm resources.
[0022] The present invention also provides a method for screening the SSR molecular marker primer set described above, the method comprising the following steps: B1) Transcriptome sequencing of Sabina germplasm resources; B2) Using the transcriptome sequence of Sabina juniper as a reference sequence, the SSR loci of the gene sequence (Unigene) were detected and primers were designed to obtain SSR markers; B3) screening the ploidy diversity among Sabina germplasm resources using the SSR markers; B4) Designing primers for the SSR markers screened in B3) to obtain the SSR molecular marker primer set.
[0023] The present invention also provides a method for performing ploidy analysis on juniper using the SSR molecular marker primer composition described above, the method comprising: using the genomic DNA of the juniper to be tested as a template, performing PCR amplification using the SSR molecular marker primer composition described above to obtain a PCR amplification product, performing electrophoresis detection on the PCR amplification product, and performing ploidy determination and analysis of the juniper based on the electrophoresis detection result.
[0024] In the above method, the PCR amplification program is: 94°C pre-denaturation for 5 min, 1 cycle; 94°C denaturation for 30 s, 60°C annealing for 40 s, 72°C extension for 50 s, 10 cycles; 94°C denaturation for 30 s, 53°C annealing for 40 s, 72°C extension for 50 s, 27 cycles; and finally 72°C extension for 10 min.
[0025] The PCR amplification reaction system is 20 μL, including 10 μL of PCR mix, 0.3 μL of forward primer (20 μM), 0.3 μL of reverse primer (20 μM), 2 μL of template DNA, and 7.4 μL of ddH2O.
[0026] The present invention developed and designed 7 pairs of SSR primers based on the transcriptome sequence of Juniperus chinensis, and used Juniperus chinensis variety resources from different sources to verify the effectiveness of the SSR primer combination developed by the present invention in determining the polyploidy of Juniperus chinensis. Experiments have shown that the SSR primer combination developed by the present invention can accurately determine the ploidy of Juniperus chinensis germplasm resources, and effectively enrich the technical methods for ploidy analysis of forest tree species. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 This is the amplification result of the primer SACp 46 in Example 2 of the present invention on the juniper variety 'Rongtuanjuniper'.
[0028] Figure 2 This is the amplification result of the primer SACp 57 in Example 2 of the present invention on the juniper variety 'Menglin Lanbai'.
[0029] Figure 3 This is the amplification result of the primer SACp 69 in Example 2 of the present invention for the juniper variety 'Diecui'.
[0030] Figure 4 This is the amplification result of the primer SACp 231 in Example 2 of the present invention on the juniper variety 'Fenghui'.
[0031] Figure 5 This is the amplification result of the primer SACp 57 in Example 2 of the present invention on 'Blue Arrow' Sabina chinensis.
[0032] Figure 6 This is the chromosome karyotype of Sabina 'Yunmi'.
[0033] Figure 7 This is the chromosome karyotype of 'Blue Arrow' Rocky Mountain juniper. DETAILED DESCRIPTION
[0034] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.
[0035] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.
[0036] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.
[0037] Example 1: Development and screening method of Sabina SSR primer set 1. Primer development and design methods First, the transcriptome sequencing of the leaves, flowers, cones and other tissues of the self-cultivated juniper variety 'Fenghui' was carried out, and then the Unigene was detected using MISA (Microsatellite) software. The detection standards were set as: mononucleotide, dinucleotide, trinucleotide, tetranucleotide, pentanucleotide and hexanucleotide, and the minimum number of repetitions of each nucleotide was 12, 6, 5, 5, 4, and 4, respectively. Then Primer 3.0 was used to design the detected SSR primers.
[0038] 2. Polymorphic primer screening method 1) Test materials The test materials are 8 varieties of juniper with large morphological differences, among which 'Lanta cypress', 'Rongtuan cypress', 'Feng cypress' and 'Jinhua cypress' are Beijing forest tree varieties, from the Forestry and Fruit Tree Research Institute of Beijing Academy of Agricultural and Forestry Sciences; 'Yunmi', 'Diecui', 'Menglin Lanbai' and 'Menglin Zhongbai' are new varieties of genus juniper, among which 'Yunmi' and 'Diecui' are from the Forestry and Fruit Tree Research Institute of Beijing Academy of Agricultural and Forestry Sciences, and 'Menglin Lanbai' and 'Menglin Zhongbai' are from the Northern Greening Research Institute of Hohhot. The above 8 varieties have been included in the National Forestry and Grassland Germplasm Resource Bank (https: / / www.nfgrp.cn / ), and the platform resource number is shown in Table 1.
[0039] Table 1. Information of test materials of the present invention
[0040] 2) DNA extraction and detection The genomic DNA of Sabina leaves was extracted by the modified CTAB method, and 2-3 μL of the extracted product was used to detect the purity by 2.0% agarose gel electrophoresis.
[0041] 3) PCR amplification According to the primer design results of step 1, 300 pairs of primers were synthesized mainly with dinucleotides and trinucleotides for polymorphic primer screening.
[0042] The reaction system used for primer screening was 20 μL, including 10 μL of PCR mix, 0.3 μL of forward primer (20 μM), 0.3 μL of reverse primer (20 μM), 2 μL of template DNA, and 7.4 μL of ddH2O.
[0043] The amplification program used for primer screening was as follows: pre-denaturation at 94°C for 5 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 60°C for 40 s, and extension at 72°C for 50 s, 10 cycles; denaturation at 94°C for 30 s, annealing at 53°C for 40 s, and extension at 72°C for 50 s, 27 cycles; and final extension at 72°C for 10 min.
[0044] 4) Triple detection method to screen polymorphic SSR primers The triple detection method comprises agarose gel electrophoresis detection, polyacrylamide gel electrophoresis detection and capillary electrophoresis detection.
[0045] The agarose gel electrophoresis detection uses 2.0% agarose gel electrophoresis to detect the PCR amplification products of 8 juniper samples, and preliminarily selects primers with target genes.
[0046] The polyacrylamide gel electrophoresis detection is to detect the PCR amplification products of 8 juniper samples using 6.0% polyacrylamide gel electrophoresis on the basis of the preliminary selection, and to re-select primers containing clear target bands and having polymorphism.
[0047] The capillary electrophoresis detection is based on the re-selection, and further performs capillary electrophoresis detection on the PCR amplification products of 8 juniper samples to screen out efficient primers with rich sites, clear peak shapes and stable amplification.
[0048] 3. Polymorphic primers According to the primer development and screening methods of steps 1 and 2, the present invention finally obtains a group of high-efficiency microsatellite molecular marker primer compositions based on the transcriptome sequence of Sabina juniper, including 7 pairs of primers, namely SACp34, SACp46, SACp57, SACp69, SACp165, SACp231 and SACp237.
[0049] The nucleotide sequence of the primer SACp34 is: Forward primer sequence F1: 5′- GGTAGGAAAGTTTTGTTGCACCT -3′ ( SEQ ID No: 1 ); Reverse primer sequence R1: 5'-CTCGGTAGCTTCTGGATTGAACT -3' (SEQ ID No: 2).
[0050] The nucleotide sequence of the primer SACp46 is: Forward primer sequence F2: 5′- TCAGATCAATAGCAATCAGAGGA-3′ ( SEQ ID No: 3); Reverse primer sequence R2: 5′-ACTATCCTTGTGCGACAATGTCTT-3′ (SEQ ID No: 4).
[0051] The nucleotide sequence of the primer SACp57 is: Forward primer sequence F3: 5′- CCCATGCAGAAAAGCTTGAT-3′ ( SEQ ID No: 5); Reverse primer sequence R3: 5′-CTGATCAATGTCAAGCCATCTAA-3′ (SEQ ID No: 6).
[0052] The nucleotide sequence of the primer SACp69 is: Forward primer sequence F4: 5′-GAGACCTGCTGAGATTTGTGTGT-3′ (SEQ ID No: 7); Reverse primer sequence R4: 5′- ATCTCTATCTGTCTCTCCCCGTC-3′ (SEQ ID No: 8).
[0053] The nucleotide sequence of the primer SACp165 is: Forward primer sequence F5: 5′- GGTCTTTTGAGATGCACAGCAAT -3′ ( SEQ ID No: 9); Reverse primer sequence R5: 5′-AGGCAATTGTGACTATCGTTGTT-3′ (SEQ ID No: 10).
[0054] The nucleotide sequence of the primer SACp231 is: Forward primer sequence F6: 5′- TTGGCACACTTTGTTTTGTTTTT-3′ ( SEQ ID No: 11 ); Reverse primer sequence R6: 5′-TCAGTTTGTGGGTTTCTTGAAT-3′ (SEQ ID No: 12).
[0055] The nucleotide sequence of the primer SACp237 is: Forward primer sequence F7: 5′- GCATGATGATAAGGAGCATGATT -3′ ( SEQ ID No: 13); Reverse primer sequence R7: 5′- CTTCGATCCCTCACTTTTGTTTA -3′ (SEQ ID No: 14).
[0056] Among them, the repeat sequence of the SSR marker primer numbered SACp34 is (ATAG)6, the repeat sequence of the SSR marker primer numbered SACp46 is (TG)7, the repeat sequence of the SSR marker primer numbered SACp57 is (CT)21, the repeat sequence of the SSR marker primer numbered SACp69 is (AC)12, the repeat sequence of the SSR marker primer numbered SACp165 is (TA)7, the repeat sequence of the SSR marker primer numbered SACp231 is (AG)11, and the repeat sequence of the SSR marker primer numbered SACp237 is (CA)10.
[0057] The 5' ends of the forward primer sequences F1-F7 can be modified with a 6-FAM fluorescent group to synthesize 7 pairs of fluorescent SSR primers for subsequent experiments.
[0058] Example 2: Method and application of determining polyploidy of Sabina using SSR primer combination Using the SSR marker primer compositions numbered SACp34, SACp46, SACp57, SACp69, SACp165, SACp231, and SACp237 obtained in Example 1, capillary electrophoresis was used to amplify the SSR molecular markers of 9 juniper and juniper varieties. The 9 variety resources were 8 juniper varieties, namely, 'Blue Tower Cypress', 'Wool Group Cypress', 'Peak Cypress', 'Golden Flower Cypress', 'Yunmig', 'Diecui', 'Menglin Lanbai', 'Menglin Zhongbai', and 1 Rocky Mountain juniper variety 'Blue Arrow' (National Forestry and Grassland Germplasm Resource Bank, platform resource number: 1111C0003115001070).
[0059] 1. DNA extraction and detection The genomic DNA of leaves of nine varieties was extracted by the modified CTAB method, and the purity and integrity of the extracted DNA were detected by 2.0% agarose gel electrophoresis.
[0060] 2. Synthesis of fluorescent primers The 5' ends of the forward primer sequences F1-F7 of the 7 pairs of juniper SSR marker primers developed in Example 1 were modified with a 6-FAM fluorescent group to synthesize 7 pairs of fluorescent SSR primers.
[0061] 3. PCR amplification of microsatellite fluorescent primers The reaction system of microsatellite fluorescence PCR was 20 μL, including 10 μL of PCR mix, 0.3 μL (20 μM) of forward primer with fluorescent group (i.e., the 5' end of the forward primer sequence F1-F7 was modified with 6-FAM fluorescent group), 0.3 μL (20 μM) of reverse primer, 2 μL of template DNA, and 7.4 μL of ddH2O.
[0062] The amplification program of microsatellite fluorescence PCR was as follows: pre-denaturation at 94°C for 5 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 60°C for 40 s, and extension at 72°C for 50 s, 10 cycles; denaturation at 94°C for 30 s, annealing at 53°C for 40 s, and extension at 72°C for 50 s, 27 cycles; and final extension at 72°C for 10 min.
[0063] 4. Capillary electrophoresis detection After formamide and molecular weight internal standard were mixed at a volume ratio of 100:1, 15 μL was taken and added to the sample plate, and then 1 μL of the PCR product obtained in step 3, which was diluted 10 times, was added. Then, capillary electrophoresis was performed using an ABI 3730XL fully automatic DNA sequencer, and the raw data obtained by the sequencer were analyzed using the Fragment (Plant) fragment analysis software in Genemarker. The position of the molecular weight internal standard in each lane was compared with the position of the peak of each sample to obtain the fragment size.
[0064] 5. Ploidy determination According to the peaks and fragment numbers obtained by SSR primer amplification, among the 7 pairs of SSR primers, SACp46 and SACp57 have more than 3 fragments in each variety, which can complete the determination of polyploidy alone, and can also be used with any other primer group for polyploidy determination. The combination of primer SACp34 and any of SACp46, SACp57, SACp69, and SACp231 can achieve polyploidy determination; the combination of SACp34, SACp165, and SACp237 cannot achieve polyploidy determination for "Menglin Lanbai" and "Menglin Zhongbai"; but the 7 pairs of primers can achieve polyploidy determination for all Juniperus individuals, as long as one of the primer pairs has 3 or more fragments in the individual, it can be determined as polyploid. The information on the number and size of fragments of the above 7 pairs of SSR primers in 9 varieties is shown in Table 2.
[0065] Table 2. Information on the number and size of fragments of 7 pairs of SSR primers in 9 varieties
[0066] In order to verify the effectiveness of the present invention, 'Yunmi' and 'Lanjian' were selected from the 9 varieties as materials, and chromosome karyotype analysis was performed. Through chromosome counting, it was found that 'Yunmi' had 44 chromosomes ( Figure 6 ), which is tetraploid; 'Blue Arrow' has 22 chromosomes and is diploid ( Figure 7 ).
[0067] From the results, it can be found that the control variety 'Blue Arrow' Rocky Mountain juniper is diploid with only 1-2 loci, while the juniper is polyploid with a larger number of loci. As long as one of the seven pairs of primers in the present invention has three or more fragments, the determination of the polyploidy of the juniper can be completed; at the same time, the primer combination of the present invention can also be used to identify and protect new varieties of juniper.
[0068] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.
Claims
1. The SSR molecular marker primer composition of Sabina juniper, characterized in that: The composition includes at least one of seven pairs of primers, the seven pairs of primers are named SACp34, SACp46, SACp57, SACp69, SACp165, SACp231, and SACp237, and the nucleotide sequences of the seven pairs of primers are shown in SEQ ID No: 1-SEQ ID No:
14.
2. A kit, characterized in that: The kit comprises the SSR molecular marker primer composition according to claim 1.
3. A DNA chip, characterized in that The DNA chip comprises the SSR molecular marker primer composition according to claim 1.
4. The SSR molecular marker primer composition according to claim 1 is used in any of the following applications: m1) Ploidy analysis, identification and / or classification of the genus Sabina; m2) Analysis of genetic diversity and / or genetic structure of Sabina; m3) Analysis and identification of the relationship between the genus Sabina; m4) Molecular marker-assisted breeding of Sabina; m5) Protection and utilization of Sabina germplasm resources; m6) Preparation of products for identification and / or classification of the genus Sabina; m7) Preparation of products for analysis of genetic diversity and / or genetic structure of the genus Sabina; m8) Preparation of products for analysis and identification of phylogenetic relationships of the genus Sabina; m9) Preparation of products for molecular marker-assisted breeding of Sabina; m10) Preparation of products for the protection and utilization of Sabina germplasm resources.
5. The kit according to claim 2 is used in any of the following applications: m1) Ploidy analysis, identification and / or classification of the genus Sabina; m2) Analysis of genetic diversity and / or genetic structure of Sabina; m3) Analysis and identification of the relationship between the genus Sabina; m4) Molecular marker-assisted breeding of Sabina; m5) Protection and utilization of Sabina germplasm resources; m6) Preparation of products for identification and / or classification of the genus Sabina; m7) Preparation of products for analysis of genetic diversity and / or genetic structure of the genus Sabina; m8) Preparation of products for analysis and identification of phylogenetic relationships of the genus Sabina; m9) Preparation of products for molecular marker-assisted breeding of Sabina; m10) Preparation of products for the protection and utilization of Sabina germplasm resources.
6. The DNA chip according to claim 3 is used in any of the following applications: m1) Ploidy analysis, identification and / or classification of the genus Sabina; m2) Analysis of genetic diversity and / or genetic structure of Sabina; m3) Analysis and identification of the relationship between the genus Sabina; m4) Molecular marker-assisted breeding of Sabina; m5) Protection and utilization of Sabina germplasm resources; m6) Preparation of products for identification and / or classification of the genus Sabina; m7) Preparation of products for analysis of genetic diversity and / or genetic structure of the genus Sabina; m8) Preparation of products for analysis and identification of phylogenetic relationships of the genus Sabina; m9) Preparation of products for molecular marker-assisted breeding of Sabina; m10) Preparation of products for the protection and utilization of Sabina germplasm resources.
7. A method for analyzing the ploidy of Sabina using the SSR molecular marker primer composition of claim 1, characterized in that: The method comprises: using the genomic DNA of the juniper to be tested as a template, performing PCR amplification using the SSR molecular marker primer composition of claim 1 to obtain a PCR amplification product, performing electrophoresis detection on the PCR amplification product, and performing polyploidy determination analysis of the genus Juniper based on the electrophoresis detection result.
8. The method according to claim 7, characterized in that The PCR amplification program was as follows: pre-denaturation at 94°C for 5 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 60°C for 40 s, and extension at 72°C for 50 s, 10 cycles; denaturation at 94°C for 30 s, annealing at 53°C for 40 s, and extension at 72°C for 50 s, 27 cycles; and final extension at 72°C for 10 min.