KASP molecular markers associated with maize ear length traits under drought conditions and their application

Abstract

The present invention provides a KASP molecular marker related to corn ear length trait under drought conditions and its application, belonging to the technical field of molecular genetics. The present invention obtains a polymorphic SNP marker site related to the ear length trait under drought conditions through genome-wide association analysis. The SNP marker site refers to the corn B73 RefGen_v4 genome and has a nucleotide polymorphism C / T at position 28374318 of chromosome 2, T is a dominant trait, and the nucleotide sequence of the primer set for amplifying the KASP molecular marker is shown in SEQ ID NO.1-3. The present invention develops a new molecular marker for corn ear length, which can be quickly genotyped using the KASP typing technology, has accurate and efficient detection, convenient and stable amplification, can be used for molecular marker-assisted selection, and plays a very important role in predicting, identifying or assisting in identifying ear length or breeding new corn varieties with longer ear length.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular genetics, and in particular relates to a KASP molecular marker associated with corn ear length traits under drought conditions and an application thereof. Background Art

[0002] corn( Zea mays L.) is an annual grass plant, an important food crop in my country, and an important source of animal feed and industrial raw materials. It has a wide range of uses and plays an important role in daily life and industrial production. In recent years, under the background of global warming, global climate change has been obvious, extreme weather has occurred frequently, and droughts have occurred frequently in some areas, which are becoming increasingly serious. Some major corn producing areas have the characteristics of large evaporation, rapid loss and uneven precipitation, which cause great damage to corn production. Drought stress is an important abiotic stress that has an adverse effect on corn production. How to ensure corn yield under drought conditions has attracted much attention from breeders. As an important component of corn yield, increasing ear length can increase the number of grains per ear, thereby promoting single ear yield and total yield. Appropriately increasing ear length can increase yield and play an important role in improving yield traits. Therefore, developing new corn varieties with longer ear length under drought conditions is an effective measure to mitigate the negative impact of drought and is crucial to ensuring global food security.

[0003] Genome wide association study (GWAS) is a reliable method to efficiently detect genetic variation of complex traits in different species and to find markers or genes associated with them. This method has been used to study complex traits caused by a large number of genetic variations in different populations and helps to determine the connection between phenotypic information and genetic background. The development of SNP molecular markers associated with corn ear length under drought conditions through GWAS technology provides an effective molecular tool for precision breeding of corn. Summary of the invention

[0004] The technical problem to be solved by the present invention is to develop a KASP molecular marker related to corn ear length under drought conditions and its application to solve the problems existing in the above-mentioned prior art. In the field of corn molecular genetics technology, it can be used to screen new corn varieties with longer ear length in the seedling stage.

[0005] Specifically, the present invention uses genome-wide association analysis to obtain a SNP site SNP_Chr2_28374318 that is significantly associated with corn ear length under drought conditions, and its -LOG 10 The (P.value) value is 4.3. The site is located at 28374318 of chromosome 2 of the maize B73RefGen_v4 reference genome. Its nucleotide polymorphism is C / T. Zm00001d002971At the -146bp promoter position of the gene (Chr2: 28374464-28376302), in the tested corn materials, the polymorphism of this SNP site was significantly associated with ear length.

[0006] The KASP molecular marker of the present invention is located at the 28374318th base of chromosome 2 of maize, and the base difference is C / T. The maize with base T has a longer ear length, and the maize with base C has a shorter ear length. When T is expressed as a polymorphism, it is a dominant trait.

[0007] The present invention also provides a KASP primer set for identifying corn ear length under drought conditions, comprising two specific forward primers and a universal reverse primer; the nucleotide sequences of the two specific forward primers are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.3, and the primer sequences are as follows:

[0008] SNP_Chr2_28374318_F1 (SEQ ID NO.1):

[0009] 5'- GAAGGTGACCAAGTTCATGCT CACAGGAGATCAAAATACTAAACTC -3',

[0010] SNP_Chr2_28374318_F2 (SEQ ID NO.2):

[0011] 5'- GAAGGTCGGAGTCAACGGATT CACAGGAGATCAAAATACTAAACTT -3',

[0012] SNP_Chr2_28374318_R (SEQ ID NO.3):

[0013] 5'-CTACACAAATATAGTGCGATCACGAATTG-3',

[0014] in, GAAGGTGACCAAGTTCATGCT It is a universal tag for FAM fluorescent linker sequence; GAAGGTCGGAGTCAACGGATT It is a universal tag for HEX fluorescent linker sequences.

[0015] The present invention also provides applications of the above-mentioned KASP molecular marker and KASP primer set, specifically including but not limited to any of the following applications:

[0016] (1) Identify and select corn varieties with longer ear length under drought conditions;

[0017] (2) Maize molecular marker-assisted breeding;

[0018] (3) Improve corn germplasm resources;

[0019] (4) Detect and predict corn ear length under drought conditions.

[0020] The present invention also provides a product containing the KASP primer combination, and the product is a detection reagent or a kit.

[0021] The present invention also provides a method for identifying corn ear length and a method for corn genotyping, which uses corn DNA to be detected as a template, utilizes the KASP primer combination, and determines the corn ear length trait and the corn genotyping according to the fluorescence detection result after primer amplification.

[0022] The specific steps include:

[0023] Extract the corn DNA to be tested; dilute the DNA template to 30 ng / uL, add KASP 2X PCR mix, use the primer set to perform ordinary PCR amplification on the template, and use fluorescent quantitative PCR to read the amplification results to determine the corn ear length.

[0024] Preferably, the amplification reaction system, in 10 μL, includes: 5 μL of KASP 2X PCR mix, 0.5 μL of primer premix, and 4.5 μL of template DNA.

[0025] Preferably, the PCR amplification program is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing and extension at 61°C for 60 s, 10 cycles, each annealing and extension temperature is reduced by 0.6°C; denaturation at 95°C for 15 s, annealing and extension at 55°C for 60 s, 30 cycles; fluorescence quantitative PCR at 37°C for 60 s, collecting fluorescence signals.

[0026] In the present invention, if the universal tag detected is a FAM fluorescent linker sequence, it is a CC genotype, and the corresponding corn material has a shorter ear length; if the universal tag detected is a HEX fluorescent linker sequence, it is a TT genotype, and the corresponding corn material has a longer ear length; if the fluorescent linker sequences of the universal tags FAM and HEX are detected at the same time, it is a CT genotype, and the ear length of the corresponding corn material is at an intermediate level.

[0027] Beneficial effects of the present invention:

[0028] The present invention obtains a polymorphic SNP marker site related to the ear length trait under drought conditions through whole genome association analysis. The SNP marker site refers to the corn B73 RefGen_v4 genome and has a nucleotide polymorphism C / T at position 28374318 of chromosome 2, and T is a dominant trait.

[0029] The present invention develops a new molecular marker for corn ear length, which can quickly perform genotyping using the KASP typing technology, has accurate and efficient detection, convenient and stable amplification, can be used for molecular marker-assisted selection, and plays a very important role in predicting, identifying or assisting in identifying ear length or breeding new corn varieties with longer ear length. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The results of genome-wide association analysis of ear length traits of maize under drought stress conditions, Manhattan plot and QQ plot based on Blink model analysis.

[0031] Figure 2 This is a box plot of the haplotype analysis of ear length corresponding to different genotypes at the SNP_Chr2_28374318 site in 196 multi-parent DH lines.

[0032] Figure 3 The KASP genotyping results of ear length of 10 maize materials; each material was repeated twice, the horizontal axis represents the genotype TT, represented by triangles; the vertical axis represents the genotype CC, represented by squares; a control NTC is represented by ×. DETAILED DESCRIPTION

[0033] In order to better understand the technical content of the present invention, the development and application of a KASP molecular marker related to corn ear length trait under drought conditions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be understood as limiting the scope of protection of the present invention.

[0034] The corn materials used in the present invention can all be obtained from the College of Agriculture of China Agricultural University.

[0035] Unless otherwise specified, the technical means used in the examples are all conventional methods. The reagents used in the examples, unless otherwise specified, can be obtained from commercial channels.

[0036] Example 1 GWAS analysis and haplotype analysis of spike length traits

[0037] 1.1 Field experiment design

[0038] The DH population used in the present invention is a total of 196 high-quality maize inbred lines collected from various breeding units across the country, with rich genetic backgrounds and wide sources. In 2020, the test materials were planted in Urumqi, Xinjiang and Yulin, Shaanxi, respectively, and two treatments were set up: water area (normal irrigation) and drought area (half-quantity irrigation). The amount of water in the drought area was half of that in the water area. The field test adopted an alpha design, with two rows planted in each plot and repeated twice. Except for the water treatment, the rest of the field management remained consistent.

[0039] 1.2 Phenotypic data

[0040] The present invention selects the ear length trait of corn, randomly selects 8 corn plants with normal ear development in each plot, and measures the average length from the base to the top of the corn ear, expressed in centimeters (cm). The R package lmer is used to perform BLUE estimation on the ear length data under drought conditions, and the analysis model is:

[0041] .

[0042] 1.3GWAS analysis and SNP site determination

[0043] After resequencing quality control, 176,675 high-quality SNPs data were obtained from 196 multi-parent DH materials. Combined with the above-mentioned maize ear length phenotypic values, GWAS analysis was performed using the Blink model of the R package GAPIT. The threshold was corrected by Bonferroni, and -LOG 10 (P.value) = 4 was used as the threshold to determine the significantly associated SNPs. The results obtained were a significant locus located on chromosome 2 SNP_Chr2_28374318 (see the specific results for details). Figure 1 ), this site is significantly associated with the ear length of corn, and its nucleotide polymorphism is C / T. 10 The (P.value) value is 4.3. The information of this SNP is shown in Table 1.

[0044] Table 1 Information on significant association loci related to maize ear length traits

[0045]

[0046] 1.4 Haplotype analysis

[0047] Haplotype analysis combining SNP variant sites with ear length traits of 196 tested maize materials ( Figure 2 ). Among them, SNP site variation typing is divided into two categories. Specifically combined with the base C / T difference, 180 materials with genotype CC have shorter ear length, and 16 materials with genotype TT have longer ear length. The difference analysis between the two haplotypes and the phenotypic ear length is 0.035, which is significantly different (P<0.05). The ear length of the TT genotype is significantly higher than that of the CC genotype corn materials.

[0048] Example 2 Development and application of KASP molecular markers related to ear length traits

[0049] 2.1 Test materials

[0050] The developed KASP molecular markers were used to verify the accuracy of the 10 selected materials with obvious differences in core ear length. The specific information of the materials used is shown in Table 2, including 4 materials with longer ear length and 6 materials with shorter ear length.

[0051] Table 2 Ear length data and genotypes of 10 maize materials

[0052]

[0053] 2.2 Development of KASP Marker

[0054] According to the SNP site information obtained above, there is a SNP mutation at position 28374318 of chromosome 2 of the reference genome B73 RefGen_v4, and the polymorphism is C / T. The 100bp flanking sequence before and after the site is extracted and primers are designed. The KASP molecular marker consists of 3 primers, including 2 specific forward primers SEQ ID NO.1 and SEQ ID NO.2, and 1 universal reverse primer SEQ ID NO.3. The primers were commissioned to Shanghai Bioengineering for synthesis. The primer sequences are as follows:

[0055] SNP_Chr2_28374318_F1 (SEQ ID NO.1):

[0056] 5'- GAAGGTGACCAAGTTCATGCT CACAGGAGATCAAAATACTAAACTC -3',

[0057] SNP_Chr2_28374318_F2 (SEQ ID NO.2):

[0058] 5'- GAAGGTCGGAGTCAACGGATT CACAGGAGATCAAAATACTAAACTT -3',

[0059] SNP_Chr2_28374318_R (SEQ ID NO.3):

[0060] 5'-CTACACAAATATAGTGCGATCACGAATTG-3',

[0061] in, GAAGGTGACCAAGTTCATGCT It is a universal tag for FAM fluorescent linker sequence; GAAGGTCGGAGTCAACGGATT It is a universal tag for HEX fluorescent linker sequences.

[0062] 2.3 DNA extraction

[0063] Ten fresh leaves of corn seedlings were used as materials and DNA was extracted using the CTAB method. The detailed steps are as follows:

[0064] (1) Take about 5 g of corn leaves, place them in a 2 mL centrifuge tube, add 2 sterilized steel balls, freeze them in liquid nitrogen, and quickly place them in an automatic sample grinder, and shake them for 30 seconds;

[0065] (2) Add 800 ul of heated CTAB buffer (with mercaptoethanol added), stir gently and shake well;

[0066] (3) Place in a 65°C water bath, invert the sample every 10 minutes to mix, and remove after 30 minutes;

[0067] (4) After the sample is taken out and cooled to a constant temperature, add 800 ul of chloroform:isoamyl alcohol (24:1), shake and mix, and centrifuge at 12000 rpm for 15 min;

[0068] (5) Pipette the supernatant into a new 2 ml centrifuge tube, add 600 μl of isopropanol, shake well, and place at -20°C for 20 min. Centrifuge at 4°C, 12,000 rpm for 15 min.

[0069] (6) Add 800 μl of 70% ethanol to suspend the precipitate; centrifuge at 12,000 rpm for 10 min at room temperature;

[0070] (7) Discard the supernatant and add 1 ml of anhydrous ethanol to suspend the precipitate. Centrifuge at 12,000 rpm for 10 min. Open the lid and wait for the residual ethanol to evaporate at room temperature. Add 50 μL of ddH2O to dissolve the DNA.

[0071] (8) Agarose electrophoresis: DNA integrity was detected by 1% agarose gel (60 V electrophoresis for 35 min). The concentration of all DNA samples was measured by NanoDrop and the OD value 260 / 280 ratio was evaluated to be between 1.8 and 2.0.

[0072] 2.4 KASP classification

[0073] The DNA concentration of the samples to be tested was diluted to 30 ng / ul, and each DNA sample was repeated twice for KASP typing. KASP molecular marker PCR amplification reaction system: KASP 2X PCR mix 5 μL, primer premix 0.5 μL (primers SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 with a concentration of 10 μM were mixed in a volume ratio of 2:2:5), template DNA 4.5 μL, total reaction volume 10 μL;

[0074] The PCR amplification procedure was as follows: pre-denaturation at 95 °C for 10 min; the first step of amplification reaction was denaturation at 95 °C for 15 s, annealing and extension at 61 °C for 60 s, and cycled 10 times, with the annealing and extension temperature decreasing by 0.6 °C each time; the second step of amplification reaction was denaturation at 95 °C for 15 s, annealing and extension at 55 °C for 60 s, and cycled 30 times.

[0075] After the reaction, the PCR product was obtained and the fluorescence was collected at 37 degrees using QuantStudioTM Design Analysis Software v1.5.2 real-time fluorescence quantitative PCR instrument, and the PCR product was typed. The typing results were compared with the resequencing variation results of the SNP_Chr2_28374318 site, and it was found that the consistency rate between the site variation type detected by the KASP molecular marker and the resequencing variation results was 100%, indicating that the KASP marker for this SNP site was successfully developed ( Figure 3 ).

[0076] According to the color classification displayed by the fluorescence quantitative PCR instrument, the samples aggregated close to the X-axis are the genotype TT connected to the HEX fluorescent label sequence, which is displayed in red and represented by a triangle; the samples aggregated close to the Y-axis are the CC genotype connected to the FAM fluorescent label sequence, which is displayed in blue and represented by a square, and the control NTC is represented by ×.

[0077] The actual situation is consistent with the expectation, so the KASP molecular marker of the present invention can effectively identify the corn ear length trait and can be used for the prediction and screening of corn varieties with longer ear length under drought conditions.

[0078] Of course, the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by ordinary technicians in this technical field within the essential scope of the present invention should fall within the protection scope of the present invention.

Claims

1. Use of a reagent for detecting KASP molecular markers associated with corn ear length traits under drought conditions in any of the following: (1) Identify and select corn varieties with longer ear length under drought conditions; (2) Molecular marker-assisted breeding of maize ear length; (3) Germplasm resources for improving corn ear length; (4) Detect and predict corn ear length under drought conditions; It is characterized in that The SNP marker site of the KASP molecular marker is named SNP_Chr2_28374318. The molecular marker is developed for the reference genome of maize B73 RefGen_v4 and is located at 28374318 of chromosome 2. Its nucleotide polymorphism is C / T. If the genotype of the SNP marker site of the corn plant is TT, the ear length is longer; if the genotype of the SNP marker site of the corn plant is CT, the ear length is at an intermediate level; if the genotype of the SNP marker site of the corn plant is CC, the ear length is shorter.

2. A method for identifying corn ear length traits under drought conditions, characterized in that: The following steps are involved: Extracting DNA from corn samples to be tested; Using the DNA as a template, using a KASP primer set, adding a KASP genotyping mixture, and configuring a KASP reaction system, PCR amplification is performed, and fluorescence detection is performed based on the obtained PCR amplification product to determine the ear length and genotyping of the corn, and data is read and exported; If the amplification result shows that the genotype of the SNP marker site of claim 1 is TT, the ear length of the corn material to be tested is longer; If the genotype of the SNP marker site is CT, the ear length of the corn material to be tested is at an intermediate level; if the genotype of the SNP marker site is CC, the ear length of the corn material to be tested is short; The KASP primer set includes two specific forward primers and a universal reverse primer; the nucleotide sequences of the two specific forward primers are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.

3.

3. The method according to claim 2, characterized in that The amplification reaction system includes: 5 μL of KASP 2X PCRmix, 0.5 μL of primer premix, and 4.5 μL of template DNA; the PCR amplification program is: pre-denaturation at 95°C for 10 minutes; denaturation at 95°C for 15 seconds, annealing and extension at 61°C for 60 seconds, and 10 cycles, with the annealing and extension temperature decreasing by 0.6°C each time; denaturation at 95°C for 15 seconds, annealing and extension at 55°C for 60 seconds, and 30 cycles; fluorescence quantitative PCR at 37°C for 60 seconds, and collecting fluorescence signals.

Images