Damage-inducible strong promoter LAP35S and preparation method thereof

Abstract

The invention discloses a damage inducible strong promoter LAP35S and a preparation method thereof, and belongs to the technical field of plant molecular biology and genetics. The damage inducible strong promoter LAP35S is formed by sequentially connecting a primer sequence 1, a response module repetitive sequence 1, a link sequence 1, a response module repetitive sequence 2, a link sequence 2, a response module repetitive sequence 3 and a minimum 35S promoter from left to right. According to the invention, damage response elements in LAP gene promoters are connected in series and then fused with a minimum 35S promoter, so that a strong expression promoter capable of specifically responding to mechanical damage is designed, and the defect of overexpression of strong promoters commonly used in current plant genetic engineering at non-insect damage parts such as fruit seeds is overcome; the sustainable development and public acceptability of transgenic insect-resistant crops can be improved.

Description

Technical Field

[0001] The invention belongs to the technical field of plant molecular biology and genetics, and specifically relates to a damage-inducible strong promoter LAP35S and a preparation method thereof. Background Art

[0002] Insect pests are a major challenge faced by agricultural production. Although chemical pesticides can effectively control pests and reduce the damage of pests to crops, they also have multiple problems such as polluting the environment and causing pest resistance. Using genetic engineering technology, the insect-resistant gene from Bacillus thuringiensis (Bt) is integrated into the crop genome to obtain transgenic crops with insect-resistant properties, which is of great significance to improving the quality and safety of agricultural products, promoting sustainable agricultural development, and protecting the ecological environment. The purpose of insect-resistant crops obtained by genetic modification includes reducing the use of pesticides or even eliminating the need for pesticide spraying crops, thereby reducing the potential toxic effects of pesticide residues on the human body. For example, patent CN108624599A discloses an application of rice OsWRKY21 transcription factor gene in improving plant insect resistance. The invention obtains the OsWRKY21 transcription factor gene sequence by PCR technology, connects it with a suitable plant expression vector, and then introduces the gene fragment into the young embryo of indica rice by gene gun transformation and Agrobacterium transformation to integrate and express, thereby obtaining rice with insect resistance.

[0003] Although scientific studies have shown that Bt proteins are highly specific, only target specific insects, and are safe for human health, the public still has great doubts about the long-term impact of genetically modified foods. Insect-resistant crops often use strong expression promoters (such as 35S, UBQ, etc.) to achieve the effect of high-dose constitutive expression of insect-resistant proteins. However, this also makes insect-resistant genes excessively present in agricultural products (such as seeds and fruits), which further aggravates the public's resistance to genetically modified insect-resistant crops. The 35S promoter was cloned from the plant pathogen cauliflower mosaic virus (CaMV). In addition to being used for constitutive expression of genes, the unique modular structural characteristics of the 35S promoter also allow it to be used as an important skeleton for designing different transcription control systems, ultimately achieving the induction or inhibition of target gene expression in transgenic plants. The base sequence of the 35S promoter spanning the -46bp to +1bp segment is called the "minimum 35S promoter", which can induce its transcriptional activity after inserting an enhancing element upstream. The minimum 35S promoter containing the TATA-box has been widely used in the development of transcription control systems for plant transgenic expression. The tomato leucine aminopeptidase (LAP) gene can be activated by mechanical damage or damage response factors. Previous studies have reported that the base sequence of 317bp before the start codon of LAP family members LAP17.1A and 17.2 is highly conserved and can specifically respond to the treatment of the damage signal molecule methyl jasmonate. Therefore, how to design a strong promoter that responds quickly to pest gnawing, and then obtain transgenic crops with local expression of insect-resistant genes, and enhance the public's acceptance of transgenic crops, is of great significance for improving the application of transgenic crops. Summary of the invention

[0004] In view of the deficiencies of the prior art, the present invention designs a strong expression promoter that can specifically respond to mechanical damage by connecting the damage response element in the LAP gene promoter in series and fusing it with the minimal 35S promoter. Specifically, the technical solution of the present invention includes the following contents:

[0005] A damage-induced strong promoter LAP35S, which is composed of a primer sequence 1, a response module repeat sequence 1, a linker sequence 1, a response module repeat sequence 2, a linker sequence 2, a response module repeat sequence 3 and a minimum 35S promoter connected in sequence from left to right.

[0006] Furthermore, the nucleotide sequence of the damage-inducible strong promoter LAP35S is shown in SEQ ID NO:1.

[0007] Furthermore, the nucleotide sequence of the primer sequence 1 is shown in SEQ ID NO:2.

[0008] Furthermore, the primer sequence is derived from the first 21 bp bases of the tomato LAP17.1A response module.

[0009] Furthermore, the nucleotide sequences of the response module repeating sequence 1, the response module repeating sequence 2 and the response module repeating sequence 3 are completely the same, and the nucleotide sequences are shown in SEQ ID NO:3.

[0010] Furthermore, the nucleotide sequences of the response module repeat sequence 1, the response module repeat sequence 2 and the response module repeat sequence 3 are derived from the tomato LAP17.1A gene promoter, and the tomato LAP17.1A gene promoter contains an enhancer CAAT Box site and an ABRE response element that responds to abscisic acid.

[0011] Furthermore, the nucleotide sequence of the linking sequence 1 is shown in SEQ ID NO:4.

[0012] Furthermore, the linker sequence 1 is derived from the promoter of the Arabidopsis thaliana damage response gene PW220.

[0013] Furthermore, the nucleotide sequence of the linker sequence 2 is shown in SEQ ID NO:5.

[0014] Furthermore, the linker sequence 2 is derived from the promoter of the Arabidopsis thaliana damage response gene PW220.

[0015] Furthermore, the nucleotide sequence of the minimal 35S promoter is shown in SEQ ID NO:6.

[0016] Furthermore, the site position of the minimal 35S promoter is -46 bp to +1 bp of the 35S full-length promoter.

[0017] A method for preparing a damage-inducible strong promoter LAP35S, the method comprising using PlantCARE to perform bioinformatics analysis on selected response module repeat sequence 1, response module repeat sequence 2, response module repeat sequence 3, link sequence 1 and link sequence 2, then arranging them in order according to primer sequence 1, response module repeat sequence 1, link sequence 1, response module repeat sequence 2, link sequence 2, response module repeat sequence 3 and minimum 35S promoter, and entrusting a biological company to synthesize them.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention fuses the response module repeat sequence 1, response module repeat sequence 2, and response module repeat sequence 3 of three tandem LAP17.1A gene promoters with the minimum 35S promoter to form a damage-inducible strong promoter LAP35S that can specifically respond to mechanical damage. Based on a large number of experiments, it was found that the damage-inducible strong promoter LAP35S can efficiently obtain positive transgenic plants, can quickly respond to external mechanical damage and has a high expression level, while the expression level in non-damaged plant tissues is low. Therefore, the damage-inducible strong promoter LAP35S of the present invention makes up for the defect of the strong promoter commonly used in current plant genetic engineering that is over-expressed in non-insect-damaged parts such as fruits and seeds, and is beneficial to improving the sustainable development and public acceptance of transgenic insect-resistant crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 is the nucleotide sequence of the damage-inducible strong promoter LAP35S of the present invention;

[0021] Figure 2 This is a schematic diagram of the tandem structure of the damage-inducible strong promoter LAP35S of the present invention;

[0022] Figure 3 This is a result diagram of the present invention detecting the response of the damage-inducible strong promoter LAP35S to different leaf damage durations through GUS staining;

[0023] Figure 4 This is a graph showing the relative quantitative expression results of the damage-inducible strong promoter LAP35S in response to different leaf damage durations detected by qPCR in the present invention. DETAILED DESCRIPTION

[0024] The technical solution of the present invention will be clearly and completely described below through the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0025] Unless otherwise specified, the raw materials and reagents used in the present invention are commercially available or can be prepared by known methods.

[0026] Example:

[0027] A preparation of a damage-inducible strong promoter LAP35S specifically includes the following steps:

[0028] (1) Base sequence pre-design:

[0029] A promoter fragment of the tomato LAP17.1A gene promoter that is conserved with homologous genes and can respond to mechanical damage was selected, and then the sequence of the selected promoter fragment was subjected to bioinformatics analysis to find and select sequences containing enhancer CAAT Box sites and ABRE response elements that respond to abscisic acid, and a sequence containing 4 enhancer CAAT Box sites and 2 ABRE response elements that respond to abscisic acid and a span of -317 bp to -78 bp before the start codon of the LAP17.1A gene was determined as the base sequence of response module repeat sequence 1, response module repeat sequence 2 and response module repeat sequence 3, and the base sequence is shown in SEQ ID NO: 3.

[0030] The link sequence is selected from the Arabidopsis thaliana early damage response gene PW220 (AT5G13220), the PW220 gene promoter sequence is selected, the promoter is analyzed using PlantCARE, and a base sequence with an ABRE response element and a size of 30 bp is selected as the link sequence. Among them, the link sequence 1 used to connect the response module repeat sequence 1 and the response module repeat sequence 2 is shown in SEQ ID NO: 4, and the link sequence 2 used to connect the response module repeat sequence 2 and the response module repeat sequence 3 is shown in SEQ ID NO: 5.

[0031] The minimal 35S promoter is derived from -46 bp to +1 bp of the 35S full-length promoter, and the nucleotide sequence size is 47 bp. The nucleotide sequence is shown in SEQ ID NO:6.

[0032] In order to achieve cloning, a specific primer sequence 1 is added before the response module repeat sequence 1. The primer sequence is taken from the first 21 bp bases of the tomato LAP17.1A response module, and the sequence is shown in SEQ ID NO: 2.

[0033] (2) Preparation of the damage-inducible strong promoter LAP35S:

[0034] The above-selected primer sequence 1, response module repeat sequence 1, linker sequence 1, response module repeat sequence 2, linker sequence 2, response module repeat sequence 3 and minimum 35S promoter were placed in order from left to right and commissioned to a biological company to obtain the damage-inducible strong promoter LAP35S using a fully automatic DNA synthesizer based on the phosphoramidite synthesis method.

[0035] Verification example:

[0036] Verification of the response effect of the damage-inducible strong promoter LAP35S specifically includes the following processes:

[0037] (1) Construction of expression vector:

[0038] Step 1: Entrust a biological company to synthesize the full-length sequence of the damage-inducible strong promoter LAP35S. Use the synthesized pUC57-LAP35S as a template, use the forward primer LAP35S-F: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTCGCATCGCAGAATTGAAGTGTCTAAGC-3' and the reverse primer LAP35S-R5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCCTCTCCAAATGAAATGAACTTCCT-3' to amplify the damage-inducible strong promoter LAP35S sequence, and use Gateway BPClonase II enzyme to connect the amplified damage-inducible strong promoter LAP35S sequence to pDNOR / ZEO + The vector was obtained as pDNOR-LAP35S, and the reaction system used was: 0.5 μL of pDNOR / ZEO + vector, 1.5 μL of LAP35S clone recovery fragment and 0.5 μL of Gateway BP Clonase II enzyme.

[0039] Step 2: Transform the incubated vector using DH5α competent medium, select monoclonal colonies with bleomycin resistance, and use a plasmid mini-preparation kit to obtain the pDNOR-LAP35S plasmid. After correct sequencing, use Gateway LR ClonaseII enzyme to recombinant the target fragment into the pBIB-GUS vector. The reaction system used is: 1μL of pDNOR-LAP35S plasmid, 1μL of pBIB-GUS vector and 0.5μL of Gateway LR Clonase II enzyme.

[0040] Step 3: Use kanamycin sulfate at a concentration of 50 μg / mL to screen positive clone plaques of the pBIB-LAP35S::GUS vector, and use LAP35S-F / R primers to identify positive plaques.

[0041] (2) Detection of the expression efficiency of the damage-inducible strong promoter LAP35S in transgenic plants:

[0042] Step 1: Extract the plasmid from the correctly identified monoclonal strain, and then transform it into Agrobacterium tumefaciens competent cells, and screen the positive colonies using YEP medium supplemented with 25 μg / mL rifampicin and 50 μg / mL kanamycin sulfate.

[0043] Step 2: Genetically transform Col-0 Arabidopsis using the floral dipping method, specifically: prepare a sucrose solution (5%, w / v) containing 20,000 parts (v / v) of Silwet L-77, use the solution to resuspend Agrobacterium carrying the pBIB-LAP35S::GUS vector, adjust OD600=0.5, use the bacterial solution to soak Arabidopsis buds at the flowering stage, and then place the infected Arabidopsis in a dark place for 24 hours. Harvest the infected Arabidopsis seeds, and use 1% glufosinate (Basta) to screen the F1 generation of positive transgenic Arabidopsis.

[0044] Step 3: Randomly select 50 independent F1 generation Arabidopsis plants that have grown for about 40 days, use scissors to cut the 5th or 6th rosette leaves from the middle of the leaves, wait for 10 hours and then remove the damaged leaves, and use GUS staining solution (0.5mM K3Fe(CN)6, 0.5mM K4Fe(CN)6·3H2O, 57.7mM Na2HPO4, 42.3mM NaH2PO4, 100mM EDTA·Na2 (pH 8.0), 0.1% Triton X-100 (V / V), 10% methanol (V / V), 0.1% X-Gluc (W / V)) to stain for 6 hours at 37°C in the dark. Then use decolorizing solution (glacial acetic acid: ethanol = 1:3) at room temperature for 24 hours to remove the chlorophyll on the leaves. The decolorized Arabidopsis leaves are placed in a 20% ethanol solution for a short time.

[0045] Step 4: Use Zeiss stereo microscope to detect the staining of the damaged part. The results showed that 45 transgenic Arabidopsis leaves had obvious staining at the damaged part, accounting for 90%, of which 39 plants had obvious staining at the damaged part and almost no staining at the non-damaged part (with response and light staining background), accounting for 78%, and 6 plants had obvious staining at both the damaged and non-damaged parts (with response but dark staining background), accounting for 12%. There were 5 plants without staining, accounting for 10% (see Table 1 below).

[0046]

[0047] Table 1

[0048] The above results indicate that the damage-inducible strong promoter LAP35S has higher expression efficiency and weaker background expression characteristics.

[0049] (3) GUS staining was used to detect the response characteristics of the damage-inducible strong promoter LAP35S to different leaf damage durations:

[0050] Step 1: Select three plant strains with good response to damage staining and low expression background from the F1 transgenic Arabidopsis strains tested above, and name them GUS-1#, GUS-2#, and GUS-3#. Obtain T1 homozygous transgenic Arabidopsis materials through propagation and Basta screening. When screening transgenic materials, the Basta concentration used on the MS plate is 10 mg / L.

[0051] Step 2: Select transgenic Arabidopsis plants grown in a greenhouse (24°C, 16h light / 8h dark, 65% humidity and 2000lm light intensity) for 35 days, in good condition and free of insects. Use scissors to cut the fifth or sixth half-side rosette leaves to achieve the purpose of mechanical damage. Select leaves 0min, 20min, 2h and 10h after cutting.

[0052] Step 3: At 37°C, the selected leaves were stained with GUS staining solution for a fixed staining time of 6 hours, and then decolorized with decolorizing solution for 24 hours. The decolorized leaves were placed in 20% ethanol for a short period of time.

[0053] Step 4: Use a stereoscope to observe the GUS staining of the damaged area. The results showed that there was no obvious staining at the damaged area of ​​the three selected plants at 0min and 20min after injury. In the 2h and 10h samples, obvious GUS staining could be found at the damaged area, and the 2h and 10h treatment time points showed that the GUS-1# staining intensity was less than the GUS-2# staining intensity and less than the GUS-3# staining intensity (see the results). Figure 3 ). In addition, we also found weak GUS staining at the serrations on the leaf margins.

[0054] (4) qPCR was used to detect the response characteristics of the damage-inducible strong promoter LAP35S at the transcriptional level to different leaf damage durations:

[0055] Step 1: Material selection and processing are the same as steps 1 and 2 in the above implementation method (3).

[0056] Step 2: Immediately freeze the removed leaves in liquid nitrogen and transfer to a -80°C refrigerator half an hour later for subsequent RNA extraction.

[0057] Step 3: Use RNeasy Plant Mini Kit: (QIAGEN, California, USA) to extract total RNA from the plant material, and the operation method is based on the instructions provided by the kit. Use RNase-free DNase I (Novozyme, Nanjing) to remove genomic DNA residues in RNA. Use HiScript III 1st Strand cDNA Synthesis Kit (Novozyme, Nanjing) to reverse transcribe mRNA into cDNA for subsequent qPCR. The above reaction system is strictly in accordance with the instructions of the kit.

[0058] Step 4: Use Roche LC96 fluorescence quantification instrument to detect the expression characteristics of GUS gene at different treatment time. The reaction system is: 10 μL ChamQ SYBR qPCR Master Mix (Novozyme, Nanjing), 2 μL cDNA template (3.5-4 ng cDNA), 0.4 μL 10 mM F primer, 0.4 μL 10 mM R primer and 7.2 μL ddH2O; qPCR program is set as: 95℃30s; 40×(95℃10s, 60℃30s); (95℃15s, 60℃60s, 95℃15s).

[0059] Step 5: The internal reference used in qPCR is Actin8; the primers used in qPCR are ACT8-F: GAGACAACTTACAACTCGATC and ACT8-R: CTGTGGACAATGCCTGGAC; GUS-F: CGTGGTGATGTGGAGTATTGC and GUS-R: CGCTGATGGTATCGGTGTGA.

[0060] Step 6: Analyze the results using Roche LC96 fluorescence quantitative machine software lanlvmaomao. The analysis results show that the expression levels of the GUS gene in the three strains were significantly upregulated at 20 minutes compared with 0 minutes (see the results). Figure 4 ). In addition, GUS-1# had the highest expression at 20min, which was 2.55 times that of 0min; GUS-2# and GUS-3# had the highest expression at 2h, which were 2.92 times and 7.54 times of 0min, respectively. At the same time, at 10h of treatment, the expression of GUS genes fell back to the level of 0min. The results of transcription level were basically consistent with the trend of GUS histochemical staining results.

[0061] The above-described embodiments provide a detailed description of the technical solutions and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected.

Claims

1. A damage-inducible strong promoter LAP35S, characterized in that The damage-inducible strong promoter is composed of primer sequence 1, response module repeat sequence 1, link sequence 1, response module repeat sequence 2, link sequence 2, response module repeat sequence 3 and minimum 35S promoter connected in sequence from left to right.

2. The damage-inducible strong promoter LAP35S according to claim 1, characterized in that: The nucleotide sequence of the damage-inducible strong promoter LAP35S is shown in SEQ ID NO:

1.

3. The damage-inducible strong promoter LAP35S according to claim 1, characterized in that: The nucleotide sequence of the primer sequence 1 is shown in SEQ ID NO:

2.

4. The damage-inducible strong promoter LAP35S according to claim 1, characterized in that: The nucleotide sequences of the response module repeating sequence 1, the response module repeating sequence 2 and the response module repeating sequence 3 are completely the same, and the nucleotide sequences are shown in SEQ ID NO:

3.

5. The damage-inducible strong promoter LAP35S according to claim 1, characterized in that: The nucleotide sequence of the linker sequence 1 is shown in SEQ ID NO:

4.

6. The damage-inducible strong promoter LAP35S according to claim 1, characterized in that: The nucleotide sequence of the linker sequence 2 is shown in SEQ ID NO:

5.

7. The damage-inducible strong promoter LAP35S according to claim 1, characterized in that: The nucleotide sequence of the minimal 35S promoter is shown in SEQ ID NO:

6.

8. A method for preparing a damage-inducible strong promoter LAP35S according to any one of claims 1 to 8, characterized in that: The preparation method comprises using PlantCARE to perform bioinformatics analysis on the selected response module repeat sequence 1, response module repeat sequence 2, response module repeat sequence 3, link sequence 1 and link sequence 2, and then sequentially arranging the primer sequence 1, response module repeat sequence 1, link sequence 1, response module repeat sequence 2, link sequence 2, response module repeat sequence 3 and minimum 35S promoter, and entrusting a biological company to perform synthesis.

Images