A drought-inducible promoter of cotinus coggygria and application thereof

By cloning and identifying the CcDT1 promoter of smoke tree, constructing a recombinant vector, and verifying its response to drought stress in Arabidopsis thaliana, the problem of leaf color change in smoke tree under drought conditions was solved, and the plant's stress resistance and breeding potential were improved.

CN120400149BActive Publication Date: 2026-06-23SOUTHWEST UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTHWEST UNIV
Filing Date
2025-04-25
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

The lack of effective drought-inducible promoters in existing technologies leads to severe changes in leaf color of smoke trees under drought conditions, affecting their ornamental value as garden landscape plants, and there is a lack of breeding methods for drought-resistant genes.

Method used

The promoter region of the Smoke Tree CcDT1 gene was cloned and identified. Primers were designed to amplify the promoter proCcDT1, and a recombinant vector was constructed. The vector was applied to Arabidopsis thaliana to drive GUS gene expression under drought stress and verify the promoter responsiveness.

Benefits of technology

The promoter proCcDT1 significantly enhances gene expression under drought stress, improves the plant's resistance to stress, has potential for breeding applications, and enhances the ornamental value of smoke tree as a landscape plant.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120400149B_ABST
    Figure CN120400149B_ABST
Patent Text Reader

Abstract

The application discloses a drought-inducible promoter of Cotinus coggygria and application thereof, a DNA sequence of the promoter is shown as SEQ ID No. 1, proCcDT1 is cloned from a promoter region of a CcDT1 gene of the Cotinus coggygria and is verified through experiments. First, elements of the promoter region are analyzed, and the result shows that the elements contain multiple cis-acting elements that can be involved in response to abiotic stress. Then, proCcDT1-GUS transgenic plants are treated through 10% PEG simulation drought, and it is found that GUS staining of the transgenic plants is enhanced, so it can be concluded that the GUS expression level driven by the promoter is increased under drought induction conditions, and it is also proved that the promoter can be induced by drought stress. The promoter proCcDT1 is introduced into an Arabidopsis genome through genetic transformation technology, so that the promoter can be stably induced by drought stress in a heterologous plant, and the practical application has important value for cultivating drought-resistant Cotinus coggygria varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and relates to a promoter for drought-induced expression in smoke tree. Background Technology

[0002] A promoter is a DNA sequence involved in initiating and regulating gene expression, and is a crucial element in gene expression regulation. Based on their mode of action and function, promoters can be classified into three categories: constitutive promoters, inducible promoters, and tissue-specific promoters. The expression of inducible promoters is induced by specific physical or chemical signals; under induction conditions, the transcriptional level of the gene is significantly increased under the regulation of this promoter. Previous studies have reported some stress-induced promoters, such as those induced by cold, heat, light, and drought. Stress-induced promoters are activated upon receiving abiotic stress signals, promoting the expression of related transcription factors, which in turn regulate the expression of downstream genes, enabling plants to respond to abiotic stress and protect themselves. Therefore, exploring the expression of exogenous genes regulated by inducible promoters in plants can provide technical means for crop breeding.

[0003] Smoke tree (Cotinus coggygria Scop.), belonging to the genus Cotinus in the family Anacardiaceae, is also known as red-leaf smoke tree or red-leaved smoke tree. It is a deciduous small tree or shrub. It is an important landscape plant in my country, famous for its red leaves, and has high ornamental and economic value. Wild smoke trees are also important resource-based species, used for extracting yellow industrial dyes, and their leaves can be used to make perfumes.

[0004] Plants undergo varying degrees of physiological and ecological changes when subjected to stress. Drought stress affects chlorophyll synthesis, thus influencing leaf color formation; in severe cases, plants may experience chlorosis or discoloration. Leaf color is a crucial characteristic of landscape plants. As an important red-leaved landscape plant, effectively maintaining the leaf color of the smoke tree (Cotinus coggygria) is essential to enhancing its ornamental value. The increasing prevalence of arid land poses a significant challenge to maintaining the leaf color of the smoke tree and ensuring tree yield. Therefore, identifying drought-resistant genes in the smoke tree can provide a theoretical basis for its genetic breeding, and its practical application is also of great value in cultivating drought-resistant varieties. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide an inducible promoter that initiates the transcription of downstream genes under drought stress.

[0006] The technical solution of the present invention is: a drought-inducible promoter proCcDT1, the nucleotide sequence of which is shown in SEQ ID No.1.

[0007] The primer pair for amplifying the above-mentioned promoter proCcDT1 is shown in SEQ ID No. 2, and the downstream primer sequence is shown in SEQ ID No. 3.

[0008] Recombinant vectors containing the aforementioned promoter proCcDT1.

[0009] The above-mentioned promoter proCcDT1 is used to promote the expression of target genes.

[0010] The application of the aforementioned promoter proCcDT1 in regulating plant drought tolerance.

[0011] The application of the aforementioned promoter proCcDT1 in drought-resistant plant breeding.

[0012] Furthermore, the plant is either smoke tree or Arabidopsis thaliana.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The promoter proCcDT1 was cloned from the promoter region of the *Cotinus coggygria* CcDT1 gene. Analysis of this promoter region revealed multiple cis-acting elements that may be involved in responding to abiotic stress. When *Arabidopsis thaliana* transgenic plants containing proCcDT1::GUS were subjected to drought treatment, it was found that the proCcDT1 promoter drove the expression of the GUS gene in *Arabidopsis thaliana*. Compared with untreated plants, the staining intensity of *Arabidopsis thaliana* transgenic plants after drought treatment was significantly darker, demonstrating that the proCcDT1 promoter can respond to drought stress. The proCcDT1 promoter can stably function in heterologous plants and can enhance the expression level of downstream genes under drought stress conditions. Therefore, this promoter can be used as an inducible promoter in research on improving crop stress resistance, and its practical application has important value for genetic engineering breeding. Attached Figure Description

[0015] Figure 1 Electrophoresis image of the proCcDT1 promoter fragment.

[0016] Figure 2 proCcDT1 promoter sequence analysis.

[0017] Figure 3 GUS staining analysis of proCcDT1::GUS transgenic Arabidopsis thaliana under 10% PEG-simulated drought treatment. Detailed Implementation

[0018] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from commercial sources.

[0019] 1. Promoter cloning

[0020] The promoter region sequence of *Pistacia chinensis* DT1 was searched and downloaded from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ). Primers were designed (Table 2), and KpnⅠ and SalⅠ restriction enzyme sites were added at both ends. The proCcDT1 promoter fragment was amplified by PCR using *Cotinus coggygria* genomic DNA as a template, and the amplification results were detected by 1% agarose gel electrophoresis. The recovered DNA was ligated into a GUS expression vector, and the proCcDT1 promoter fragment sequence was determined by sequencing and alignment. The results showed that the promoter region was 1479 bp in length.

[0021] Table 1 shows the promoter amplification system (total 20 μL).

[0022]

[0023] Table 2 Primer sequences for the promoter proCcDT1

[0024] Primer name Primer sequences (5'-3') pCcDT1-F(Kpn I) GGGGTACCTGGCTCGGGTATTGTCTG(SEQ ID No.2) pCcDT1-R(Sal I) GCGTCGACGTCAGCAAGTGAAACG(SEQ ID No.3)

[0025] Experimental results:

[0026] Agarose gel electrophoresis detected an amplification product of 1479 bp in size, as shown in the results. Figure 1 As shown, its nucleotide sequence is shown in SEQ ID No. 1.

[0027] 2. Promoter sequence analysis

[0028] Promoter regulatory element analysis was performed using the PLACE database (http: / / www.dna.affrc.go.jp / PLACE / ). Figure 2 ).

[0029] Experimental results:

[0030] The cis-acting elements contained in the promoter proCcDT1 are shown in Table 3.

[0031] Table 3. Summary of essential promoter components and environmental stress response components contained in the proCcDT1 promoter.

[0032]

[0033]

[0034] 3. Transgenic Arabidopsis plants

[0035] The successfully constructed proCcDT1::GUS vector was transformed into wild-type Arabidopsis thaliana (Col-0) using Agrobacterium-mediated inflorescence staining, and T0 generation seeds were collected. Seeds were plated on 1 / 2 MS medium containing hygromycin for transgenic plant selection. Plants exhibiting normal growth on resistant medium were transplanted and identified by PCR and GUS staining. GUS histochemical staining was observed in the transgenic Arabidopsis plants, demonstrating that the proCcDT1 promoter can initiate the expression of the exogenous gene GUS vector.

[0036] 4. Drought stress treatment experiment

[0037] proCcDT1 transgenic Arabidopsis plants grown on 1 / 2 MS medium for 8 days were immersed in 10% PEG to simulate drought treatment. After 3 hours, the material was collected for GUS staining. The staining results are shown below. Figure 3 Compared to the control group, transgenic Arabidopsis seedlings treated with 10% PEG showed significantly deeper GUS staining, indicating that the promoter proCcDT1 was induced by drought stress.

Claims

1. A drought-induced promoter proCcDT1 The promoter proCcDT1 The nucleotide sequence is shown in SEQ ID No.

1.

2. Containing the promoter of claim 1 proCcDT1 Recombinant carriers.

3. The promoter according to claim 1 proCcDT1 In the application of initiating the expression of a target gene, the target gene is the GUS gene.

4. The promoter according to claim 1 proCcDT1 Application in improving plant drought resistance, wherein the plant is smoke tree or Arabidopsis thaliana.

5. The promoter according to claim 1 proCcDT1 Application in drought-resistant plant breeding, wherein the plant is smoke tree or Arabidopsis thaliana.