Csdrm2 gene for regulating color of cucumber peel, encoded protein and application
By identifying and validating the CsDRM2 gene, we constructed a cucumber CsDRM2 overexpression material, which regulated the cucumber peel color from yellow to green, solving the problem of cucumber peel color regulation and improving the marketability and ornamental value of cucumbers.
Patent Information
- Application Number
- CN202411888045.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-20
- Publication Date
- 2025-12-16
- Estimated Expiration
- 2044-12-20
AI Technical Summary
Existing technologies have limited research on the molecular regulation mechanism of cucumber peel color, making it difficult to regulate peel color through genes. This results in an inability to meet the market demand for peel color from consumers in different regions. Furthermore, the genetic laws governing peel color are complex, and there is a lack of unified quality standards.
The function of the CsDRM2 gene was identified and verified. A cucumber CsDRM2 overexpression material was constructed using transgenic technology. The CsDRM2 gene was used to regulate the color of cucumber peel from yellow to green, delaying the time for young fruits to turn from yellow to green and maintaining the color of young fruits for a longer period of time.
This technology enables the genetic regulation of cucumber peel color, changing it from yellow to green, thereby improving the marketability and ornamental value of cucumbers and meeting diverse market demands.
Smart Images
Figure CN119410664B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of bioengineering breeding, and particularly relates to a CsDRM2 gene for regulating cucumber peel color, a coding protein and application. BACKGROUND
[0002] Cucumber (Cucumis sativus L., 2n = 2x = 14) is also known as melon and prickly melon, which is an annual herb of Cucurbitaceae and originated from the southern slope of the Himalayas. Cucumber is widely planted in temperate and tropical regions and is an important economic crop in the world. Cucumber has the characteristics of preferring warm, tolerating cold, not tolerating heat, preferring wet, not tolerating waterlogging, preferring fertilizer, not tolerating fertilizer, preferring light, not tolerating insufficient light, poor fruit growth, shallow root system, weak absorption capacity and poor stress resistance.
[0003] Peel color is an important standard of cucumber quality traits, which can greatly affect the selection of consumers and has important commodity value. The commodity value of cucumber peel color has strong regional characteristics, and consumers in different regions have different preferences for peel color, and it is impossible to judge the advantages and disadvantages of a certain peel color with a unified standard. At the same time, the genetic law of cucumber peel color is relatively complex, and its inheritance may follow the law of free combination of genes and be controlled by multiple pairs of alleles. Therefore, improving fruit appearance characteristics, especially peel color, in combination with market demand in different regions is an important breeding goal to improve the economic value of cucumber. At present, the peel color of Chinese cucumber germplasm is mainly divided into dark green, deep green, green, light green, yellow-green, white-green, yellow-white and milky white types. At present, there are few studies on the molecular regulation mechanism of cucumber peel color, and the function of genes in regulating peel color has not been reported. SUMMARY
[0004] The purpose of the present application is to provide a CsDRM2 gene for regulating cucumber peel color, a coding protein and application, which can regulate the process of changing from yellow to green of cucumber peel color through the CsDRM2 gene.
[0005] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions.
[0006] The present application provides a CsDRM2 gene for regulating cucumber peel color, and the nucleotide sequence of the cucumber CsDRM2 gene is shown in SEQ ID NO. 1.
[0007] The present application also provides a protein encoded by the CsDRM2 gene for regulating cucumber peel color, and the amino acid sequence of the protein encoded by the CsDRM2 gene is shown in SEQ ID NO. 2.
[0008] The application also provides a primer group for amplifying the CsDRM2 gene for regulating the color of cucumber peel, which consists of the following sequences:
[0009] CsDRM2-F (SEQ ID NO. 3):
[0010] 5'-ATGGGGATATTTGTAGCTGGTGA-3';
[0011] CsDRM2-R (SEQ ID NO. 4):
[0012] 5'-TTCAGTTTTGGTGGCTATACACTTG-3'.
[0013] The application also provides application of the CsDRM2 gene for regulating the color of cucumber peel or the protein encoded by the CsDRM2 gene for regulating the color of cucumber peel in regulating the color of cucumber peel.
[0014] Further, the CsDRM2 gene for regulating the color of cucumber peel or the protein encoded thereby can regulate the process of changing the color of cucumber peel from yellow to green.
[0015] The application also provides application of the CsDRM2 gene for regulating the color of cucumber peel or the protein encoded by the CsDRM2 gene for regulating the color of cucumber peel in cucumber peel mutation breeding.
[0016] The application also provides application of the CsDRM2 gene for regulating the color of cucumber peel or the protein encoded by the CsDRM2 gene for regulating the color of cucumber peel in early identification of the color of cucumber peel.
[0017] Compared with the prior art, the application has the following beneficial effects:
[0018] The application identifies and verifies a CsDRM2 gene involved in the regulation of the color of cucumber peel, and then constructs a cucumber CsDRM2 overexpression material by using transgenic technology to study the function of the CsDRM2 gene. The experiment proves that overexpression of the CsDRM2 gene delays the time of changing the color of cucumber tender fruit from yellow to green, so that the cucumber maintains the color of tender fruit for a longer time in the early stage of fruit development, and increases the commodity value and ornamental value of the cucumber. BRIEF DESCRIPTION OF DRAWINGS
[0019] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings described below only show some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor.
[0020] Figure 1 The transcriptome data column chart of wild type CsDRM2 after 0, 6, 12, 18, 24, 30 days of pollination for embodiment 1 of the present application;
[0021] Figure 2 The cucumber CsDRM2 gene overexpression vector map in test example 1 of the present application;
[0022] Figure 3 The fluorescence quantitative verification of significant increase of CsDRM2 overexpression gene compared with wild type expression;
[0023] Figure 4 The phenotype of fruit skin color of wild type and transgenic cucumber after 4, 7, 10, 14 days of field pollination in test example 1 of the present application;
[0024] Figure 5 The fruit length and diameter of wild type and transgenic cucumber after 10, 12, 14, 16, 18, 22 days of field pollination in test example 1 of the present application;
[0025] Figure 6 The early L, C, H values of wild type and transgenic cucumber after field pollination in test example 2 of the present application. DETAILED DESCRIPTION
[0026] Various exemplary embodiments of the present application will now be described in detail, which should be considered to be illustrative of the present application and should not be construed to limit the scope of the present application, and are understood to be a further description of certain aspects, features and embodiments of the present application.
[0027] It should be understood that the terms used in the present application merely describe particular embodiments and are not intended to limit the present application. In addition, for numerical ranges in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is specifically disclosed. Each smaller range within the range of the intermediate values and any other stated value or intermediate value within the stated range is also included in the present application. The upper limit and the lower limit of these smaller ranges can be included or excluded independently from the range.
[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, preferred methods and materials are described. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict between the content of the specification and that of any document incorporated by reference, the content of the specification prevails.
[0029] Many modifications and variations of the specific embodiments of the application can be practiced in accordance with the principles of the application, and such variations are apparent to one skilled in the art. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples are illustrative only.
[0030] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed material or list of materials.
[0031] The cucumber inbred line "9930" of the present application has been published in the article "The genome of the cucumber, Cucumis sativus L." in the journal Nature Genetics (Sanwen Huang et al., 2009), and the above germplasm resource is deposited in the Laboratory Germplasm Bank of Yangzhou University, which can be obtained by those skilled in the art through the Laboratory Germplasm Bank of Yangzhou University.
[0032] Example 1
[0033] The embodiment of the present application provides a preparation method of the CsDRM2 gene overexpression material DRM2-OE-1, and the specific steps are as follows:
[0034] (1) Acquisition of cucumber CsDRM2 gene
[0035] The cDNA of the cucumber inbred line '9930' root system is used as a template, a cloning primer CsDRM2-F and CsDRM2-R are designed, and high-fidelity DNA polymerase is used for PCR amplification.
[0036] The primer CsDRM2-F (SEQ ID NO. 3) is as follows:
[0037] 5'-ATGGGGATATTTGTAGCTGGTGA-3';
[0038] The primer CsDRM2-R (SEQ ID NO. 4) is as follows:
[0039] 5'-TTCAGTTTTGGTGGCTATACACTTG-3'.
[0040] The PCR system is 50 μL in total: 25 μL of 2x Phanta Flash MasterMix, 2 μL of template, 2 μL of each of the upstream and downstream primers, and 19 μL of ddH2O.
[0041] The PCR reaction program is as follows: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 60℃ annealing for 5 seconds, 72℃ extension for 2 minutes, a total of 35 cycles; and finally 72℃ extension for 1 minute.
[0042] The PCR reaction product obtained was identified by 1% agarose gel electrophoresis, and the target band was purified by a gel recovery kit from Takara, the product was ligated to a PMD19-T vector (Takara), and the recombinant plasmid was sent for detection, and the full-length sequence of the cucumber CsDRM2 gene was obtained.
[0043]
[0044] CsDRM2 protein amino acid sequence (SEQ ID NO. 2):
[0045] MAGDDFGVEVDNIDWDTEDELEIENIPLGSHASLAFPGVEANMASSSAGPSNSKTVDYFIGMGFSAKMVAKAIEDNGEENTDSILETLLTLSALENSPPKQQHVDTDDSFSDYEGSFLDDFSDLDSDYENEATAKPVSDADNKMTFLVDMGYSEDEAYAAIERCGVHSSFAELTDFISAAQISKAADVLLGDLPVRPKPKNLNGCSKLNKRRHYDDDTWKKKKPRCFEDEDDDTIRLPNPMIGFGVPNELCLTVHRKIPEAAMGPPYFYYENVALAPKGVWNTISRFLYDVEPEFVDSKYFCAAARKRGYVHNLPIHNRFPLLPLPPHTVHEALPLTRRWWPSWDTRTQLNCLQTCIGSARLTDRIRRALEDYDGVRDPPLHVQKFVVEQCRKWNLVWVGKNKVAPLEPDEVEMLLGFPKNHTRGGGISRTDRYKSLGNSFQVDTVAYHLSVLKDMFPGGINLLSLFSGIGGAEVALHRLGIPLKNVVSVDISEVNRNIVRCWWEQTNQKGTLIDLADVQELDADRLQYYMNLFGGFDLVVGGSPCNNLTGSNRYTRDGLEGKESILFYDYFRILDLVKCIATKTE.
[0046] (2) Construction of cucumber CsDRM2 gene overexpression vector Figure 2 ) (pCAMBIA1305.4-CsDRM2)
[0047] According to the overexpression vector pCAMBIA1305.4 (Universe Biotech (Jiangsu) Co., Ltd.) and the sequence shown in SEQ ID No. 1, the homologous recombination primers were designed, and the primer sequences are as follows:
[0048] pCAMBIA1305.4-CsDRM2-F (SEQ ID NO. 5):
[0049] GAGAACACGGGGGACTCTAGAATGGGGATATTTGTAGCTGGTGA;
[0050] pCAMBIA1305.4-CsDRM2-R (SEQ ID NO.6):
[0051] GGGAAATTCGAGCTCACTAGTTTCAGTTTTGGGTGGCTATACACTTG.
[0052] The CsDRM2 gene was amplified by PCR using the above homologous recombination primers, and then recovered by agarose gel electrophoresis for later use.
[0053] The pCAMBIA1305.4 vector was digested with BamHI using the NEB R3136 kit (NEB (Beijing) Co., Ltd., New England Biolabs (Beijing) LTD.), and the gel was recovered using the DC301 kit (gel recovery kit).
[0054] Using the homologous recombination kit Novizan C112 ( The CsDRM2 gene sequence shown in SEQ ID No. 1 of the above gel recovery product was inserted into the BamHI restriction site of the pCAMBIA1305.4 vector using the IIOne Step Cloning Kit to obtain the pCAMBIA1305.4-CsDRM2 recombinant overexpression vector. Figure 2 The specific procedure involves preparing a 20 μL system: 2 μL of CsDRM2 gel-recovered fragment, 5.44 μL of vector pCAMBIA130, 2 μL of homologous recombinase, 2 μL of buffer, and ddH2O to 20 μL; the PCR reaction program is 37℃ for 30 min, followed by storage on ice or at 4℃.
[0055] The recombinant vector was transformed into Escherichia coli DH5α, and positive single colony sequencing was performed using the 1305-Seq-F (SEQ ID NO.7):GTCACTTTATTGTGAAGATAGTGGA sequencing primers.
[0056] The recombinant plasmid pCAMBIA1305.4-CsDRM2 was extracted from the correctly sequenced bacterial culture and transformed into Agrobacterium EHA105. After picking the bacteria, PCR positive detection was performed using CsDRM2-F and CsDRM2-R primers. The positive colonies with consistent bands were propagated in bacterial culture and stored at -80℃ for later use.
[0057] (3) Construction of CsDRM2 overexpression lines
[0058] 1) Infection
[0059] Cucumber germplasm '9930' seeds are sowed on SGM sowing medium, and cultured in darkness at 28℃ for 36h; the above-mentioned sequencing consistent positive Agrobacterium liquid is used for infection, and the OD of the bacterial liquid is 0.2-0.3; the seeds cultured in darkness are added into the Agrobacterium liquid to be co-cultured on IM co-cultured medium at 25℃ in darkness for 3-4d;
[0060] 2) Screening of the first selfed generation T1 of the overexpression strain
[0061] The seedling plants in the above-mentioned step are subjected to fluorescence screening detection, and the fluorescent sprouts are transferred to 1M SRM differentiation medium and RM rooting medium, and cultured at a temperature of 24.5℃, a humidity of 62%, and a light intensity of 6500Lux, with 16h light and 8h darkness; when the number of roots is about 12-15, the plants are transplanted into soil to grow into cucumber plants, and PCR identification is performed when tender leaves grow out.
[0062] The identification primer is a vector antibiotic gene AADA, and the PCR amplification primer is:
[0063] AADA_F (SEQ ID NO. 8): TCCGACATCGATCTCCTGGT;
[0064] AADA_R (SEQ ID NO. 9): CAGGGTGAGGACCACATTCC.
[0065] The plants with bands are resistant transgenic plants T0; the transgenic cucumbers are selfed to grow and collect seeds to obtain T1 generation, and finally obtain CsDRM2 gene overexpression materials DRM2-OE-1 and DRM2-OE-2.
[0066] Example 2
[0067] In the example 2 of the present application, the cotyledon nodes of the cucumber selfing line '9930' infected by the Agrobacterium constructed in the example 1 are induced to regenerate sprouts and root culture by a conventional method to obtain tissue culture seedlings.
[0068] The primer shown in SEQ ID NO. 8 and SEQ ID NO. 9 is used for identification to obtain CsDRM2 gene overexpression materials DRM2-OE.
[0069] Test Example 1
[0070] In the test example 1 of the present application, the CsDRM2 expression amount of the CsDRM2 gene overexpression materials DRM2-OE-1 and DRM2-OE-2 prepared in the example 1 is detected with wild type cucumber (WT) as a control, and the specific steps are as follows:
[0071] (1) The expression amount of CsDRM2 gene after overexpression was explored by fluorescence quantitative PCR technology, and the fluorescence quantitative PCR primer was designed based on the exon region of CsDRM2 gene:
[0072] Forward primer-SEQ ID NO. 10: 5'-CTGGTGACGATTTTGGTGTTG-3';
[0073] Reverse primer-SEQ ID NO. 11: 5'-GATGAGCTTGCCATATTTGCC-3'.
[0074] The internal reference primer was designed based on Actin gene:
[0075] Forward primer-SEQ ID NO. 12: 5'-GCTGGATTCTGGTGATGGTG-3';
[0076] Reverse primer-SEQ ID NO. 13: 5'-AGCAAGGTCCAAACGGAGAA-3'.
[0077] SYBR Premix Ex Taq (Takara Company) and fluorescence quantitative PCR instrument q225 (Coolbo Company) were used to carry out fluorescence quantitative PCR to obtain the cycle number reaching the fluorescence threshold, and the results are shown in Figure 3
[0078] The relative expression amount of CsDRM2 gene after overexpression was calculated as 4 times of WT, and the results showed that the CsDRM2 gene level of the overexpression strain was significantly higher than that of WT plants. Figure 3 (4) The transcription data of CsDRM2 of wild type cucumber fruits after pollination at different times were detected, and the results are shown in
[0079] Figure 1 P0, P6, P12, P18, P24 and P30 represent 0, 6, 12, 18, 24 and 30 days after pollination, respectively.
[0080] Test Example 2
[0081] In the test example 2 of the application, wild type cucumber (CK) was used as a control to detect the phenotype of cucumber fruits after field pollination, and the specific steps were as follows:
[0082] (1) The DRM2-OE tissue culture seedlings obtained in Example 2 were planted in the same field as the wild type, pollinated during the flowering period, and the phenotype of cucumber fruits after field pollination was observed, and the results are shown in Figure 4
[0083] Figure 4 The study showed that, on days 4, 7, 10, and 14 after field pollination of wild-type and transgenic cucumbers (DRM2-OE), the peel color of transgenic cucumbers changed from yellow to green in the early stages of development, compared with wild-type cucumbers.
[0084] Experimental Example 3
[0085] In Experiment 3 of this invention, wild-type cucumber (WT) was used as a control. The cucumber phenotypes of the CsDRM2 gene overexpression materials DRM2-OE-1 and DRM2-OE-2 prepared in Example 1 were tested. The specific steps are as follows:
[0086] (1) Phenotypic detection of cucumbers after pollination
[0087] The phenotype of cucumber fruits after field pollination was examined, and the results are as follows: Figure 5 As shown.
[0088] Depend on Figure 5 It can be seen that the difference in peel color between wild-type and transgenic cucumbers does not affect the changes in fruit length and diameter in the later stages, and there is no significant difference between the two. This indicates that the CsDRM2 gene regulates peel color in the early stage of fruit development, but does not affect the fruit length and diameter.
[0089] (2) During the early stages of cucumber fruit development, color changes in the peel were detected, and the brightness (L), saturation (C), and hue (H) values of the cucumber fruit peel were measured using a portable colorimeter. To ensure the accuracy of phenotypic collection, 40 independent replicate measurements were performed. The results are as follows: Figure 6 As shown.
[0090] Figure 6 The results showed that, compared with the wild type, transgenic cucumbers (DRM2-OE-1 and DRM2-OE-2) did not have significant differences in L and H values during the early stages of fruit development, while the C value indicated a significant difference. This indicates that... Figure 4 The transgenic cucumber fruit, as shown, exhibits a gradual yellow-green color change during the early stages of fruit development compared to the wild type, indicating that the CsDRM2 gene is involved in regulating the peel color during the early stages of fruit development.
[0091] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. The application of the CsDRM2 gene or the protein encoded by the CsDRM2 gene in regulating the yellow-to-green color change of cucumber peel, characterized in that... The nucleotide sequence of the CsDRM2 gene is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the CsDRM2 gene is shown in SEQ ID NO.
2. Overexpression of the CsDRM2 gene or the protein encoded by the CsDRM2 gene causes the cucumber peel color to change from yellow to green during development.