Heat shock transcription factor bd1650 gene for increasing fucoxanthin content in Phaeodactylum tricornutum and its application

Abstract

The present invention discloses a heat shock transcription factor for increasing the content of fucoxanthin in Phaeodactylum tricornutum bd1650 gene and its application, characterized in that bd1650 the nucleotide sequence of the gene is as shown in SEQ ID NO: 1, and the amino acid sequence of the protein encoded by bd1650 is as shown in SEQ ID NO: 2. By knocking out the bd1650 gene in Phaeodactylum tricornutum, the content of fucoxanthin synthesized by it is increased. The advantage is that the content of fucoxanthin in Phaeodactylum tricornutum can be significantly increased.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, and in particular to a heat shock transcription factor bd1650 gene for increasing the content of fucoxanthin in Phaeodactylum tricornutum and its application. Background Art

[0002] Marine diatoms play a crucial role in the global carbon cycle. Their high nutritional value, pharmaceutical potential, and potential as raw materials for biofuels are attracting increasing attention. Among them, Phaeodactylum tricornutum stands out due to its significant advantages such as rapid growth, strong environmental adaptability, and ease of artificial cultivation. This alga is rich in fucoxanthin, and its content is several times higher than that of other algae. Fucoxanthin, as a type of xanthophyll, is an important oxygenated derivative of carotenoids and exhibits multiple biological activities such as anti-cancer, anti-diabetic, anti-tumor, antioxidant, and anti-obesity, thus showing broad application prospects in industrial production.

[0003] Heat shock transcription factors are a class of transcription factors commonly present in higher plants and can respond to various stresses. Heat shock transcription factors may also play an important role in the stress response of microalgae. For example, nitrogen and phosphorus deficiency stresses lead to the expression of many heat shock transcription factors in Phaeodactylum tricornutum. Transcriptome analysis shows that heat shock transcription factors are the transcription factors with the largest expression differences at different growth stages of this species. In fact, heat shock transcription factors account for 34.18% of all transcription factors in Phaeodactylum tricornutum. However, despite these indications that heat shock transcription factors play an important role in microalgae, the specific functional studies of heat shock transcription factors in microalgae are relatively few. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a heat shock transcription factor bd1650 gene for increasing the content of fucoxanthin in Phaeodactylum tricornutum and its application, bd1650 and the gene knockout algal strain can positively regulate the expression of fucoxanthin synthesis genes.

[0005] The technical solution adopted by the present invention to solve the above technical problem is: a heat shock transcription factor bd1650 gene for increasing the content of fucoxanthin in Phaeodactylum tricornutum, and the bd1650 nucleotide sequence of the gene is as shown in SEQ ID NO: 1.

[0006] Furthermore, the amino acid sequence of the protein encoded by bd1650 is as shown in SEQ ID NO: 2.

[0007] The present invention also provides the application of the above heat shock transcription factor bd1650 gene in increasing the content of fucoxanthin in Phaeodactylum tricornutum, and the bd1650The nucleotide sequence of the gene is shown in SEQ ID NO: 1. bd1650 The gene causes an increase in the amount of fucoxanthin it synthesizes.

[0008] Compared with the prior art, the advantages of the present invention are:

[0009] 1. For the first time, we found the heat shock transcription factor bd1650 by screening the gene library of P. tricornutum. After knocking out its CRISPR gene, we found bd1650 The mutant strains had phenotypic changes in fucoxanthin synthesis;

[0010] 2. For the first time, it was confirmed that the heat shock transcription factor bd1650 gene of P. tricornutum can promote the increase of fucoxanthin content. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 For specific embodiment three bd1650 Sequence chromatograms generated by sequencing the knockout algae strain and the wild-type P. tricornutum;

[0012] Figure 2 For specific embodiment 4 bd1650 Analysis of fucoxanthin content in gene knockout strains and wild-type P. triangularis. Note: WT represents wild-type P. triangularis. bd1650-1 and bd1650-8 Indicates different transfers bd1650 Transgenic Phaeodactylum tricornutum strains of vector;

[0013] Figure 3 For the specific embodiment 5 bd1650 Fucoxanthin biosynthesis genes in knockout strains and wild-type Phaeodactylum tricornutum CRTISO5 Expression level;

[0014] Figure 4 For the specific embodiment 5 bd1650 Fucoxanthin biosynthesis genes in knockout strains and wild-type Phaeodactylum tricornutum ZEP1 Expression amount. DETAILED DESCRIPTION

[0015] The present invention is further described in detail below with reference to the accompanying drawings.

[0016] Specific Example 1: Heat shock transcription factor bd1650 Gene cloning and sequence analysis include the following steps:

[0017] Step 1: Extract algae at a concentration of 1×10 6 cells / mL of total RNA from the logarithmic phase of Phaeodactylum triangularis, and the extracted RNA was used as a reactant for reverse transcription to obtain a cDNA template.

[0018] Step 2, PCR amplification: Obtain bd1650 gene amplification products. The reaction system for PCR amplification is: 0.5 μL cDNA, 10 μL 2×PrimeSTAR Max Premix, bd1650 upstream and downstream gene amplification primers

[0019] 0.5 μL each, 8.5 μL ddH2O; The PCR amplification program is: denaturation at 98°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 1 min, 30 cycles; among them bd1650 the nucleotide sequence of the upstream gene amplification primer is shown in SEQ ID NO:3: ATGTGCGTTACCAACACTACCCA, bd1650 the nucleotide sequence of the downstream gene amplification primer is shown in SEQ ID NO:4: TTAGTCCTCAAGTAGTCGTTCCAGC.

[0020] Step 3, ligate the PCR amplification products with the pMD19-T vector after purification and recovery by 1% agarose gel electrophoresis, further verify by PCR and then sequence to obtain bd1650

[0021] Heat shock transcription factor bd1650 The amino acid sequence of the encoded protein is shown in SEQ ID NO:2: MCVTNTTHRRPQPISLAPSQYGACPSMLSQRLLGSYAAATVSAPASPSPAAPQYYATTIVTEKPRPKRRRKPQKPGKTAKMNERHFVKHNYHDHAMDTVDDMDDHAAEEQQPEDASLRRRGGVSVAFPLKLHAVLDQVEADGLAHVISWQPHGRCFVVHEPKKFVDHVMPKYFRQTKLTSFQRQLNLYGFCRLTRGNDSGGYYHELFLRNKVFLCQKMIRTKVKGTRFKAASSPDQEPDFYTMPPVAVTPANTSDEESSFDSGSRESVSSLPTQPTTMPSFDMFATNYAAVPQNISHAVQSFEPRGAFAPLCLPQADDADRVLDEAVEELFLNEAIASDSLDDFVHDWDPSNEGNEAYLDSLQDDCQLGMMLERLLED。

[0022] Specific Example 2. Construction bd1650 Gene knockout vector.

[0023] Using the pPtPuc3-Cas9-sgRNA (Addgene ID:109219) vector as the expression cassette of CRISPR / Cas9, two bd1650 knockout vectors (CRISPR-bd1650-1 / 2) were constructed. The specific steps are as follows:

[0024] Step 1. Select the target gene to be knocked out bd1650 and use the online sgRNA design software to obtain two sets of sgRNA sequences. The nucleotide sequence of sgRNA1 is shown in SEQ ID NO:5: CCCGCAGCCAATCTCTCTGGCAC, and the nucleotide sequence of sgRNA2 is shown in SEQ ID NO:6: CCGTCACAATCGTTGTGGCGTAG.

[0025] Step 2: Add restriction enzyme sites to the sgRNA sequences obtained in Step 1 and synthesize two pairs of single-stranded primers. The nucleotide sequence of the gRNA1 single-stranded upstream primer is as shown in SEQ ID NO:7: GTGCCAGAGAGATTGGCTGC, and the nucleotide sequence of the gRNA1 single-stranded downstream primer is as shown in SEQ ID NO:8: GCAGCCAATCTCTCTGGCAC; the nucleotide sequence of the gRNA2 single-stranded upstream primer is as shown in SEQ ID NO:9: GCTACGCCACAACGATTGTGA, and the nucleotide sequence of the gRNA2 single-stranded downstream primer is as shown in SEQ ID NO:10: TCACAATCGTTGTGGCGTAGC.

[0026] Step 3: Anneal the two pairs of single-stranded upstream and downstream primers obtained in Step 2 to obtain the corresponding double-stranded DNA fragments. The reaction system is 10×Buffer, 1 μL; 10 μM single-stranded upstream primer, 1 μL, 10 μM single-stranded downstream primer 1 μL, and make up to 10 μL with ddH2O. Mix the reaction system evenly, react at 85°C for 10 min, and cool at room temperature for 90 min to obtain double-stranded DNA.

[0027] Step 4: Ligate the two double-stranded DNA fragments obtained in Step 3 with the pPtPuc3-Cas9-sgRNA linear plasmid using T4 ligase. Ligate at 16°C for 1 h. The ligation system is 1 μL of T4 10×Buffer, 4 μL of pPtPuc3-Cas9-sgRNA linear plasmid, 3.5 μL of double-stranded DNA fragment, 0.5 μL of T4 DNA ligase, and make up to 10 μL with water to obtain two recombinant vectors, named bd1650-sgRNA1 recombinant vector and bd1650-sgRNA2 recombinant vector respectively; the preparation method of the linear plasmid is as follows: Take 1 μL of 1 μg / μL pPtPuc3-Cas9-sgRNA vector (109219), add 5 μL of 10×Buffer, 1 μL of restriction enzyme, and make up to 50 μL with ddH2O. Mix the reaction system evenly, react in a 37°C constant temperature incubator for 1 h, and then perform recovery and concentration detection to obtain the pPtPuc3-Cas9-sgRNA linear plasmid.

[0028] Step 5: Transform the bd1650-sgRNA1 and bd1650-sgRNA2 recombinant vectors into Escherichia coli respectively. The specific steps are as follows:

[0029] (1)Take 10 μL of each of the two recombinant vectors obtained in step 4 and add them to Escherichia coli DH5α competent cells, and place them on ice for 30 min; gently shake the bacteria, perform heat shock in a 42°C water bath for 60 s, and then quickly place them on ice and let them stand still for 3 - 5 min;

[0030] (2)Then add 400 μL of LB liquid medium without antibiotics to each and mix gently, and then incubate them with shaking at 220 rpm in a 37°C shaker for 1 h; the composition of the LB liquid medium is: yeast extract 5 g / L, tryptone 10 g / L, sodium chloride 10 g / L, and the solvent is water;

[0031] (3)Take 100 μL of the mixture obtained in step (2) and add them to LB solid medium containing ampicillin (Amp + ) antibiotics, spread them evenly until the bacterial liquid dries on the plate, seal it with a sealing film, make good marks, and place it in a 37°C constant temperature incubator for overnight culture for 12 - 16 h.

[0032] Take out the plates of overnight culture from the incubator and observe the colonies on the plates; if there are single colonies, pick 8 single colonies each on the ultra - clean workbench and culture them in 1 mL of LB liquid medium containing ampicillin (Amp + ) antibiotics. After incubating them with shaking at 220 rpm in a 37°C constant temperature shaking incubator for 3 h, take the bacterial liquid for bacterial liquid PCR identification. Take a segment of the sequence on the pPtPuc3 - Cas9 - sgRNA vector as the reverse primer for identification. The nucleotide sequence of the reverse primer for bacterial liquid identification is as shown in SEQ ID NO:11: CAGGAAACAGCTATGACC. Use the single - strand upstream primer in step 2 as the forward primer for bacterial liquid identification (gRNA1 single - strand upstream primer and gRNA2 single - strand upstream primer) for PCR identification. The bacterial liquid PCR reaction system is: 10 μL of 2×Flash Hot Start Master, 1 μL of the forward primer for bacterial liquid identification, 1 μL of the reverse primer for bacterial liquid identification, 1 μL of bacterial liquid, add ddH2O to a total volume of 20 μL. The bacterial liquid PCR reaction program is: 95°C for 5 min; 98°C for 10 s, 55°C for 5 s, 72°C for 5 - 10 s / kb, 30 cycles; cool to 4°C.

[0033] Perform gel electrophoresis on the obtained PCR products to view the results. Take the samples with positive bands for enlarged culture (100 μL of bacterial liquid and 4 mL of LB liquid medium containing ampicillin (Amp + ) antibiotics) and use the Plasmid Mini KitⅡ plasmid extraction kit to extract plasmids to obtain two bd1650 gene knockout vectors.

[0034] Specific Example 3 bd1650 Preparation of gene knockout algal strains, the specific steps are as follows:

[0035] Step 1: Use EcoNⅠ to linearize and digest two bd1650 gene knockout vectors. The digestion system is: 5 μL of 10× Buffer, 3 μL of EcoNⅠ, 6 μg of bd1650 gene knockout vector, make up to 50 μL with water. After digestion for 3 hours, purify with a Gel Extraction Kit to obtain the digested and recovered product, and get two bd1650 linear plasmids of gene knockout vectors.

[0036] Step 2: Perform electrotransformation on Phaeodactylum tricornutum and bd1650 the linear plasmid of the gene knockout vector. The specific steps are as follows:

[0037] (1) Culture Phaeodactylum tricornutum to the logarithmic phase at 1×10 6 cells / mL, centrifuge at 4℃, 1500×g for 10 min, and discard the supernatant; wash the precipitate 3 times with 1 mL of 375 mM sorbitol (sterile, pre-cooled on ice) solution, and resuspend the washed cells with 100 μL of 375 mM sorbitol solution to obtain a resuspended solution with a final algal density of 2×10 9 cells / mL;

[0038] (2) Mix 100 μL of the resuspended solution, 4 μg of the linear plasmid of the gene knockout vector purified in Step 1 with a concentration of 0.2 μg / μL, and 40 μg of salmon sperm DNA (boiled at high temperature for 10 min) solution with a concentration of 10 μg / μL, incubate on ice for 10 min, then transfer to a 0.2 cm electrotransformation cuvette pre-cooled on ice, and set the parameters: 500V field strength, 25μF capacitance, and 400 Ω parallel resistance for electrotransformation; bd1650 gene knockout vector linear plasmid, 40 μg of salmon sperm DNA (boiled at high temperature for 10 min) solution with a concentration of 10 μg / μL, mix them together, incubate on ice for 10 min, then transfer to a 0.2 cm electrotransformation cuvette pre-cooled on ice, and set the parameters: 500V field strength, 25μF capacitance, and 400 Ω parallel resistance for electrotransformation;

[0039] After electrotransformation, immediately transfer the cells to 10 mL of f / 2 liquid medium, incubate in weak light (about 30 μmol / m 2 ·s) for 24 h to recover, then transfer to normal light conditions for 24 h, centrifuge the algal solution at 1500×g, 4℃ for 10 min, discard the supernatant, take the precipitate and resuspend it with 600 μL of f / 2 liquid medium, take 200 μL and add it to an f / 2 medium solid plate containing bleomycin, and culture under normal culture conditions for 12 - 14 d.

[0040] Step 3、 bd1650Screening and identification of gene knockout algal strains are carried out as follows:

[0041] (1)Pick the monoclonal algal colonies grown on the bleomycin resistance plate in step 2, draw short lines of 3 - 5 mm on the f / 2 solid medium containing bleomycin, culture under normal conditions until algal colonies grow, take half of the algal colonies, add 20 μL of algal lysis solution, after 10 - minute water bath at 100 °C, take the algal lysis product as a template for algal solution PCR identification. The formula of the algal lysis solution is: 1% Nonidet P 40 (NP40), 10.00 mM Tris, 0.14 mM NaCl, 5.00 mM KCl;

[0042] (2)Design the nucleotide sequence of the forward primer for algal solution identification as shown in SEQ ID NO:12: ATGTGCGTTACCAACACTACCCA, and the nucleotide sequence of the reverse primer for algal solution identification as shown in SEQ ID NO:13: TGATCGACAAACTTTTTGGGTTC. The algal solution PCR reaction system is as follows: 10 μL of 2×Flash Hot Start Master, 1 μL of the forward primer for algal solution identification, 1 μL of the reverse primer for algal solution identification, 1 μL of algal solution, add ddH2O to a total volume of 20 μL. The algal solution PCR reaction program is as follows: 95 °C for 5 min; 98 °C for 10 s, 55 °C for 5 s, 72 °C for 5 - 10 s / kb, 30 cycles; cool to 4 °C.

[0043] Perform sequencing analysis on the PCR amplification products, select the positive transformants with successful gene knockout, choose the algal strains with heterozygous knockout among them, culture them in f / 2 liquid medium and then dilute and coat for a new round of screening, repeat the steps of algal solution PCR identification and sequencing until 2 homozygous transformants are screened out and named bd1650 gene knockout algal strains. bd1650 The sequencing results of the wild type (the original Phaeodactylum tricornutum without genetic modification),

[0044] and bd1650-1 and bd1650-8 the homozygous transformants are as Figure 1 shown. It can be seen from Figure 1 that bd1650-1 the homozygous transformants are missing 135 bp compared to the wild type; bd1650- 8 the homozygous transformants are missing 138 bp compared to the wild type.

[0045] Specific Example 4: Extraction and determination of fucoxanthin.

[0046] Those in the logarithmic phase bd1650After freeze-drying the gene knockout algal strain and wild-type *Phaeodactylum tricornutum* for 48 h, 90% ethanol was added at a solid-liquid ratio of 1 g:10 mL, and fucoxanthin was extracted by ultrasound at 40 °C for 1 h. After filtration, the supernatant was passed through a 0.22 μm filter membrane for HPLC analysis, and the whole process was carried out in the dark. A gilent 1200 HPLC system (Agilent Technologies, American) consisting of a G1312A binary pump, a G1367B autosampler, a G1315D PDA detector, and a G1316A column oven was used for fucoxanthin quantification. The mobile phase, methanol and water, was eluted at a flow rate of 0.7 mL / min, at 35 °C, and a YMC carotenoid column (250 mm in length × 4.6 mm in inner diameter; 5 μm particle size; Waters, America) was used for separation under the following gradient program: methanol increased from 90% to 100% for 20 min, held at 100% for 5 min, decreased to 90% for 5 min, and then held at 90% for 5 min. 10 μL of the sample solution was injected, and the chromatogram was recorded at 445 nm. Fucoxanthin was quantified based on a calibration curve with a concentration range of 0.5 - 50 μg / mL.

[0047] Figure 2 The fucoxanthin contents of the gene knockout algal strain and wild-type *Phaeodactylum tricornutum* with a cell density of 1.5×10 6 cells / mL were measured separately. bd1650 As can be seen from Figure 2 , bd1650-1 and bd1650-8 showed a 0.12 - 0.2-fold increase in fucoxanthin content. The experimental data indicated that knocking out the bd1650 gene in *Phaeodactylum tricornutum* led to an increase in fucoxanthin content, and the bd1650 gene knockout algal strain played a positive regulatory role in fucoxanthin synthesis. Note: WT represents wild-type *Phaeodactylum tricornutum*.

[0048] Specific Example Five: Detection of the expression levels of key genes for fucoxanthin synthesis.

[0049] Fluorescent quantitative primers for the fucoxanthin synthesis genes CRTISO5 and ZEP1 were selected and synthesized. CRTISO5 The nucleotide sequence of the fluorescent quantitative upstream primer was as shown in SEQ ID NO:14: GAGGATCGGCTCATACATTCTC, CRTISO5 and the nucleotide sequence of the fluorescent quantitative downstream primer was as shown in SEQ ID NO:15: GCATCTCTTCTTCCAGGACATC. ZEP1The nucleotide sequence of the fluorescence quantitative upstream primer is shown in SEQ ID NO:16: GGTACGCTTCGATACCCTACAG, ZEP1 The nucleotide sequence of the fluorescence quantitative downstream primer is shown in SEQ ID NO:17: GTAATTGGCAATACGGGACTTG.

[0050] Respectively use bd1650 gene knockout algal strains bd1650-1 、 bd1650-8 and the cDNA reverse transcribed from the RNA extracted from wild-type Phaeodactylum tricornutum as templates for real-time PCR quantification. The reaction system of the Taq Pro Universal SYBRqPCR Master Mix (Vazyme #Q712) used for the quantification reagent is as follows: 10 μL of 2×Taq Pro Universal SYBRqPCR Master Mix, 0.4 μL of the fluorescence quantitative upstream primer, 0.4 μL of the fluorescence quantitative downstream primer, 2 μL of cDNA, and add ddH2O to a total volume of 20 μL. The reaction program is as follows: 95°C for 30 s; 95°C for 10 s, 60°C for 30 s, a total of 40 cycles; 95°C for 15 s, 60°C for 60 s, 95°C for 15 s; 4°C until the end.

[0051] The results are as Figure 3 、 Figure 4 shown. Compared with the wild-type Phaeodactylum tricornutum WT, in bd1650 the gene knockout algal strains, the expression levels of two key genes CRTISO5 and ZEP1 of fucoxanthin increase. Therefore, it can be proved that bd1650 the gene knockout algal strains can regulate the expression of fucoxanthin synthesis genes, and it is a positive regulation.

[0052] The above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Changes, modifications, additions or substitutions made by those of ordinary skill in the art within the scope of the essence of the present invention shall also fall within the protection scope of the present invention.

Claims

1. Application of a heat shock transcription factor bd1650 gene in increasing the content of fucoxanthin in Phaeodactylum tricornutum, characterized in that: The described bd1650 The nucleotide sequence of the gene is shown in SEQ ID NO: 1, and knocking out this gene can increase the content of fucoxanthin in Phaeodactylum tricornutum.

2. Use of a heat shock transcription factor gene according to claim 1 bd1650 in increasing the content of fucoxanthin in Phaeodactylum tricornutum, characterized in that: The amino acid sequence of the protein encoded by bd1650 is shown in SEQ ID NO:

2.

3. Use of a heat shock transcription factor as described in claim 1 bd1650 in increasing the content of fucoxanthin in Phaeodactylum tricornutum, characterized in that: By knocking out the bd1650 gene in Phaeodactylum tricornutum, the expression of fucoxanthin synthesis genes CRTISO5 and ZEP1 can be positively regulated, thereby increasing the content of fucoxanthin.

Images