Method for improving cold resistance of rice in seedling stage

Abstract

The invention discloses a method for improving cold resistance of rice in a seedling stage, and relates to the field of rice gene engineering. According to the method, target rice is subjected to gene editing, so that a rice OsPMEI28 gene sequence is subjected to base deletion, insertion or base replacement, and corresponding encoding protein is mutated, so that the cold stress resistance of the target rice in the seedling stage is improved; it is found for the first time that after the OsPMEI28 gene is knocked out through the CRISPR / Cas9 technology, the methyl esterification degree of rice pectin is remarkably reduced, the cold resistance of rice is remarkably improved, a new gene resource is provided for cold-resistant breeding of rice, and the application has a large application prospect in cultivation of cold-resistant rice varieties.

Description

Technical Field

[0001] The invention belongs to the field of rice genetic engineering and relates to a method for improving the cold stress tolerance of rice seedlings by knocking out a rice pectin methylesterase inhibitor protein encoding gene OsPMEI28 and a CRISPR / Cas9 target DNA sequence thereof. Background Art

[0002] Rice is a tropical and subtropical crop. When the ambient temperature drops below 16°C, the metabolism and physiological processes of rice plants will be irreversibly damaged, namely, chilling injury (Caton BP, Foin TC, Gibson KD, Hill JE (1998) A temperature-based model of direct-, water-seeded rice (Oryza sativa) stand establishment in California. Agricultural and Forest Meteorology, 90(1):91-102.), resulting in reduced crop yields. About 24 countries in the world have encountered serious chilling damage problems, and the global rice production loss due to chilling damage is about 3 to 5 billion kilograms each year (Fei YB, Shu NH, Huang T, Zhao SH (1994) Cellula rand biochemical correlates to chilling and Freezing tolerance inplant. Biotechnology Progress, 14: 40-43; Han Longzhi, Park Zhongze, Gao Xizong (2003) The influence of rice cold tolerance on the cold water response of rice quality. Chinese Agricultural Science, 36 (7): 757-763).

[0003] Pectin is an important component of the primary cell wall. It is synthesized in the Golgi apparatus and secreted into the apoplast in a fully methyl-esterified form (Wang X, Wilson L, Cosgrove DJ. (2020) Pectin methylesterase selectively softens the onion epidermal wall yet reduces acid-induced creep. J Exp Bot. 71(9): 2629-2640.). The low methylation degree (DM) of pectin is essential for enhancing cell wall rigidity, regulating plant growth and development, and improving abiotic resistance (such as drought) (Du J, Anderson CT, Xiao C (2022) Dynamics of pectic homogalacturonan in cellular morphogenesis and adhesion, wall integrity sensing and plant development. Nat Plants. 8 (4): 332-340; Cheng M, Meng F, Qi H, Mo F, Wang P, et al. (2022) Escaping drought: The pectinmethylesterase inhibitor gene Slpmei27 can significantly change drought resistance in tomato. Plant Physiol Biochem. 192: 207-217). Therefore, how to improve the cold stress tolerance of rice plants has become a technical problem that needs to be solved urgently in this field. Summary of the invention

[0004] In response to the above problems, based on the correlation between OsPMEI28 encoding pectin methylesterase inhibitory protein and the cold stress resistance of rice seedlings, the present application knocks out the gene in rice through gene editing to improve the cold stress resistance of rice seedlings and obtain new cold-resistant rice germplasm resources.

[0005] Specifically, the present application achieves the invention objective through the following schemes:

[0006] First, the present application provides a method for improving the cold stress resistance of rice seedlings based on the rice pectin methylesterase inhibitory protein encoding gene OsPMEI28, that is, gene editing of the target rice is performed to cause base deletion, insertion or base substitution in the rice OsPMEI28 gene sequence, resulting in mutation of the corresponding encoding protein, so as to improve the cold stress resistance of the target rice seedlings.

[0007] The above gene editing refers to the transfer of a CRISPR / Cas9 gene editing vector that can edit the OsPMEI28 gene located on rice chromosome 8 into the target rice material. The CRISPR / Cas9 gene editing vector is firstly designed with a gRNA Oligo sequence according to the target DNA shown in SEQ IN NO.2, then prepared into an Oligo dimer, and then the Oligo dimer is constructed into a CRISPR / Cas vector to obtain.

[0008] Furthermore, the above-mentioned transfer refers to transforming the constructed gene editing vector into Agrobacterium (such as EHA105) and infecting the target rice callus tissue to achieve the purpose of knocking out the OsPMEI28 gene in the target rice and obtaining gene-knocked transgenic rice plants.

[0009] The nucleotide sequence of the OsPMEI28 gene is shown in SEQ ID NO:1.

[0010] The above-mentioned gRNA Oligo sequence consists of a UP Oligo sequence as shown in SEQ IN NO.3 and a LOW Oligo sequence as shown in SEQ IN NO.4.

[0011] Furthermore, after the knockout line is homozygous and stable, DNA of the gene knockout plant is extracted, and the DNA is used as a template, and PCR amplification is performed with the upstream primer (nucleotide sequence as shown in SEQ ID NO: 5) and the downstream primer (nucleotide sequence as shown in SEQ ID NO: 6) of the target gene OsPMEI28 as primers: the amplified product is then sequenced, and if the knockout line has homozygous mutations such as deletions and insertions, and its mutation causes a frameshift and causes the function of the protein to be blocked, it is considered that the transgenic rice seedling stage has improved resistance to cold stress.

[0012] Secondly, the present application provides a CRISPR / Cas9 system for editing the rice OsPMEI28 gene gRNA Oligo sequence, which is composed of a UP Oligo sequence as shown in SEQ IN NO.3 and a LOW Oligo sequence as shown in SEQ IN NO.4.

[0013] In the present application, the term "gene knockout" or "knockout" refers to a base deletion, insertion or base substitution in the OsPMEI28 gene sequence, a mutation in the corresponding encoded protein, and the resulting gene-edited strain is the "gene knockout strain".

[0014] Compared with the traditional technology, the method provided by this application has the following beneficial effects:

[0015] 1. This application first discovered that after knocking out the OsPMEI28 gene located on rice chromosome 8 using CRISPR / Cas9 technology, the degree of rice pectin methylation was significantly reduced and the cold tolerance of rice was significantly increased, providing a new method for improving the plant's tolerance to cold stress.

[0016] 2. The implementation of the method of the present invention is not limited by genetic background and can be carried out in both indica rice and japonica rice. There is no problem of trait linkage in traditional breeding. By knocking out genes in target plants through genetic engineering methods, rice plants with improved cold stress resistance can be obtained. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the verification result of the interaction between qPSR10 and OsPMEI28;

[0018] In the figure, A is the yeast two-hybrid verification of qPSR10 and OsPMEI28; B is the dual luciferase complementation experiment verification; C is the Co-IP interaction verification.

[0019] Figure 2 This is the result of site identification of OsPMEI28 gene knockout strains;

[0020] Figure 3 Schematic diagram of the pectin-related phenotype analysis and cold-tolerance phenotype identification results of OsPMEI28 gene knockout and overexpression strains;

[0021] In the figure, A is a phenotypic photo of Zhonghua 11 and the knockout strains (OsPMEI28-KO-1 and OsPMEI28-KO-2) after cold treatment; B is the survival rate (PSR%) statistics of Zhonghua 11 and the knockout strains after cold treatment; C is the pectin methylesterase activity analysis of the knockout strains; D is the methylation degree detection of pectin methyl ester in the knockout strains; E is a phenotypic photo of R6547 and the overexpression strains (OsPMEI28-OE-1 and OsPMEI28-OE-2) after cold treatment; F is the survival rate (PSR%) statistics of R6547 and the overexpression strains (OsPMEI28-OE-1 and OsPMEI28-OE-2) after cold treatment; G is the pectin methylesterase activity analysis of the overexpression strains; H is the methylation degree detection of pectin methyl ester in the overexpression strains. DETAILED DESCRIPTION

[0022] "Zhonghua 11" and R6547 are common rice varieties. The rice varieties involved in the embodiments are all preserved in the laboratory of Jiangsu Lixiahe Agricultural Science Research Institute.

[0023] Example 1: Mining of OsPMEI28

[0024] In the previous work, the applicant cloned a rice cold tolerance-related gene qPSR10 (“Xiao N, Gao Y, Qian H, Gao Q, WuY Zhang D, Zhang X, Yu L, Li Y, Pan C, Liu G, Zhou C, Jiang M, HuangN, Dai Z, Liang C, Chen Z, Chen J, Li A. (2018) Identification of Genes Related to ColdTolerance and a FunctionalAllele That Confers ColdTolerance. Plant Physiology. 177(3): 1108-1123.”). In the process of studying the function of the qPSR10 gene, the applicant used the yeast two-hybrid screening library method to mine the pectin methylesterase inhibitory protein OsPMEI28 that interacts with qPSR10, and verified the interaction in vivo and in vitro. The results are as follows: Figure 1 As shown, the specific method is as follows:

[0025] 1) Yeast two-hybrid experiment: The coding sequence of qPSR10 was cloned into the pGBKT7 vector, and the coding sequence of OsPMEI28 was cloned into the pGADT7 vector. The recombinant vectors were co-transformed into the yeast strain AH109 in pairs, and then selected on a medium lacking tryptophan and leucine (SD / Trp / Leu). The positive colonies were picked to SD / Trp / Leu medium and SD / Trp / His / Leu / +20mM 3-AT medium, and the colonies were observed after culturing at 30°C for 4 days. pGADT7-LargeT and pGBKT7-p53 were used as positive controls, and pGADT7-LargeT and pGBKT7-lamic were used as negative controls. The vectors used in this method are conventional commercially available vectors, and the methods are conventional methods in the art. The experimental results are shown in the figure. Figure 1 As shown in A;

[0026] 2) Dual luciferase complementation experiment: The coding sequence of qPSR10 was cloned into the pCAMBIA1300-cLUC vector, and the coding sequence of OsPMEI28 was cloned into the pCAMBIA1300-nLUC vector. The recombinant plasmids were transformed into Agrobacterium tumefaciens GV3101 and then injected into 4-week-old Nicotiana benthamiana leaves in pairs. After 48 hours of culture, 1mM fluorescent reagent was injected into the leaves, and the fluorescent signal was captured using the Tanon-5200 imaging system. AtFLS2-nLUC+ATAG1-cLUC was used as a positive control. The vectors used in this method are conventional commercially available vectors, and the methods are conventional methods in the field. The experimental results are shown in Figure 2. Figure 1As shown in B;

[0027] 3) Co-IP experiment: The coding sequence of qPSR10 was cloned into the pCAMBIA-3×Flag vector, and the coding sequence of OsPMEI28 was cloned into the pBinGFP2 vector, respectively. All recombinant plasmids were transferred into Agrobacterium tumefaciens GV3101. Agrobacterium tumefaciens GV3101 strains carrying the recombinant vectors were mixed at OD600=0.5 and infiltrated into leaves of 4-week-old Nicotiana benthamiana leaves. After 48 hours of incubation, proteins were extracted from the infiltrated leaf tissue with extraction buffer (50 mM HEPES [pH 7.5], 150 mM KCl, 1 mM EDTA, 1 mM DTT, 0.5% TritonX-100 and protease inhibitor cocktail [Sigma-Aldrich]), bound to 30 μL protein A+G agarose (such as commercially available Beyotime, P2012) and 2 μL GFP antibody (such as commercially available Abcam, ab290), and incubated at 4°C for 12 hours or overnight. The agarose beads were then washed 3 to 5 times with 1x PBS buffer and eluted with elution buffer (200 mM glycine [pH = 2.5] and 1 M Tris base [pH = 10.4]). The eluted proteins were used immediately or stored at -80°C. 1x SDS loading buffer was added to the samples, boiled for 10 minutes, and then subjected to SDS-PAGE and IB analysis. The antibodies used for Co-IP and WB experiments in this study were anti-GFP (such as commercially available Abcam, ab290) and anti-Flag (such as commercially available Abcam, ab205606). The ChemDoc TouchImaging system (Bio-Rad) was used to capture the stripes. The vector used in this method is a conventional commercial vector, and the method is a conventional method in the art. The experimental results are shown in Figure 2. Figure 1 As shown in C.

[0028] Through the above experiments, OsPMEI28 protein was successfully obtained, and its encoding nucleotide sequence is shown in SEQ IN NO.1.

[0029] Example 2 Functional verification of OsPMEI28 gene

[0030] 2.1 Functional verification of OsPMEI28 overexpression

[0031] In order to explore the application of OsPMEI28 in enhancing the cold tolerance of rice, this example used indica rice R6547 as the receptor material to create an overexpression strain of the gene. The specific method is as follows:

[0032] 2.1.1) Cloning of gene fragments:

[0033] Select leaf materials of Zhonghua 11 rice at the four-leaf stage, use RNA extraction kit (such as commercially available Tiangen, DP441) to extract RNA from the leaves of each transgenic rice line, use reverse cDNA kit (such as commercially available Vazyme, R312) to obtain cDNA, and the specific processing method is carried out according to the instructions of the corresponding kit.

[0034] OsPMEI28 specific amplification primers were designed, and the nucleotide sequences of the upstream and downstream primers were shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively. Using cDNA as a template, high-fidelity DNA polymerase (NoviZan, P510) and the above-mentioned specific primers were used for PCR amplification:

[0035] The PCR reaction system was as follows: 2× PhantaFlash Master Mix 25 μL, upstream primer (10 μM) 2 μL, downstream primer (10 μM) 2 μL, template cDNA 1 μg, ddH 2 0 to a total volume of 50 μL.

[0036] The PCR amplification program was pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s, for 30 cycles; and final extension at 72°C for 10 min.

[0037] The amplified product was subjected to agarose gel electrophoresis and then recovered using a gel recovery kit (such as commercially available Novezan, DC301) to obtain the amplified product for later use; the specific method of use was performed according to the instructions of the kit, and the DNA concentration was determined using a nucleic acid concentration detector OD-1000 (One Drop).

[0038] 2.1.2) Construction of overexpression vector:

[0039] The original vector pBWA(V)HS and the amplified product obtained in step 2.1.1) were digested with BsaI endonuclease (Biorun, #RCA02). The digestion system was as follows: 10× Buffer 2 μL, BsaI 2 μL, DNA of the amplified product obtained in step 2.1.1) 2 ug, and ddH 2 O to a total volume of 20 μL. After 1 h of enzyme digestion at 37°C, the above enzyme digestion products were purified using a PCR purification kit to obtain OsPMEI28 and vector pBWA(V)HS purified products. This step was performed according to the instructions, and the DNA concentration was measured using a nucleic acid concentration detector OD-1000 (One Drop).

[0040] T4 DNA ligase was then used to connect the digested vector and the digested fragment. The ligation system was as follows: 10× Buffer 2 μL, T4 ligase 2 μL, pBWA(V)HS 0.3 pmol, OsPMEI28 purified product 0.03 pmol, ddH 2 O to a total volume of 20 μL. After ligation at 20°C for 1 hour, 10 μL of the ligation product was transformed into E. coli competent cells and spread on a kanamycin-resistant plate, cultured at 37°C for 12 hours, and a single colony was picked for plaque PCR identification. The nucleotide sequence of the upstream primer for colony PCR identification is shown in SEQ ID NO: 5, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 6.

[0041] The PCR reaction system was: 2×Phanta Flash Master Mix 5 μL, upstream primer (10 uM) 0.5 μL, downstream primer (10 uM) 0.5 μL, ddH 2 2. 4 μL of HO.

[0042] The amplified product was identified by agarose gel electrophoresis, and a plasmid extraction kit (such as commercially available Novezan, DC201) was used to extract the plasmid from a single colony with the target band and sequenced for identification. The correctly identified plasmid was the recombinant plasmid and was stored for future use.

[0043] 2.1.3) Obtaining transgenic plants:

[0044] The recombinant plasmid obtained in step 2.1.2) was transformed into EHA105 Agrobacterium and infect rice callus (Agrobacterium method is a conventional method in the art, and this embodiment is carried out with reference to the method disclosed in the document "Zhao W, Zheng S, Ling HQ (2011) An efficient regeneration system and Agrobacterium-mediated transformation of Chinese upland rice callus, Handao 297. Plant Cell Tissue & Organ Culture. 106 (3): 475") to obtain transgenic plants, and after fluorescence quantitative PCR screening and identification, a stable genetic transgenic strain was obtained, which was the overexpression strain.

[0045] The sequences of upstream and downstream primers for fluorescence quantitative analysis of OsPMEI28 are shown in SEQ ID No.7 and SEQ ID No.8. The fluorescence quantitative PCR screening method is as follows: RNA extraction kit (such as commercially available Tiangen, DP441) is used to extract RNA from rice leaves of each transgenic strain, and cDNA is obtained using a reverse cDNA kit (such as commercially available Vazyme, R312). Real-time PCR uses a Biorad CFX96 real-time PCR instrument for fluorescence quantitative detection, OsActin is used as an internal reference gene, and three biological replicates are performed. The specific method of use is operated according to the instructions of the kit. This method can be used to verify the results of transgenic overexpression.

[0046] 2.1.3) Identification of cold stress tolerance and pectin-related phenotypes of overexpression lines:

[0047] The cold stress tolerance of each overexpression strain was identified, and the specific method was as follows: the seeds of the parent and the gene overexpression strain were germinated and grown to the 4-leaf stage, the total number of seedlings was counted and placed in a 4°C environment for cold treatment, and after 48 hours of cold treatment, the seedlings were placed in normal conditions for 7 days, and the survival rate of the seedlings was counted after 7 days.

[0048] The survival rate of seedlings of each strain after cold stress treatment was counted. Figure 3 E in the middle is the cold-treatment phenotype photo of the parent R6547 and the overexpression lines (OsPMEI28-OE-1 and OsPMEI28-OE-2). Figure 3 F in the middle is the statistical result of survival rate, which shows that the survival rate of the parent R6547 is only 18.4%, while the survival rate of the OsPMEI28 overexpression strain is 2.8%. The above results show that the survival rate of the overexpression strain is significantly lower than that of the parent.

[0049] The pectin-related phenotypes of the overexpression strains were identified, mainly including the determination of pectin content and pectin lyase activity. The specific methods are as follows:

[0050] The seeds of the parent and overexpression lines were germinated and grown to the 4-leaf stage, and fresh leaves were taken and the activity of pectin methylesterase was detected using a pectin esterase activity assay kit (such as commercially available Solarbio, BC2700); the degree of methylation of pectin was detected using a pectin methylation degree test kit (such as commercially available Comin, GJJ-2-W).

[0051] The results of the test are as follows Figure 3As shown in G and H, the results showed that the pectin methylesterase activity of the OsPMEI28 overexpression line (OsPMEI28-OE-1) was significantly reduced and the degree of pectin methylesterification was significantly increased compared with the parent R6547. The above test results prove that the expression of the OsPMEI28 gene is negatively correlated with the ability of rice seedlings to resist cold stress.

[0052] 2.2 Functional verification of OsPMEI28 knockout strains

[0053] 2.2.1) Construction of OsPMEI28 knockout strain:

[0054] First, according to the OsPMEI28 coding nucleotide sequence shown in SEQ ID NO: 1, the target DNA sequence was designed as shown in SEQ ID NO: 2. Then, the CRISPR / Cas9 gene editing vector of OsPMEI28 was constructed using a CRISPR / Cas vector construction kit (Baige, BGK032), and the specific steps were as follows:

[0055] A) Design and synthesize gRNA Oligo sequence according to the designed target DNA sequence (as shown in SEQ ID NO: 2), UPOligo sequence: TGTGTCCACGCTGTGCTCCCGCTCA (SEQ IN NO. 3), LOW Oligo sequence: AAACTGAGCGGGAGCACAGCGTGGCA (SEQ IN NO. 4); B) Prepare Oligo dimer:

[0056] The synthesized oligo was dissolved in water to 10 μM, and the reaction system (Buffer Anneal 18 μL, UP Oligo 1 μL, LOW Oligo 1 μL) was mixed according to the kit instructions, heated at 95°C for 3 minutes, and then slowly decreased to 20°C at about 0.2°C / second;

[0057] C) Constructing the oligo dimer into the CRISPR / Cas vector:

[0058] According to the product instructions, the reaction system was constructed (2 μl of CRISPR / Cas Vector, 1 μl of Oligo dimer, 1 μl of Enzyme Mix, 6 μl of water), and the components were mixed on ice. After mixing, the mixture was reacted at room temperature (20°C) for 1 hour.

[0059] The constructed vector was transformed into Escherichia coli and the sequencing primer TCCCAGTCACGACGTTGTAA (SEQ IN NO. 9) was used to screen the correct recombinant clones. The plasmid extracted from the correct positive single colony was the final CRISPR / Cas9 gene editing vector of OsPMEI28.

[0060] D) The CRISPR / Cas9 gene editing vector of OsPMEI28 was then transformed into EHA105 Agrobacterium and infected with Zhonghua 11 rice callus (conventional methods in the art, the method disclosed in the reference document "Zhao W, Zheng S, Ling HQ (2011) An efficient regeneration system and Agrobacterium-mediated transformation of Chinese upland rice callus Handao 297. Plant Cell Tissue & Organ Culture. 106 (3): 475"), and finally gene knockout plants were obtained.

[0061] 2.2.2) Identification of OsPMEI28 knockout strains:

[0062] Use a plant DNA extraction kit (such as the commercially available Novezan, DC104) to extract the DNA of each gene knockout strain obtained in step 2.1.1), and use the DNA as a template, the upstream primer (nucleotide sequence as shown in SEQ ID NO: 5) and the downstream primer (nucleotide sequence as shown in SEQ ID NO: 6) of the target gene OsPMEI28 as primers, and use a high-fidelity DNA polymerase (such as the commercially available Novezan, P510) to perform PCR amplification:

[0063] The PCR reaction system was: 2×PhantaFlash Master Mix 10 μL, upstream primer (10 uM) 1 μL, downstream primer (10 uM) 1 μL, template 200 ng, ddH 2 O to a total volume of 20 μL;

[0064] The PCR amplification program was pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s, for 30 cycles; and final extension at 72°C for 10 min.

[0065] After sequencing the amplified product, it can be identified whether it is a homozygous mutation. The results of the site identification in the picture are as follows: Figure 2 As shown, if the knockout strain has homozygous mutations such as deletion, insertion, or substitution, it is considered that the gene mutation causes a frameshift and causes the function of the protein to be blocked, that is, it is a homozygous gene knockout plant and is reserved.

[0066] 2.2.3) Identification of cold stress tolerance and pectin-related phenotypes of OsPMEI28 knockout lines

[0067] A) The cold-tolerant phenotype of the homozygous knockout plants (OsPMEI28-KO-1 and OsPMEI28-KO-2) obtained in the above steps was identified, and the specific method was the same as that in step 2.1) of Example 2. Figure 3 Figure A is a photo of the cold treatment phenotype detection of the parent Zhonghua 11 and the knockout strains (OsPMEI28-KO-1 and OsPMEI28-KO-2), and Figure B is the survival rate statistics, showing that the survival rate of the parent Zhonghua 11 was 83%, and the average survival rate of the OsPMEI28 gene knockout strains was 96.2%. The survival rate of the seedlings of the gene knockout strains showed a significant increase.

[0068] B) Identify the pectin-related phenotypes of the homozygous plants obtained by screening, and the specific method is as follows:

[0069] The seeds of the parental and gene-edited strains were germinated and grown to the 4-leaf stage, and fresh leaves were taken to detect the pectin methylesterase activity and the degree of methyl esterification according to the method in Example 2.1.

[0070] The experimental results are as follows Figure 3 As shown in C and D, compared with the wild type, the pectin methylesterase activity of the knockout line OsPMEI28-KO-1 increased significantly, and the degree of methyl esterification of pectin decreased significantly. The above experimental results prove that knocking out the OsPMEI28 gene can significantly increase the pectin methylesterase activity, thereby improving the resistance of rice seedlings to cold stress.

Claims

1. A method for improving cold tolerance of rice seedlings, characterized in that: The specific steps are as follows: Gene editing of target rice to make the rice OsPMEI28 Base deletion, insertion or base substitution occurs in the gene sequence, resulting in mutation of the corresponding encoded protein, so as to improve the target rice's tolerance to cold stress at the seedling stage.

2. The method for improving cold tolerance of rice seedlings according to claim 1, characterized in that: The gene editing refers to the transfer of editable OsPMEI28 CRISPR / Cas9 gene editing vector for genes.

3. The method according to claim 2, characterized in that The CRISPR / Cas9 gene editing vector is obtained by designing a gRNA Oligo sequence according to the target DNA shown in SEQ IN NO.2, then preparing an Oligo dimer, and then constructing the Oligo dimer into the CRISPR / Cas vector.

4. The method according to claim 2, characterized in that: The transfer refers to transforming the gene editing vector into Agrobacterium and infecting the target rice callus.

5. The method according to claim 3, characterized in that: The gRNA Oligo sequence consists of an UP Oligo sequence as shown in SEQ IN NO.3 and a LOW Oligo sequence as shown in SEQ IN NO.

4.

6. The method according to claim 4, characterized in that The Agrobacterium is EHA105.

7. A CRISPR / Cas9 system for editing rice OsPMEI28 The gRNA Oligo sequence of the gene, the sequence is composed of the UP Oligo sequence shown in SEQ IN NO.3 and the LOW Oligo sequence shown in SEQ IN NO.4.

Images