Molecular marker for screening rice varieties in gleying rice field and application of molecular marker

Abstract

The invention discloses a molecular marker for screening rice varieties in a gleying rice field and application of the molecular marker, provides application of a primer group for detecting the molecular marker in identifying the mesocotyl length of rice, and detects that the genotypes of to-be-detected rice based on a Kasp-9-10.0 site are TT homozygotic type, CC homozygotic type, CC homozygotic type, TT homozygotic type, CC homozygotic type and CC homozygotic type. The length of the rice mesocotyl can be effectively evaluated by detecting the genotype of the Kasp-9-10.0 site, the length of the rice mesocotyl can be identified by detecting the genotype of to-be-detected rice based on the Kasp-9-10.0 site, and the molecular marker has important application value in the rice molecular marker assisted breeding process.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a molecular marker for screening rice varieties in latent paddy fields and an application thereof. Background Art

[0002] The main methods of rice planting at present include transplanting and direct seeding. The seedling transplanting method has low planting efficiency and consumes a lot of agricultural water. With the development of society, a large number of rural labor forces have been lost, the aging process of the population has accelerated, and arable land and water resources have become increasingly scarce. The disadvantages of this planting method are becoming increasingly obvious. Therefore, the direct seeding rice cultivation technology with the advantages of high mechanization, resource conservation, light weight and high efficiency has come into being. Direct seeding of rice directly sows rice seeds into the field without the need for seedling raising and transplanting. It is more efficient and cost-saving than traditional rice farming methods, and can effectively solve the problems of high rice planting costs and labor shortages in my country.

[0003] The success rate of rice seedlings is the key to the success of direct seeding. Submerged rice fields are the most common low-yield fields in southern my country, accounting for about 1 / 3 of the rice fields in the south. Submerged rice fields have many obstacles, such as long-term stagnant water and lack of oxygen, cold water and low mud temperature, many reducing harmful substances, slow nutrient conversion, and obvious nutrient deficiency, which are extremely unfavorable to the direct seeding of rice seedlings.

[0004] Rice mesocotyl plays an important role in the emergence of rice seedlings. The seedling population with long mesocotyls can promote the emergence of rice seedlings, which is closely related to the growth of rice seedlings and subsequent yield. Developing molecular markers that can be used to screen and create new rice germplasm with long mesocotyls, and creating rice germplasm with long mesocotyls, can effectively promote the development of rice direct seeding technology and facilitate the efficient use of latent rice fields.

[0005] Currently, SNPs are the most widely distributed and most efficiently used genetic variation in the rice genome. SNP markers have gradually been used in the construction of high-density genetic maps, QTL positioning, germplasm genotype detection and genotype aggregation, effectively accelerating the molecular breeding process. The development of molecular markers tightly linked to the mesocotyl elongation QTL can be used to screen long mesocotyl varieties, and purposefully increase the mesocotyl length of varieties through molecular marker-assisted selection (MAS). Among them, KASP (Kompetitive Allele-Specific PCR) markers can accurately identify SNPs alleles, which can be effectively used to screen long mesocotyl varieties and create new germplasm. Summary of the invention

[0006] In order to overcome the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a molecular marker for screening rice varieties in latent rice fields and its application.

[0007] The technical solution adopted by the present invention to solve the technical problem is as follows: the present invention comprises a molecular marker for screening rice varieties in latent paddy fields, wherein the molecular marker is a primer set for amplifying a target sequence including a Kasp-9-10.0 site on rice chromosome 9; the primer set is composed of an upstream primer F1, an upstream primer F2 and a downstream primer R; the upstream primer F1 is composed of a fluorescent label sequence A and a DNA fragment shown at positions 22 to 40 from the 5' end of SEQ ID NO:2; the upstream primer F2 is composed of a fluorescent label sequence B and a DNA fragment shown at positions 22 to 40 from the 5' end of SEQ ID NO:3; and the nucleotide sequence of the downstream primer R is as shown in SEQ ID NO:4.

[0008] In the above primer set, the nucleotide sequence of the fluorescent tag sequence A is shown in SEQ ID NO: 2 from position 1 to position 21 from the 5' end;

[0009] The nucleotide sequence of the fluorescent tag sequence B is shown in SEQ ID NO: 3 from position 1 to position 21 from the 5' end.

[0010] In the molecular marker, the nucleotide sequence of the fluorescent tag sequence A is shown in SEQ ID NO: 2 from the 1st to the 21st position from the 5' end;

[0011] The nucleotide sequence of the fluorescent tag sequence B is shown in SEQ ID NO: 3 from position 1 to position 21 from the 5' end.

[0012] The present invention provides a primer set for identifying or assisting in identifying rice mesocotyl characteristics, which consists of an upstream primer F1, an upstream primer F2 and a downstream primer R;

[0013] The upstream primer F1 is a single-stranded DNA molecule represented by GAAGATGACCAAATTCATGCTGGACCTCATATTCATGTTGTTTGGT;

[0014] The upstream primer F2 is as follows: a single-stranded DNA molecule represented by GAAGATCGGAATCAACGGATTGACCTCATATTCATGTTGTTTGGC;

[0015] The downstream primer R is a single-stranded DNA molecule represented by TCGGATGTTACGTGTGTATGCAACC.

[0016] The present invention also includes the use of the primer set as described above, which is any one of the following b1)-b3):

[0017] b1) identifying the mesocotyl length of the rice to be tested;

[0018] b2) screening rice varieties with long mesocotyls;

[0019] b3) Rice breeding.

[0020] The present invention also includes the use of the DNA fragment shown in SEQ ID NO: 1, which is any one of the following b1)-b4):

[0021] b1) identifying the mesocotyl length of the rice to be tested;

[0022] b2) screening rice varieties with long mesocotyls;

[0023] b3) Rice breeding;

[0024] b4) as a molecular marker for identifying the mesocotyl length of the rice to be tested.

[0025] The present invention also includes a method for identifying the mesocotyl of a rice to be tested, comprising detecting the rice to be tested using the above-mentioned molecular marker for screening rice varieties in latent rice fields, comprising the following steps: detecting that the genotype of the rice to be tested based on the Kasp-9-10.0 locus is CC homozygous or TT homozygous, and then making the following judgment:

[0026] If the genotype of the rice to be tested based on the Kasp-9-10.0 locus is TT homozygous, the rice to be tested has a long mesocotyl;

[0027] If the genotype of the rice to be tested based on the Kasp-9-10.0 locus is CC homozygous, the mesocotyl of the rice to be tested is short;

[0028] The Kasp-9-10.0 site is the 37th nucleotide from the 5' end of SEQ ID NO: 1 in the rice genome.

[0029] In the above method, the steps of detecting whether the genotype of the rice to be tested is TT homozygous or CC homozygous based on the Kasp-9-10.0 locus are as follows:

[0030] (a1) using the genomic DNA of the rice to be tested as a template and the primer set of claim 1 to perform PCR amplification to obtain a PCR amplification product;

[0031] (a2) After completing step (a1), the fluorescent signal of the PCR amplification product is detected, and the genotype of the rice to be tested based on the Kasp-9-10.0 locus is obtained according to the color of the fluorescent signal.

[0032] In the above method, the steps of detecting whether the genotype of the rice to be tested is TT homozygous or CC homozygous based on the Kasp-9-10.0 locus are as follows:

[0033] (b1) using the genomic DNA of the rice to be tested as a template and the primer set of claim 1 to perform PCR amplification to obtain a PCR amplification product;

[0034] (b2) taking the PCR amplification product obtained in step (b1) and sequencing it;

[0035] (b3) According to the sequencing results obtained in step (b2), the genotype of the rice to be tested based on the Kasp-9-10.0 locus is obtained.

[0036] The present invention also includes a kit, comprising a substance for detecting the genotype of the rice to be tested based on the Kasp-9-10.0 locus;

[0037] The Kasp-9-10.0 site is the 37th nucleotide from the 5' end of SEQ ID NO: 1 in the rice genome.

[0038] In the above-mentioned kit, the substance for detecting the genotype of the rice to be tested based on the Kasp-9-10.0 locus is any one of the above-mentioned primer sets.

[0039] The present invention also protects the use of any of the above-mentioned kits, which is any of the following b1)-b3):

[0040] b1) identifying the mesocotyl length of the rice to be tested;

[0041] b2) screening rice varieties with long mesocotyls;

[0042] b3) Rice breeding.

[0043] Compared with the prior art, the present invention has the following beneficial effects:

[0044] The method provided by the present invention is used to detect whether the genotype of the rice to be tested based on the Kasp-9-10.0 locus is TT homozygous or CC homozygous. By detecting the genotype of the Kasp-9-10.0 locus, the length of the rice mesocotyl can be effectively evaluated. The specific judgment criteria are as follows: if the genotype of the Kasp-9-10.0 locus of the rice to be tested is TT homozygous, the rice may have a longer mesocotyl; if the genotype of the Kasp-9-10.0 locus of the rice to be tested is CC homozygous, the mesocotyl of the rice may be shorter. By detecting the genotype of the rice to be tested based on the Kasp-9-10.0 locus, the length of the rice mesocotyl can be identified, which has important application value in the process of rice molecular marker-assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1The genotyping results of Kasp-9-10.0 on the IR 145 / KALASU F2:3 population in the example; red in the figure represents the KALASU genotype (TT), blue represents the IR 145 genotype (CC), pink represents detection failure, and green represents heterozygous (CT).

[0046] Figure 2 The genotyping results of Kasp-9-10.0 for 470 Indica rice varieties in the example; red in the figure is the KALASU genotype (TT), blue is the IR 145 genotype (CC), pink is the detection failure, and green is heterozygous (CT). DETAILED DESCRIPTION

[0047] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0048] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0049] 'IR 145' is an important indica material, in which the hypocotyl is short, only 0.18cm, while Kalasu has a longer hypocotyl, 4.20cm.

[0050] IR145 See: Liu, J., Zhan, J., Chen, J., Lu, X., Zhi, S., & Ye, G. (2021). Validation of genes affecting rice grain zinc content through candidate gene-based association analysis. Frontiers in Genetics, 12, 701658.

[0051] KALASU See: Wang, Y., Liu, J., Meng, Y., Liu, H., Liu, C., & Ye, G. (2021). Rapid identification of QTL for mesocotyl length in rice through combining QTL-seqand genome-wide association analysis. Frontiers in Genetics, 12, 713446.

[0052] Example 1. Development and polymorphism detection of rice mesocotyl length molecular marker Kasp-9-10.0

[0053] Ⅰ Development of molecular marker Kasp-9-10.0

[0054] The inventors of the present invention have designed and synthesized a primer set suitable for identifying the length of rice mesocotyls by allele competitive specific PCR method on rice chromosome 9 (10024501bp) through a large number of experiments and by fine positioning. The primer set consists of three primer sequences, namely, upstream primer F1 (FAM), upstream primer F2 (HEX) and downstream primer R, and is used to amplify the target sequence including the Kasp-9-10.0 site. The nucleotide sequences of each primer are shown in Table 1.

[0055] Table 1 Nucleotide sequences of each primer

[0056]

[0057] The Kasp-9-10.0 locus is the 37th nucleotide from the 5' end of SEQ ID NO: 1 in the rice genome, and the genotypes are TT homozygous, AA homozygous and AT heterozygous. SEQ ID NO: 1: TTTTTATATTATGGACCTCATATTCATGTTGTTTGG[C / T]ACTTAAGCATATAATTAT TACGATGGATCGTTTATT.

[0058] Since genomic DNA is a double-stranded DNA molecule composed of two reverse complementary single-stranded DNA molecules, the DNA molecule encoding the protein is generally named as the sense DNA molecule; the DNA molecule that is reverse complementary to the sense DNA molecule is named as the antisense DNA molecule. The genotypes of the Kasp-9-10.0 locus are all sense DNA genotypes.

[0059] Ⅱ Polymorphism detection

[0060] 1. Phenotypic identification of mesocotyls of IR 145 / KALASU in the field

[0061] In June 2018, 'IR145' was hybridized with KALASU; after the F1 generation seeds were harvested, they were processed for southern propagation at the experimental base in Lingshui County, Hainan Province in December 2018, and F2 generation seeds were obtained from individual plants in April 2019. About 400 full rice grains were selected from the F2 generation seeds and sown in a 10×5 hole tray filled with uniformly proportioned nutrient soil, with a sowing depth of 6 cm. The nutrient soil was covered until it was flush with the surface of the hole. After that, 500g of nutrient soil was placed in the tray and compacted, the tray was placed in the tray, and the tray and tray were sprayed with appropriate amount of tap water respectively. The entire equipment was placed in a constant temperature and dark incubator at 30℃ for cultivation. Watering was carried out at a fixed time every day until seedlings emerged, and the germination status was recorded. After about 10 days of constant temperature cultivation, the tray was removed from the artificial climate box, and the root soil of the seedlings was quickly rinsed with running water to remove individual plants under extreme growth conditions. The lines with uniform growth were photographed and the length of their hypocotyls was measured using Image J software.

[0062] 2. Molecular identification of 318 rice F2:3 populations

[0063] (1) The CTAB method was used to extract genomic DNA from young leaves of 232 rice germplasm resources to meet the requirements of PCR. The specific standards were as follows: agarose electrophoresis should show a single DNA band; the A260 / A280 ratio should be between 1.8 and 2.0, the A260 / A230 ratio should also be between 1.8 and 2.0, and there should be no significant light absorption at 270 nm when detected by UV spectrophotometer Nanodrop2100 (Thermo); the DNA concentration should be between 50 and 200 ng / μL.

[0064] (2) Perform competitive allele-specific PCR. Using the extracted rice genomic DNA as a template, perform PCR amplification using the primer set synthesized in step 3 to generate PCR products. The PCR reaction procedure is as follows: pre-denaturation at 94°C for 15 minutes; then denaturation at 94°C for 20 seconds, 61°C to 55°C (using a touch down procedure, the temperature decreases by 0.6°C per cycle), 1 minute, for a total of 10 cycles; then denaturation at 94°C for 20 seconds, 55°C for 1 minute, and continue amplification for 26 cycles.

[0065] (3) After step (2), when the temperature of the PCR amplification product drops below 40°C, the fluorescence value is read by scanning the FAM and HEX beams of the microplate reader (the FAM fluorescent label is read at an excitation light of 485nm and an emission light of 520nm, and the HEX fluorescent label is read at an excitation light of 528nm and an emission light of 560nm). The genotype of the rice to be tested based on the Kasp-9-10.0 locus is determined according to the color of the fluorescent signal. The specific judgment rules are as follows: If the sample to be tested shows a blue fluorescent signal based on the Kasp-9-10.0 locus, the Kasp-9-10.0 locus of the rice is TT homozygous, which is consistent with KALASU; if a red fluorescent signal is shown, it is CC homozygous, which is consistent with IR145; if a green fluorescent signal is shown, it is TC heterozygous. The test results are as follows. Figure 1 3. Significance Analysis

[0066] The length of the mesocotyl of the two genotypes of rice was statistically analyzed, and the results are listed in Table 2. At the same time, the t-test analysis was performed using the PROC TTEST model in the internationally recognized SAS9.2 statistical software. The statistical results are shown in Table 3. The data showed that the average length of the mesocotyl of the CC homozygous rice variety was 1.40 cm, which was 21.3% less than that of the TT homozygous rice variety (the average length of the mesocotyl was 1.78 cm), and there was a significant difference at the significance level of 0.05 (see Table 3). This finding shows that the length of the mesocotyl of rice can be effectively evaluated by detecting the genotype of the Kasp-9-10.0 locus. The specific judgment criteria are as follows: if the Kasp-9-10.0 locus genotype of the rice to be tested is TT homozygous, then the rice may have a longer mesocotyl; if the Kasp-9-10.0 locus genotype of the rice to be tested is CC homozygous, then the mesocotyl of the rice may be shorter.

[0067] Table 2 KASP-9-10.0 detection results and mesocotyls in IR 145 / KALASU F2:3 population

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077] KALASU genotype (TT, blue), IR 145 genotype (CC, red), green heterozygous (CT)

[0078] Table 3 Mesocotyl association analysis of Kasp-1-38383221 in IR 145 / KALASU population

[0079]

[0080] Example 2 Analysis and verification of the association between primer sets and mesocotyl length in natural rice varieties

[0081] 1. Detection of genotypes of 236 rice varieties at the KASP-9-10.0 locus

[0082] According to the steps in Example 1, the rice to be tested was replaced with 236 different varieties, and the other steps remained unchanged. After the operation, the genotype detection results of these 236 rice varieties at the KASP-9-10.0 locus were obtained, as shown in Figure 2 .

[0083] 2. Measure the length of the mesocotyl

[0084] The rice materials were 236 rice varieties from the Indica subgroup in Southeast Asia and South Asia. Fifteen complete and crack-free rice grains were selected from each material and sown in a 10×5 hole tray filled with quantitatively formulated nutrient soil. Fifteen grains were placed in each hole, and the sowing depth was set to 6 cm to ensure that there was no overlap between the grains and the nutrient soil was covered to the same level as the hole surface. Subsequently, 500 g of nutrient soil was weighed and placed in the tray and compacted. The tray was placed in the tray, and the tray and tray were sprayed with appropriate amounts of tap water. The entire device was placed in a constant temperature, dark incubator at 30°C for cultivation. Watering was performed at a fixed time every day until seedlings emerged, and the germination status was recorded. After about 10 days of constant temperature cultivation, the tray was removed from the artificial climate box, and the soil at the roots of the seedlings was quickly rinsed with running water to remove the individual plants with significant differences in growth conditions. The uniformly growing lines were photographed, and the length of their embryonic axes was measured using Image J software.

[0085] The sources of materials are recorded as follows: Wang W, Mauleon R, Hu Z, Chebotarov D, Tai S, Wu Z, Li M, Zheng T, Fuentes RR, Zhang F, Mansueto L, Copetti D, Sanciangco M, Palis KC, Xu J, Sun C, Fu B, Zhang H, Gao Y, Zhao X, Shen F, Cui X, Yu H, Li Z, Chen M, Detras J,ZhouY,Zhang X,Zhao Y,Kudrna S,Wang C,Li R,Jia B,Lu J,He Z,Naredo MEB,Talag J,Wang X,Li J, Fang

[0086] 3. Correlation analysis

[0087] The average mesocotyl length of the two genotypes of rice was statistically analyzed (Table 4), and the t-test was performed using the internationally used SAS9.2 statistical software PROC TTEST model. The statistical results are shown in Table 5. The results showed that the average mesocotyl length of the CC homozygous rice variety (mesocotyl 1.01 cm) was 26.3% lower than that of the TT homozygous rice variety (mesocotyl 1.37 cm), and there was a significant difference at the 0.05 level (Table 5).

[0088] Table 4 Genotype detection results of 470 rice varieties

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097] KALASU genotype (TT, blue), IR 145 genotype (CC, red), green heterozygous (CT)

[0098] Table 5 Association analysis of mesocotyl length of Kasp-1-38383221 in IR 145 / KALASU population

[0099]

[0100] The above results show that the length of rice mesocotyl can be identified by detecting the genotype of the tested rice based on the Kasp-9-10.0 locus, which has important application value in the process of rice molecular marker-assisted breeding.

[0101] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A molecular marker for screening rice varieties in latent rice fields, characterized in that: The molecular marker is a primer set for amplifying a target sequence including the Kasp-9-10.0 site on rice chromosome 9; the primer set consists of an upstream primer F1, an upstream primer F2 and a downstream primer R; the upstream primer F1 consists of a fluorescent label sequence A and a DNA fragment shown at positions 22 to 40 from the 5' end of SEQ ID NO:2; the upstream primer F2 consists of a fluorescent label sequence B and a DNA fragment shown at positions 22 to 40 from the 5' end of SEQ ID NO:3; the nucleotide sequence of the downstream primer R is shown in SEQ ID NO:

4.

2. A molecular marker for screening rice varieties in latent paddy fields as claimed in claim 1, characterized in that: The nucleotide sequence of the fluorescent tag sequence A is shown in SEQ ID NO: 2 from position 1 to position 21 from the 5' end; The nucleotide sequence of the fluorescent tag sequence B is shown in SEQ ID NO: 3 from position 1 to position 21 from the 5' end.

3. A primer set for identifying or assisting in identifying the characteristics of rice mesocotyls, consisting of an upstream primer F1, an upstream primer F2 and a downstream primer R; The upstream primer F1 is as follows: a single-stranded DNA molecule represented by GAAGATGACCAAATTCATGCTGGACCTCATATTCATGTTGTTTGGT; The upstream primer F2 is as follows: a single-stranded DNA molecule represented by GAAGATCGGAATCAACGGATTGACCTCATATTCATGTTGTTTGGC; The downstream primer R is a single-stranded DNA molecule represented by TCGGATGTTACGTGTGTATGCAACC.

4. The use of the molecular marker according to any one of claims 1 to 3, characterized in that: Any one of the following b1)-b3): b1) identifying the mesocotyl length of the rice to be tested; b2) screening rice varieties with long mesocotyls; b3) Rice breeding.

5. A method for identifying the mesocotyl of a rice plant to be tested, comprising detecting the rice plant to be tested using the molecular marker for screening rice varieties in latently incubated paddy fields as claimed in claim 1, characterized in that: The method comprises the following steps: detecting that the genotype of the rice to be tested is CC homozygous or TT homozygous based on the Kasp-9-10.0 locus, and then making the following judgment: If the genotype of the rice to be tested based on the Kasp-9-10.0 locus is TT homozygous, the rice to be tested has a long mesocotyl; If the genotype of the rice to be tested based on the Kasp-9-10.0 locus is CC homozygous, the mesocotyl of the rice to be tested is short; The Kasp-9-10.0 site is the 37th nucleotide from the 5' end of SEQ ID NO: 1 in the rice genome.

6. The method for identifying the mesocotyl of rice to be tested according to claim 5, characterized in that: The steps of detecting whether the genotype of the rice to be tested is TT homozygous or CC homozygous based on the Kasp-9-10.0 locus are as follows: (a1) using the genomic DNA of the rice to be tested as a template and the primer set of claim 1 to perform PCR amplification to obtain a PCR amplification product; (a2) After completing step (a1), the fluorescent signal of the PCR amplification product is detected, and the genotype of the rice to be tested based on the Kasp-9-10.0 locus is obtained according to the color of the fluorescent signal.

7. The method for identifying the mesocotyl of rice to be tested according to claim 5, characterized in that: The steps of detecting whether the genotype of the rice to be tested is TT homozygous or CC homozygous based on the Kasp-9-10.0 locus are as follows: (b1) using the genomic DNA of the rice to be tested as a template and the primer set of claim 1 to perform PCR amplification to obtain a PCR amplification product; (b2) taking the PCR amplification product obtained in step (b1) and sequencing it; (b3) According to the sequencing results obtained in step (b2), the genotype of the rice to be tested based on the Kasp-9-10.0 locus is obtained.

8. A kit comprising a substance for detecting the genotype of a rice plant to be tested based on the Kasp-9-10.0 locus; The Kasp-9-10.0 site is the 37th nucleotide from the 5' end of SEQ ID NO: 1 in the rice genome.

9. The kit according to claim 8, characterized in that: The material for detecting the genotype of the rice to be tested based on the Kasp-9-10.0 site is the primer set according to claim 1.

10. The use of the kit according to claim 8 or 9, which is any one of the following b1) to b3): b1) identifying the mesocotyl length of the rice to be tested; b2) screening rice varieties with long mesocotyls; b3) Rice breeding.

Images