Sensor based on allosteric probe catalysis CRISPR-Cas12a and double-color proportion long-afterglow nanomaterial and application thereof

Abstract

The invention discloses a sensor based on an allosteric probe for catalyzing CRISPR-Cas12a and a double-color proportion long-afterglow nano material and application of the sensor. The sensor comprises a red light-emitting long-afterglow material ZnGa2O4: Cr combined with a BHQ3 modified allosteric probe, a methylated green light-emitting long-afterglow nano material Zn2GeO4: Mn, a primer sequence and a Cas12a enzyme. In the detection process, after the allosteric probe is combined with a detected object, a primer binding site structural domain is exposed, double-stranded DNA is generated under the assistance of DNA polymerase, a Cas12a-crRNA compound is combined to the double-stranded DNA, the trans-cleavage activity of Cas12a is started, BHQ3 releases red fluorescence after cleavage to serve as a detection signal, and the red fluorescence interacts with ZGM-N + (CH3) 3 with positive charges in an electrostatic mode to prepare the fluorescent probe capable of emitting light in a proportional mode. Ultra-sensitive and high-specificity detection of pathogenic microorganisms is realized, and the kit is not interfered by self-fluorescence and external interference.

Description

Technical Field

[0001] The present invention relates to the field of detection, in particular to a sensor based on allosteric probe catalysis CRISPR-Cas12a and a two-color ratio long afterglow nanomaterial, and also to the application of the sensor. Background Art

[0002] Methicillin-resistant Staphylococcus aureus (MRSA) is a common clinical antibiotic-resistant pathogen with strong pathogenicity. The infections it causes are difficult to treat and have a high mortality rate. Therefore, timely and accurate detection and identification of MRSA are crucial to curbing the spread of this pathogen. MRSA detection methods include traditional bacterial isolation and culture, amplification-based molecular diagnostic technology, and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF). However, these methods often require complex and time-consuming procedures, limiting their applicability for rapid detection and on-site monitoring of microbial contamination. Especially in the initial stage of pathogen infection, effectively quantifying low-level pathogens remains a daunting challenge.

[0003] Therefore, there is an urgent need for a rapid and simple MRSA detection method. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a sensor based on allosteric probe catalysis CRISPR-Cas12a and a two-color ratio long afterglow nanomaterial; the second object of the present invention is to provide the application of the sensor based on allosteric probe catalysis CRISPR-Cas12a and a two-color ratio long afterglow nanomaterial as a reagent for detecting pathogens.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] 1. Based on the allosteric probe catalysis CRISPR-Cas12a and dual-color ratio long afterglow nanomaterial sensor, the sensor includes a red luminescent long afterglow material ZnGa2O4:Cr (ZGC) combined with a BHQ3-modified allosteric probe, a methylated green luminescent long afterglow nanomaterial Zn2GeO4:Mn (ZGM), a primer sequence and a Cas12a enzyme;

[0007] The allosteric probe consists of an aptamer domain that specifically recognizes the sequence to be detected, a primer binding site domain and a stem-loop sequence domain; the primer binding site domain is complementary to the primer sequence.

[0008] Preferably, the stem-loop sequence domain of the allosteric probe is 12 to 14 nucleotides.

[0009] Preferably, in the present invention, the sequence of the allosteric probe is shown as SEQ ID NO.1, and the sequence of the primer is shown as SEQ ID NO.2.

[0010] Preferably, the red light-emitting long afterglow material ZGC is prepared by dissolving 1M Zn(NO3)2·6H2O, 2M Ga(NO3)3·xH2O and 0.5M Cr(NO3)3·9H2O in water, adding 28% ammonia water by mass, adjusting the pH to 9.0, and reacting at 220°C for 10 hours to obtain the target product.

[0011] Preferably, the green luminescent long afterglow nanomaterial ZGM is prepared by dissolving GeO2 in 2 mol / L sodium hydroxide until it is clear, preparing a 1 mol / L Na2GeO3 solution, then adding a mixed solution containing Zn(NO3)2·6H2O and Mn(NO3)2, adding ammonia water to adjust the pH value to 9.3, and reacting at 220°C for 10 hours to obtain the target product.

[0012] Preferably, the method for methylating the green luminescent long afterglow nanomaterial ZGM is to add the green luminescent long afterglow nanomaterial ZGM to N,N-dimethylformamide, then add APTES, react at 80°C to obtain the amino-functionalized green luminescent long afterglow nanomaterial ZGM, referred to as ZGM-NH2, then disperse the ZGM-NH2 in acetonitrile, add K2CO3 and CH3I in sequence, vigorously stir for 12 hours under heating conditions at 80°C, and obtain the methylated green luminescent long afterglow nanomaterial ZGM by centrifugation at 12000rpm for 10 minutes.

[0013] 2. The application of the allosteric probe-catalyzed CRISPR-Cas12a and dual-color ratio long afterglow nanomaterial sensor as a reagent for detecting pathogens.

[0014] Preferably, the pathogen is MRSA.

[0015] Preferably, the detection principle of the present invention is as follows: in the absence of a test object, the allosteric probe remains inactive; when the aptamer domain of the allosteric probe recognizes and binds to the test object, the hairpin structure is unstable, exposing the primer binding site domain; with the assistance of DNA polymerase and primer sequences, the allosteric probe becomes a template for producing double-stranded DNA, on the one hand releasing the test object for the next catalytic cycle to achieve signal amplification; on the other hand, the Cas12a-crRNA complex binds to the double-stranded DNA, initiating the trans-cutting activity of Cas12a, restoring the red fluorescence signal of the red luminescent long afterglow material ZGC, and electrostatically binding to the methylated green luminescent long afterglow nanomaterial ZGM, and obtaining the concentration of the test object by monitoring the fluorescence signal.

[0016] The beneficial effects of the present invention are as follows: the present invention discloses a CRISPR-Cas12a and a dual-color ratio long afterglow nanomaterial sensor based on an allosteric probe catalysis, by designing a unique allosteric probe (AP), including an aptamer domain (blue) recognized by MRSA, a primer binding site domain (green) and a stem sequence domain (red). In the absence of MRSA, AP remains inactive and adopts a hairpin structure that hides the primer binding site domain, thereby hindering downstream reactions. However, when the aptamer domain of AP recognizes and binds to MRSA, the hairpin structure is unstable, resulting in the exposure of the primer binding site domain. Subsequently, with the assistance of DNA polymerase, AP becomes a template for producing double-stranded DNA (dsDNA) and releases MRSA for the next catalytic cycle to achieve signal amplification. Finally, the Cas12a-crRNA complex binds to the proximal dsDNA, initiates the trans-cleavage activity of Cas12a, and after cutting, the BHQ3-modified allosteric probe that forms a surface connection with the red luminescent ZGC is opened, and BHQ3 leaves to release red fluorescence as a detection signal, which reacts with the positively charged ZGM-N + The ratiometric luminescent sensor ZGC@BHQ3-ZGM was prepared through (CH3)3 electrostatic interaction, which can achieve ultra-sensitive and highly specific detection of pathogenic microorganisms such as MRSA, and is not affected by autofluorescence and external interference.

[0017] This method is simple and economical, and can be expanded to primary care units or remote areas with limited resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:

[0019] Figure 1 The allosteric probe-activated catalytic CRISPR-Cas12a side chain cleavage and dual-color ratiometric luminescent sensor ZGC@BHQ3-ZGM tandem (APC-Cas-PLNPs) system was used for MRSA detection (a: schematic diagram of the allosteric probe-activated catalytic CRISPR-Cas12a side chain cleavage process b: schematic diagram of the dual-color ratiometric luminescent sensor ZGC@BHQ3-ZGM for MRSA detection).

[0020] Figure 2 Performance analysis of allosteric probes (a: inverted fluorescence microscope image; b: polyacrylamide gel electrophoresis result; c: fluorescence result of trans-cleavage activity of CRISPR-Cas12a; d: fluorescence intensity of 6 different stem lengths).

[0021] Figure 3The preparation process and characterization of the two-color ratiometric luminescence sensor ZGC@BHQ3-ZGM (a: Schematic diagram of the developed two-color ratiometric luminescence sensor ZGC@BHQ3-ZGM b: TEM, HR-TEM and elemental mapping of ZGM and size distribution c: TEM, HR-TEM and elemental mapping of ZGC and size distribution d: TEM, HR-TEM and elemental mapping of ZGC@BHQ3-ZGM, the white box is the TEM and elemental mapping of ZGC e: ZGM, ZGM-NH2 and ZGC-N + (f) Hydration particle size of ZGC, ZGC-NH2, ZGC@BHQ3 and ZGC@BHQ3-ZGM. (g) Hydration particle size of ZGM, ZGM-NH2 and ZGC-NH3 + Zeta potential of (CH3)3 h: Zeta potential of ZGC, ZGC-NH2, ZGC@BHQ3 and ZGC@BHQ3-ZGM. )

[0022] Figure 4 To analyze the performance of the sensor and optimize the detection conditions of the APC-Cas-PLNPs system.

[0023] Figure 5 The sensitivity and specificity of the APC-Cas-PLNPs system in detecting MRSA (a: The fluorescence intensity of APC-Cas-PLNPs in detecting MRSA (the amount of MRSA was 1-10 6 CFU); Illustration: Linear analysis of APC-Cas-PLNPs for detecting MRSA b: Ct value of real-time fluorescence quantitative PCR for detecting MRSA (the number of MRSA ranged from 6×10 2 -6×10 7 CFU); Illustration: Linear analysis of MRSA detection by real-time fluorescence quantitative PCR cd: Specificity of APC-Cas-PLNPs in detecting MRSA (MRSA: 10 2 CFU / mL, other pathogens: 10 3 CFU / mL)ef: specificity of APC-Cas-PLNPs in detecting MRSA in complex samples (the amount of MRSA is one-tenth of that of other pathogens).

[0024] Figure 6 For the determination of MRSA in food samples and mouse serum. DETAILED DESCRIPTION

[0025] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0026] The detection principle of the present invention is as follows: Figure 1 In the initial stage, a unique allosteric probe (AP) was used. The probe is a single-stranded DNA fragment with three domains with different functions, including the aptamer domain for MRSA recognition, the primer binding site domain, and the stem sequence domain. The aptamer sequence length for specific recognition of MRSA is 75 nt, and the dissociation constant is Kd = 1.6 ± 0.5 × 10 2 nmol / L. In the absence of MRSA, AP remains inactive and adopts a hairpin structure that hides the primer binding site domain, thereby hindering downstream reactions. However, when the adapter domain of AP recognizes and binds MRSA, the hairpin structure is unstable, resulting in the exposure of the primer binding site domain. Subsequently, with the assistance of DNA polymerase, AP becomes a template for producing double-stranded DNA (dsDNA) and releases MRSA for the next catalytic cycle to achieve signal amplification. Finally, the Cas12a-crRNA complex binds to the proximal dsDNA and initiates the trans-cutting activity of Cas12a.

[0027] Then, a dual-color ratiometric luminescence sensor based on long-lasting luminescence nanomaterials (PLNPs) was fabricated. Figure 1 As shown in Figure b, cDNA-BHQ3 (BHQ3 modified chain) forms a surface connection with the red luminescent long afterglow nanomaterial ZGC, referred to as ZGC-PLNPs, to obtain ZGC@BHQ3 as a detection signal. At the same time, the green luminescent long afterglow nanomaterial ZGM, referred to as ZGM-PLNPs, is methylated to prepare the positively charged ZGM- + (CH3)3 is used as the reference signal. + The ratiometric luminescent sensor ZGC@BHQ3-ZGM was prepared by the electrostatic interaction of (CH3)3 and negatively charged ZGC@BHQ3. The present invention connects AP, CRISPR-Cas12a and the dual-color ratiometric luminescent sensor ZGC@BHQ3-ZGM in series for MRSA detection, which is called the "APC-Cas-PLNPs" system. When MRSA is recognized by AP, Cas12a is activated, acquires the ability to randomly cut single strands, restores the red fluorescence signal of ZGC, and the green fluorescence of ZGM remains unchanged. The entire detection process takes about 55 minutes. Therefore, the APC-Cas-PLNPs detection system proposed in the present invention can achieve ultra-sensitive and highly specific detection of MRSA, and is not affected by autofluorescence and external interference.

[0028] Example 1

[0029] (1) Strain culture and quantification

[0030] Inoculate the MRSA colonies stored on the plate into LB liquid culture medium and grow to the logarithmic growth phase at 220rpm and 37℃. Take an appropriate amount of bacterial solution, centrifuge at 8000rpm for 5 minutes, and remove the supernatant. Wash the collected bacterial precipitate several times with 10mM PBS buffer to remove the remaining culture medium. Resuspend the bacterial precipitate in PBS buffer and store at 4℃. In order to calculate the exact number of bacteria in the culture, dilute the bacterial suspension with PBS buffer gradient continuously. Take 100μL of the diluted bacterial solution and spread it on the LB agar plate and incubate it at 37℃ for 24h, and determine the number of colonies on the plate.

[0031] (2) Design and synthesis of allosteric probes

[0032] The probe consists of a single-stranded DNA molecule with three different functional domains: an aptamer domain for MRSA recognition, a primer binding site domain and a stem sequence domain. All oligonucleotides used in the present invention, including allosteric probes, primers and crRNA, are synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The specific sequences are as follows: Allosteric probe: 5'-ATCCAGACGTGACGCAGCATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTGT GGACACGGTGGCTTAGTACACACACACACATGTACTAAGCCACC-3' (SEQ ID NO.1);

[0033] Primer: 5′-TTAGTACA-3′;

[0034] crRNA: 5′-UAAUUUCUACUAAGUGUAGAUUGUGUGGACACGGUGGCUUAG-3′

[0035] (SEQ ID NO.2).

[0036] To confirm the specific binding of AP to MRSA and its subsequent transition to the active structure, the present invention synthesized a covalently modified AP in which the fluorescent group FAM was covalently attached to the 3' end of the primer binding site domain, and the quencher group BHQ1 was covalently and internally attached to the 5' end of the aptamer domain. Inverted fluorescence microscopy images confirmed that AP had bound to MRSA and switched to the active structure ( Figure 2, a). Therefore, it is believed that the constructed AP has strong specificity for MRSA. In order to further verify that the combination of AP and MRSA triggers dsDNA amplification, the present invention performed polyacrylamide gel electrophoresis (PAGE) analysis. The results showed that whether it was mixed with primer (5′-TTAGTACA-3′) alone (Line 2) or mixed with primer and DNA polymerase at the same time, AP still maintained its original structure (Line 3). However, in the presence of MRSA, the AP structure unfolded, and after co-incubation with primer and DNA polymerase, an extension reaction was triggered, resulting in the production of a large amount of dsDNA (Line 4) ( Figure 2 , b). In addition, the trans-cleavage activity of CRISPR-Cas12a has also been confirmed. Figure 2 , c shows that when target dsDNA is present, Cas12a exhibits strong activity under the guidance of crRNA.

[0037] To demonstrate the stability of AP in the absence of MRSA, the effect of stem length on the AP structure was studied. The present invention monitored the fluorescence intensity changes of APs with 6 different stem lengths (9, 10, 12, 14, 15 and 16 bp) ( Figure 2 , d). Regardless of the presence or absence of MRSA, as the stem length increases, the fluorescence intensity decreases. However, as the stem length increases from 9bp to 14bp, the background signal decreases significantly, and the signal decreases slightly, resulting in an increase in the signal-to-noise ratio (S / BG) ​​(blue line), which decreases significantly from 14bp to 16bp. Therefore, it can be inferred that an excessively long stem length causes the AP to be too stable, hindering the unfolding of the AP structure and being detrimental to subsequent dsDNA amplification and Cas12a activation. The above data show that the AP with a stem length of 14bp has excellent stability and state switching dynamics and is selected as the AP in the APC-Cas-PLNPs system.

[0038] (3) Preparation of long afterglow nanomaterials

[0039] a. Synthesis of ZGM

[0040] Dissolve GeO2 (2.08 g) in 2 mol / L sodium hydroxide until clear to prepare a 1 mol / L Na2GeO3 solution. Dissolve Zn(NO3)2·6H2O (1.19 g) and Mn(NO3)2 (20 μL, 0.01 M) in 22 mL of ultrapure water and stir vigorously. Add Na2GeO3 (2 M, 2 mL) dropwise to the above solution and immediately add ammonia water (28%, wt). Adjust the pH value of the mixture to 9.3. After stirring at room temperature for 1 hour, transfer the mixture to a 20 mL Teflon-lined autoclave and react at 220°C for 10 hours to obtain the desired product.

[0041] b. Synthesis of ZGC

[0042] Dissolve 3.6 mL Zn(NO3)2·6H2O (1M), 3 mL Ga(NO3)3·xH2O (2M) and 24 μL Cr(NO3)3·9H2O (0.5M) in 15 mL ultrapure water. Quickly add about 3 mL of ammonia (28%, wt) to the mixture and adjust the pH to 9.0. After stirring for 30 min, transfer the suspension to a Teflon-lined autoclave (25 mL) and react at 220°C for 10 hours to obtain the desired product.

[0043] c. Functionalized ZGM-NH2, ZGM-N + Preparation of (CH3)3 and ZGC-NH2

[0044] ZGM was added to 10 mL of N,N-dimethylformamide (DMF) under ultrasonication, and 100 μL of APTES was added dropwise while stirring vigorously. The resulting mixture was heated to 80°C, reacted for 12 h, and centrifuged (12000 rpm, 10 min) to obtain the product ZGM-NH2. + (CH3)3, firstly, amino-functionalized ZGM (ZGM-NH2) was prepared by a similar method as described above. Then, 100 mg ZGM-NH2 was dispersed in 100 mL acetonitrile, 0.5 g K2CO3 and 0.5 mL CH3I were added successively, and the mixture was stirred vigorously at 80 °C for 12 h. ZGM-NH2 was obtained by centrifugation (12000 rpm, 10 min). + (CH3)3.

[0045] Preparation of ZGC-NH2: ZGC was added to 10 mL of N,N-dimethylformamide (DMF) under ultrasonication, and 100 μL of APTES was added dropwise while stirring vigorously. The resulting mixture was heated to 80°C, reacted for 12 h, and centrifuged (12000 rpm, 10 min) to obtain the product ZGC-NH2.

[0046] d. Preparation of ZGC@BHQ3-ZGM:

[0047] 3.0 mg ZGC-NH2 was ultrasonically dispersed in 3.0 mL HEPES buffer, and 1 mg Sulfo-SMCC was added and gently shaken at room temperature for 2 h. The solid product was collected by centrifugation (12000 rpm, 10 min), washed 3 times with PBS buffer, and then redispersed in 3.0 mL HEPES buffer. Next, 6 nmol cDNA-BHQ3

[0048] (3'-SH-TATATATCGATGCGCCATCG-BHQ3-3') was mixed with the above solution and incubated at 37 °C overnight to prepare ZGC@BHQ3. + (CH3)3 was mixed in equal volumes (1.0 mg / mL) and shaken overnight to obtain the dual-color ratiometric fluorescent sensor ZGC@BHQ3-ZGM (3, a).

[0049] The green luminescent long afterglow nanomaterial ZGM and the red luminescent material ZGC prepared above were methylated to prepare the positively charged ZGM-N + (CH3)3 was used as the reference probe, and BHQ3-modified ZGC@BHQ3 was used as the detection probe. The two were combined through electrostatic interaction to form the proportional induction sensor ZGC@BHQ3-ZGM.

[0050] The results show that the prepared ZGM nanorods have a standard Zn2GeO4 rhombic crystal structure with a size of 40-75nm. 2+ The prepared ZGC is granular with a diameter of 5-9 nm and a standard cubic spinel structure of ZnGa2O4 and a green luminescence at 696 nm caused by the twisted Cr 3+ The near-infrared emission is generated by the 2E→4A2 transition of ZGM-NH2 and ZGM-N + The changes in zeta potential and hydrated particle size of (CH3)3, ZGC@BHQ3, etc. indicate that the modification of ZGM and ZGC is successful (3, c). In addition, TEM images show that the prepared ZGC@BHQ3-ZGM has a distinct core-shell structure, characterized by a granular ZGC shell adsorbed on a rod-shaped ZGM core ( Figure 3 , d, white box). HAADF analysis results show that Zn, Ge, Mn, Ga, Cr, and O are present in ZGC@BHQ3-ZGM.

[0051] Example 2

[0052] In order to verify whether the prepared sensor has the advantages of no external interference and no autofluorescence, the effects of test voltage and ZGC@BHQ3-ZGM concentration on the fluorescence intensity and fluorescence intensity ratio (I 696 / I 533 ). With the increase of test voltage and ZGC@BHQ3-ZGM concentration, the luminescence intensity at 533nm and 696nm gradually increases, while I 696 / I 533 Basically stable ( Figure 4, a and b). In addition, the detection conditions of the APC-Cas-PLNPs system were optimized to improve the assay performance. First, the effect of the concentration of the allosteric probe (AP) that plays a catalytic role in the detection method on MRSA detection was studied. The results showed that as the AP concentration increased, △(I 696 / I 533 ) increases, when the AP concentration is 400nm, △(I 696 / I 533 )Highest( Figure 4 , c). The kinetic curve of Cas12a side cutting activity of APC-Cas-PLNPs for detecting MRSA under the condition of AP concentration of 400nm was then optimized. The results showed that the reaction reached a plateau at 15min. Therefore, AP of 400nm and reaction time of 15min were selected as the optimal conditions for MRSA detection ( Figure 4 , d).

[0053] Example 3

[0054] (1) APC-Cas-PLNPs and qPCR for MRSA detection and specificity analysis:

[0055] The ability of APC-Cas-PLNPs to detect MRSA was investigated using the conditions optimized in Example 3. As the concentration of MRSA increased, the luminescence intensity at 696 nm gradually increased, while the luminescence intensity at 533 nm remained stable. 696 / I 533 ) changes with MRSA concentration in the range of 1-10 5 There is a good linear relationship in the CFU / mL range. 2 is 0.9957( Figure 5 , a). The present invention also compared the APC-Cas-PLNPs detection system with real-time PCR for MRSA detection. The results showed that when the number of MRSA was less than 600 CFU / mL, C t The value was greater than 30. Even after 40 cycles, no fluorescence peak was observed for 60 CFU ( Figure 5 , b). The results show that the APC-Cas-PLNPs detection system presented in the present invention has better sensitivity than real-time PCR.

[0056] Next, to demonstrate the specificity of the detection system, the present invention used AP-Cas-PLNPs to detect MRSA of different genera, including Klebsiella pneumoniae, Pseudomonas aeruginosa, Escherichia coli, Listeria monocytogenes, and Staphylococcus aureus (ATCC29213) and Staphylococcus aureus (ATCC25923). The results showed that at 1×10 2 At a concentration of 1.5 CFU, almost no fluorescence response was observed for strains other than MRSA. To further study the specificity of AP-Cas-PLNPs in complex samples, the present invention tested them in a mixture of MRSA and other bacteria at a molar ratio of 1:10. As expected, there was no significant difference in the fluorescence signal between samples containing only MRSA and other complex bacterial samples containing MRSA ( Figure 5 , c~f).

[0057] (2) Application of APC-Cas-PLNP in MRSA detection in milk, orange juice and serum

[0058] In order to verify the feasibility of the invented detection method in food sample detection, the present invention used APC-Cas-PLNPs to conduct a double-blind experimental verification of MRSA levels in 20 pasteurized milk samples (n=20) and contaminated milk samples (n=20), as well as 20 pasteurized orange juice samples (n=20) and contaminated orange juice samples (n=20). Compared with the pasteurized milk or orange juice samples, all 20 contaminated milk or orange juice samples showed higher Δ(I 696 / I 533 ), which indicates that APC-Cas-PLNPs can effectively distinguish contaminated food samples from pasteurized food samples (P<0.001)( Figure 6 , a, d,). However, C t The values ​​showed that although there was a significant difference in the expression of MRSA genomic DNA between pasteurized milk or orange juice samples and contaminated milk or orange juice samples (P<0.01), there was a certain proportion of signal overlap between the two columns of data ( Figure 6 , b and e). The ROC curve of APC-Cas-PLNPs showed that the AUC values ​​of contaminated milk and orange juice samples were both 1.0 compared with pasteurized milk samples. In contrast, real-time PCR had poor classification ability for pasteurized food samples and contaminated food samples (AUC values ​​were 0.85 and 0.77, respectively) (Fig.6c and f).

[0059] Finally, the present invention infected 6 8-week-old mice by intravenous injection of MRSA bacterial solution, and used uninfected mice of the same age and number as controls. After collecting blood samples, APC-Cas-PLNPs were used to detect MRSA in mouse serum ( Figure 6 , g). The △(I 696 / I 533 ) value, and then tested every 12 hours until the 4th day to prove the presence of MRSA in mice ( Figure 6 , h). The results showed that the △(I 696 / I 533 ) values ​​increased over time, while the △(I 696 / I 533 ) value did not change significantly, indicating that MRSA has already colonized and grown in the blood. The ROC curve of APC-Cas-PLNPs showed that the AUC of uninfected mice was 0.98 compared with infected mice, indicating that it has the potential to detect early MRSA infection ( Figure 6 , i). The above results fully demonstrate that the developed APC-Cas-PLNPs system can accurately detect MRSA in food testing and clinical testing.

[0060] All experiments in the present invention were repeated three times in parallel, and the data are presented as mean ± standard deviation. Two samples were compared using GraphPadPrism (version 8.0.2) and Student's t test was used. P < 0.05 (*), P < 0.01 (**) or P < 0.001 (***) was considered significant.

[0061] The above-described embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. Based on allosteric probe catalysis CRISPR-Cas12a and dual-color ratio long afterglow nanomaterial sensor, characterized by: The sensor includes a red luminescent long afterglow material ZnGa2O4:Cr combined with a BHQ3-modified allosteric probe, a methylated green luminescent long afterglow nanomaterial Zn2GeO4:Mn, a primer sequence and a Cas12a enzyme; The allosteric probe consists of an aptamer domain that specifically recognizes the sequence to be detected, a primer binding site domain and a stem-loop sequence domain; the primer binding site domain is complementary to the primer sequence.

2. According to claim 1, the allosteric probe catalyzed CRISPR-Cas12a and dual-color ratio long afterglow nanomaterial sensor is characterized in that: The stem-loop sequence domain of the allosteric probe is 12 to 14 nucleotides.

3. According to claim 1, the allosteric probe catalyzed CRISPR-Cas12a and dual-color ratio long afterglow nanomaterial sensor is characterized in that: The sequence of the allosteric probe is shown as SEQ ID NO. 1, and the sequence of the primer is shown as 5'-TTAGTACA-3'.

4. According to claim 1, the allosteric probe catalyzed CRISPR-Cas12a and dual-color ratio long afterglow nanomaterial sensor is characterized in that: The red light-emitting long afterglow material ZnGa2O4:Cr is prepared by dissolving 1M Zn(NO3)2·6H2O, 2M Ga(NO3)3·xH2O and 0.5M Cr(NO3)3·9H2O in water, adding 28% ammonia water by mass, adjusting the pH to 9.0, and reacting at 220°C for 10 hours to obtain the target product.

5. According to claim 1, the allosteric probe catalyzed CRISPR-Cas12a and dual-color ratio long afterglow nanomaterial sensor is characterized in that: The green luminescent long afterglow nano material Zn2GeO4:Mn is prepared by dissolving GeO2 in 2mol / L sodium hydroxide until it is clear, preparing a 1mol / L Na2GeO3 solution, then adding a mixed solution containing Zn(NO3)2·6H2O and Mn(NO3)2, adding ammonia water to adjust the pH value to 9.3, and reacting at 220°C for 10 hours to obtain the target product.

6. According to claim 1, the allosteric probe catalyzed CRISPR-Cas12a and dual-color ratio long afterglow nanomaterial sensor is characterized in that: The method for methylating the green luminescent long afterglow nanomaterial Zn2GeO4:Mn is as follows: the green luminescent long afterglow nanomaterial Zn2GeO4:Mn is added to N,N-dimethylformamide, and then APTES is added, and the reaction is performed at 80° C. to obtain the amino-functionalized green luminescent long afterglow nanomaterial Zn2GeO4:Mn, referred to as ZGM-NH2, and then the ZGM-NH2 is dispersed in acetonitrile, and K2CO3 and CH3I are added in sequence, and the mixture is vigorously stirred at 80° C. for 12 hours, and the methylated green luminescent long afterglow nanomaterial Zn2GeO4:Mn is obtained by centrifugation at 12000 rpm for 10 minutes.

7. Use of the allosteric probe-catalyzed CRISPR-Cas12a and dual-color ratio long afterglow nanomaterial sensor as a reagent for detecting pathogens according to any one of claims 1 to 6.

8. The use according to claim 7, characterized in that: The pathogen is MRSA.

9. The use according to claim 7, characterized in that: The principle of the detection is as follows: in the absence of a test object, the allosteric probe remains inactive; when the aptamer domain of the allosteric probe recognizes and binds to the test object, the hairpin structure is unstable, exposing the primer binding site domain; with the assistance of DNA polymerase and primer sequences, the allosteric probe becomes a template for producing double-stranded DNA, on the one hand releasing the test object for the next catalytic cycle to achieve signal amplification; on the other hand, the Cas12a-crRNA complex binds to the double-stranded DNA, initiating the trans-cutting activity of Cas12a, restoring the red fluorescence signal of the red luminescent long afterglow material ZnGa2O4:Cr, and electrostatically binding with the methylated green luminescent long afterglow nanomaterial Zn2GeO4:Mn, and the concentration of the test object is obtained by monitoring the fluorescence signal.

Images