Application of composition containing cordyceps militaris extract in preparation of product for preventing and improving Parkinson's disease

Abstract

The invention discloses application of a composition containing a cordyceps militaris extract in preparation of a product for improving and preventing Parkinson's disease. The composition comprises the cordyceps militaris extract, a white peony root extract, a prepared rehmannia root extract and a gastrodia elata extract. The composition provided by the invention aims to tonify kidney and marrow and nourish yin and blood, effectively prevents and improves Parkinson's disease, and has no obvious influence on body weight.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to application of a composition containing a Cordyceps militaris extract in preparing a product for preventing and improving Parkinson's disease. Background Art

[0002] This section merely provides background information related to the present disclosure and is not necessarily prior art.

[0003] The most commonly used Western medicine for preventing and improving Parkinson's disease is levodopa preparations, but studies have shown that long-term use of the drug can cause complications and reduced efficacy. Once you receive drug treatment, you will likely become dependent on the drug for the rest of your life.

[0004] The draft of the trial version of the “Standards for Diagnosis and Therapeutic Effect Evaluation of Geriatric Tremor in Traditional Chinese Medicine” unifies Parkinson’s and Parkinson’s syndrome into “Geriatric Tremor” and divides it into five syndrome types: phlegm-heat causing wind, blood stasis causing wind, deficiency of both Qi and blood, deficiency of liver and kidney, and deficiency of both Yin and Yang. Parkinson’s is closely related to the liver and kidney. It is often caused by deficiency of liver and kidney leading to the loss of nourishment to tendons and veins or internal movement of liver wind. The “Suwen·Zhenzhenyaodalun” states that “all wind-induced dizziness and vertigo belong to the liver.” The “Suwen·Maiyaojingweilun” mentions: “Bones are the home of marrow. If you cannot stand for a long time and shake when walking, your bones will become exhausted. The kidney stores essence, and the liver stores blood. The kidney is the mother organ of the liver. Essence and blood have the same origin. The source of liver blood is in the kidney. If liver blood is insufficient, the kidney water should be nourished and the kidney yin should be replenished to nourish the liver yin. This can promote and regulate the distribution of blood and essence in the human body. Only when the blood is adequate can the qi and blood flow properly. If the kidney qi is often infused into the limbs and meridians, the tendons and veins can be nourished. If the kidney qi is strong, the brain can be nourished and the tendons and bones are strong. If the kidney essence is deficient and cannot store the will, the brain will be empty. For example, Chinese invention application CN106266354A discloses a composition for improving and preventing Parkinson's disease, which is prepared by crushing and decocting Radix Glehniae, Radix Scrophulariae, Raw Ochre, Herba Artemisiae Scopariae, Rhizoma Arisaematis, Semen Persicae, Fructus Pini Maris, Fructus Quisqualis, Cortex Moutan, Flos Lonicerae, Herba Coptidis, Thistle, and Radix Stephaniae Tetrandrae, but it has the functions of cooling blood and nourishing yin, purging fire and detoxifying, but ignores the importance of nourishing yin and blood, and tonifying the kidney and strengthening the foundation.

[0005] In recent years, the use of Chinese medicine and other plant extracts to improve and prevent Parkinson's disease has achieved remarkable results. Based on the extracts of Chinese herbal medicines in traditional Chinese medicine prescriptions, such as white peony root, Rehmannia glutinosa, Gastrodia elata, etc., used alone or in combination, they can nourish the liver and kidneys, replenish the essence, nourish the blood and yin, calm the liver wind, and effectively treat and improve Parkinson's disease. Clinical studies have also found that Chinese herbal preparations for improving and preventing Parkinson's disease composed of white peony root, Rehmannia glutinosa, Gastrodia elata, etc. can significantly relieve the symptoms of Parkinson's patients.

[0006] The pathogenesis of Parkinson's disease is complex. At present, the research on its pathogenesis is very extensive but still in the exploratory stage. Modern medical scientists generally believe that the main pathogenic mechanisms are the misfolding and aggregation of α-synuclein, oxidative stress, neuroinflammation, mitochondrial disorders, UPS dysfunction, LRRK2 gene mutation, excitotoxic neurotoxicity, and gut-brain connection. The main pathological changes are the loss of dopaminergic neurons and synuclein deposition in the substantia nigra. Western medicine can treat Parkinson's disease by means of drug therapy, surgical treatment, adaptive motor rehabilitation, botulinum toxin treatment, psychological adjustment, care and nursing, etc., and drug therapy is the main method in clinical practice. However, whether it is drugs or surgery, they can only control symptoms, cannot prevent nerve degeneration, and cannot cure it. Western medicine treatment has the advantage of quick results in a short period of time, but it also has the disadvantage of damaging gastrointestinal, liver, and kidney functions, and its toxic side effects and drug resistance cannot be ignored. In contrast, traditional medicine, as a unique cultural heritage with a long history of development in my country, is easily adopted and accepted by the Chinese people, and has significant advantages such as simple operation, low cost, low toxic side effects, low recurrence rate, and flexible prescription and medication. Summary of the invention

[0007] Purpose of the invention: The technical problem to be solved by the present invention is to provide a composition containing Cordyceps militaris extract and its application in the preparation of products for preventing and improving Parkinson's disease in view of the deficiencies in the prior art.

[0008] In order to solve the above technical problems, the present invention discloses the following technical solutions:

[0009] In a first aspect, the present invention discloses a composition for preventing and / or improving Parkinson's disease, which effectively prevents and improves Parkinson's disease by tonifying the kidney and marrow, nourishing yin and blood.

[0010] The composition comprises Cordyceps militaris extract, White Peony Root extract, Rehmannia glutinosa extract and Gastrodia elata extract.

[0011] In some embodiments, the weight proportions of the Cordyceps militaris extract, white peony extract, Rehmannia glutinosa extract and Gastrodia elata extract are 12-26 parts, 44-66 parts, 60-88 parts, 28-44 parts, preferably 14-24 parts, 46-64 parts, 62-86 parts, 30-42 parts, preferably 16-22 parts, 48-62 parts, 64-84 parts, 32-40 parts.

[0012] In some embodiments, the weight proportions of the Cordyceps militaris extract, white peony extract, Rehmannia glutinosa extract and Gastrodia elata extract are 12-20 parts, 44-52 parts, 60-68 parts, 28-36 parts, preferably 14-18 parts, 46-50 parts, 62-66 parts, 30-34 parts, preferably 16 parts, 48 ​​parts, 64 parts, 32 parts.

[0013] In some embodiments, the weight proportions of the Cordyceps militaris extract, white peony extract, Rehmannia glutinosa extract and Gastrodia elata extract are 18-26 parts, 58-66 parts, 80-88 parts, 36-44 parts, preferably 20-24 parts, 60-64 parts, 82-86 parts, 38-42 parts, preferably 22 parts, 62 parts, 84 parts, 40 parts.

[0014] Furthermore, in addition to Cordyceps militaris extract, White Peony Root Extract, Rehmannia Glutinosa Extract and Gastrodia elata Extract, the composition for preventing and / or improving Parkinson's disease in the present invention also includes any one or a combination of the following components: Uncaria rhynchophylla extract, Astragalus membranaceus extract and Salvia miltiorrhiza extract.

[0015] In some embodiments, the weight proportions of the Cordyceps militaris extract and the Uncaria rhynchophylla extract are 12-26 parts and 28-44 parts, preferably 14-24 parts and 30-42 parts, preferably 16-22 parts and 32-40 parts, respectively.

[0016] In some embodiments, the weight proportions of the Cordyceps militaris extract and the Astragalus membranaceus extract are 12-26 parts and 44-66 parts, respectively, preferably 14-24 parts and 46-64 parts, preferably 16-22 parts and 48-62 parts.

[0017] In some embodiments, the weight proportions of the Cordyceps militaris extract and the Salvia miltiorrhiza extract are 12-26 parts and 28-44 parts, preferably 14-24 parts and 30-42 parts, and preferably 16-22 parts and 32-40 parts, respectively.

[0018] In some embodiments, the weight proportions of the Cordyceps militaris extract, Uncaria rhynchophylla extract, Astragalus membranaceus extract and Salvia miltiorrhiza extract are 12-26 parts, 28-44 parts, 44-66 parts, 28-44 parts, preferably 14-24 parts, 30-42 parts, 46-64 parts, 30-42 parts, preferably 16-22 parts, 32-40 parts, 48-62 parts, 32-40 parts.

[0019] In a second aspect, the present invention discloses a pharmaceutical composition for preventing and / or improving Parkinson's disease, the composition comprising (i) the composition or Cordyceps militaris extract described in the first aspect, and (ii) a pharmaceutically acceptable excipient.

[0020] The pharmaceutically acceptable excipients are conventional excipients in the art, such as fillers, lubricants, adhesives, etc.

[0021] In a third aspect, the present invention discloses the use of the composition described in the first aspect and the pharmaceutical composition described in the second aspect in the preparation of drugs for preventing and / or improving Parkinson's disease.

[0022] The Cordyceps militaris extract described in the present invention is a Cordyceps militaris water extract. In some embodiments, the mass ratio of cordycepin to cordyceps polysaccharide in the Cordyceps militaris extract is 3:2.1-8, preferably 3:3-6, preferably 3:4. In some embodiments, the Cordyceps militaris water extract, in addition to cordycepin and cordyceps polysaccharide, also includes cordycepic acid, cordyceps adenosine, cordyceps polypeptide, amino acid, or any combination of the foregoing. In some embodiments, the mass ratio of cordycepin to cordycepic acid in the Cordyceps militaris water extract is 2.3-3.1:0.5-1.5, preferably 2.5-2.9:0.8-1.2, preferably 2.7:1; in some embodiments, the mass ratio of cordycepin to cordyceps adenosine in the Cordyceps militaris water extract is 23-31:2-6, preferably 25-29:3-5, preferably 27:4; in some embodiments, the mass ratio of cordycepin to cordyceps polypeptide in the Cordyceps militaris water extract is 23-31:2-8, preferably 25-29:3-7, preferably 27:5; in some embodiments, the mass ratio of cordycepin to amino acids in the Cordyceps militaris water extract is 25-29:14-22, preferably 25-29:16-20, preferably 27:18.

[0023] In the present invention, the white peony root extract, Rehmannia root extract, Gastrodia elata extract, Uncaria rhynchophylla extract, Astragalus membranaceus extract and Salvia miltiorrhiza extract are aqueous extracts obtained by extracting white peony root, Rehmannia root, Gastrodia elata, Uncaria rhynchophylla, Astragalus membranaceus and Salvia miltiorrhiza by conventional methods, and can be directly purchased or prepared according to the existing technology, as follows:

[0024] The Cordyceps militaris extract described in the present invention is a water extract of Cordyceps militaris, such as the one obtained by extracting Cordyceps militaris fruiting bodies in water; the extraction temperature is 70-100° C., such as 80° C., boiling water; the extraction time is 1-5h, such as 3h, 4h; the mass volume ratio of Cordyceps militaris fruiting bodies to water is 1g:5-15mL, such as 1g:10mL.

[0025] The white peony root extract of the present invention is prepared by extracting the white peony root in water; the extraction temperature is 70-100° C., such as 80° C., the extraction time is 1-5 h, such as 3 h, 4 h, and the solid-liquid ratio is 1 g:5-15 mL, such as 1 g:10 mL.

[0026] The Rehmannia glutinosa extract of the present invention is prepared by extracting Rehmannia glutinosa in water; the extraction temperature is 70-100° C., such as 80° C., the extraction time is 1-5 h, such as 3 h, 4 h, and the solid-liquid ratio is 1 g:5-15 mL, such as 1 g:10 mL.

[0027] The preparation of the Gastrodia elata extract of the present invention comprises extracting Gastrodia elata powder in water; the extraction temperature is 70-100° C., such as 80° C., the extraction time is 1-5 h, such as 3 h, 4 h, and the solid-liquid ratio is 1 g:5-15 mL, such as 1 g:10 mL.

[0028] The preparation of the Uncaria rhynchophylla extract of the present invention comprises extracting the Uncaria rhynchophylla slices in water; the extraction temperature is 70-100° C., such as 80° C., the extraction time is 1-5 h, such as 3 h, 4 h, and the solid-liquid ratio is 1 g:5-15 mL, such as 1 g:10 mL.

[0029] The astragalus extract of the present invention is prepared by extracting the astragalus slices in water; the extraction temperature is 70-100° C., such as 80° C., the extraction time is 1-5 h, such as 3 h, 4 h, and the solid-liquid ratio is 1 g:5-15 mL, such as 1 g:10 mL.

[0030] The preparation of the salvia miltiorrhiza extract of the present invention comprises extracting salvia miltiorrhiza in water; the extraction temperature is 70-100° C., such as 80° C., the extraction time is 1-5 h, such as 3 h, 4 h, and the solid-liquid ratio is 1 g:5-15 mL, such as 1 g:10 mL.

[0031] After the above extracts are extracted with water, the obtained extract solution is filtered, concentrated and dried to obtain extract powder.

[0032] The improvement mentioned in the present invention includes treatment.

[0033] The present invention has no special requirements for the preparation method of each dosage form of the drug, and conventional methods in the field are all acceptable. It can be prepared according to conventional production methods in the pharmaceutical field, such as mixing the active ingredient with one or more carriers and then making it into the desired dosage form.

[0034] The term "prevent or improve" in the present invention means that the Cordyceps militaris extract or the composition containing the Cordyceps militaris extract described in the present application is administered to prevent or improve one or more symptoms associated with Parkinson's disease.

[0035] The term "pharmaceutically acceptable" in the present invention refers to those compounds, materials, compositions and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0036] Beneficial effects:

[0037] The present invention provides a composition for improving and preventing Parkinson's disease, comprising Cordyceps militaris extract, White Peony Root Extract, Rehmannia Glutinosa Extract and Gastrodia elata Extract. The composition aims to tonify the kidney and marrow, nourish yin and blood, effectively prevent and improve Parkinson's disease, and has no significant effect on body weight. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more clear.

[0039] Figure 1 is the comparison of behavioral test results (rotation test); compared with the sham operation group, P ### <0.001; compared with the model group, P *** <0.01; P ** <0.05.

[0040] Figure 2 is the comparison of behavioral test results (open field test); compared with the sham operation group, P ### <0.001; compared with the model group, P *** <0.01; P ** <0.05.

[0041] Figure 3 HE staining was used to observe the damage of striatal neurons.

[0042] Figure 4 is the ROS content in rat brain tissue; compared with the sham operation group, P ### <0.001; compared with the model group, P *** <0.01; P ** <0.05.

[0043] Figure 5 is the MDA content in rat brain tissue; compared with the sham operation group, P ### <0.001; compared with the model group, P *** <0.01; P ** <0.05.

[0044] Figure 6 is the GSH content in rat brain tissue; compared with the sham operation group, P ### <0.001; compared with the model group, P *** <0.01; P ** <0.05.

[0045] Figure 7 is the SOD content in rat brain tissue; compared with the sham operation group, P ### <0.001; compared with the model group, P *** <0.01; P ** <0.05.

[0046] Figure 8 is the relative expression of TH; compared with the sham operation group, P ### <0.001; compared with the model group, P *** <0.01; P ** <0.05.

[0047] Fig. 9is the relative expression of DAT; compared with the sham operation group, P ### <0.001; compared with the model group, P *** <0.01; P ** <0.05. DETAILED DESCRIPTION

[0048] The present invention can be better understood according to the following examples. However, it is easy for those skilled in the art to understand that the contents described in the examples are only used to illustrate the present invention, and should not and will not limit the present invention described in detail in the claims.

[0049] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0050] The Cordyceps militaris extract described in the following examples, unless otherwise specified, comprises the following components in percentage by mass: 27% cordycepin, 10% cordycepic acid, 4% cordyceps adenosine, 36% cordyceps polysaccharide, 5% cordyceps polypeptide, and 18% amino acids.

[0051] The preparation methods of the white peony root extract, Rehmannia root extract, Gastrodia elata extract, American ginseng extract, Uncaria rhynchophylla extract, Astragalus root extract and Salvia miltiorrhiza extract described in the following examples are as follows:

[0052] Preparation of white peony root extract: Place white peony root in a vacuum drying oven at 50°C for 1 day, crush, pass through a 60-mesh sieve, add distilled water at a solid-liquid ratio of 1:10 (g / mL), extract under boiling water bath reflux for 3 times, each time for 1 hour, filter, combine the filtrate, concentrate the filtrate by rotary evaporation, and freeze-dry the concentrate.

[0053] Preparation of Radix Rehmanniae Preparata Extract: Take Radix Rehmanniae Preparata, dry and crush, pass through a 60-mesh sieve, add distilled water at a solid-liquid ratio of 1:10 (g / mL), extract under boiling water bath heat reflux for 3 times, each time for 1 hour, filter, combine the filtrate, concentrate the filtrate by rotary evaporation, and freeze-dry the concentrate.

[0054] Preparation of Gastrodia elata extract: dry Gastrodia elata powder, add distilled water at a solid-liquid ratio of 1:10 g / mL, heat reflux extraction for 1 hour, repeat the extraction 3 times, combine the filtrate, concentrate by rotary evaporation, and freeze-dry for 24 hours to obtain Gastrodia elata water extract dry powder.

[0055] Preparation of American ginseng extract: distilled water was added at a solid-liquid ratio of 1:10 g / mL, and the extraction was performed under hot reflux for 1 hour. The extraction was repeated 3 times, the filtrates were combined, the supernatant was taken and concentrated to an extract, and then freeze-dried.

[0056] Preparation of Uncaria rhynchophylla extract: The Uncaria rhynchophylla slices were placed in an oven, dried at 50°C for 1 day, crushed, passed through a 60-mesh sieve, added with distilled water at a solid-liquid ratio of 1:10 g / mL, and extracted under hot reflux for 1 hour. The extraction was repeated 3 times, the filtrates were combined, concentrated in a water bath at 50°C, and dried into powder in a constant temperature drying oven.

[0057] Preparation of Astragalus extract: The Astragalus slices were placed in an oven, dried at 50°C for 1 day, crushed, passed through a 60-mesh sieve, added with distilled water at a solid-liquid ratio of 1:10 g / mL, and extracted under hot reflux for 1 hour. The extraction was repeated 3 times, the filtrates were combined, concentrated in a water bath at 50°C, and dried into powder in a constant temperature drying oven.

[0058] Preparation of Danshen extract: Take Danshen medicinal materials and place them in an oven, dry them at 50℃ for 1 day, crush them, and pass them through a 60-mesh sieve to obtain Danshen dry powder. Add distilled water at a solid-liquid ratio of 1:10 (g / mL), place them in a boiling water bath and heat reflux for extraction 3 times, each time for 1 hour, filter them, and combine the filtrate. The filtrate is concentrated by rotary evaporation, and the concentrate is freeze-dried and crushed.

[0059] The specific method for preparing the composition by extraction in the following examples is as follows: Example 1-5 and Comparative Example 1-3 are to prepare the extracts according to the above method, and then weigh the powders according to their respective mass ratios.

[0060] Example 1

[0061] A composition consists of the following components in parts by weight: 160 parts of Cordyceps militaris extract, 480 parts of white peony root extract, 640 parts of Rehmannia glutinosa extract and 320 parts of Gastrodia elata extract.

[0062] Example 2

[0063] A composition consists of the following components in parts by weight: 160 parts of Cordyceps militaris extract, 480 parts of White Peony Root extract, 640 parts of Rehmannia glutinosa extract, 320 parts of Gastrodia elata extract, 320 parts of Uncaria rhynchophylla extract, 480 parts of Astragalus membranaceus extract, and 320 parts of Salvia miltiorrhiza extract.

[0064] Comparative Example 1

[0065] A composition consists of the following components in parts by weight: 160 parts of American ginseng extract, 480 parts of white peony root extract, 640 parts of Rehmannia root extract and 320 parts of Gastrodia elata extract.

[0066] Comparative Example 2

[0067] A composition consists of the following components in parts by weight: 160 parts of American ginseng extract, 480 parts of white peony extract, 640 parts of Rehmannia glutinosa extract, 320 parts of Gastrodia elata extract, 320 parts of Uncaria rhynchophylla extract, 480 parts of Astragalus membranaceus extract, and 320 parts of Salvia miltiorrhiza extract.

[0068] Comparative Example 3

[0069] A composition consists of the following components in parts by weight: 160 parts of astragalus extract, 480 parts of white peony extract, 640 parts of rehmannia root extract and 320 parts of gastrodia elata extract.

[0070] Example 3

[0071] A composition consists of the following components in parts by weight: 220 parts of Cordyceps militaris extract, 620 parts of white peony root extract, 840 parts of Rehmannia glutinosa extract and 400 parts of Gastrodia elata extract.

[0072] Example 4

[0073] A composition consists of the following components in parts by weight: 220 parts of Cordyceps militaris extract, 620 parts of white peony extract, 840 parts of Rehmannia glutinosa extract, 400 parts of Gastrodia elata extract, 400 parts of Uncaria rhynchophylla extract, 620 parts of Astragalus membranaceus extract, and 400 parts of Salvia miltiorrhiza extract.

[0074] Example 5

[0075] The cordyceps militaris extract comprises the following components: 27% cordycepin, 10% cordycepic acid, 4% cordyceps adenosine, 36% cordyceps polysaccharide, 5% cordyceps polypeptide and 18% amino acid.

[0076] Application Example: Experiment on the improvement and prevention of Parkinson's disease in SD rats by various compositions

[0077] 1. Modeling and group drug administration

[0078] SD male rats, 8-10 weeks old, with a body weight of about 200g, were randomly divided into: sham operation group, model group, positive control group, test group (Example 1-5 group), comparative example group (Comparative example 1-3 group), 5 rats in each group. 4% chloral hydrate anesthesia, the rat head was fixed on a stereotaxic instrument, routine disinfection, 3cm incision was made in the middle of the rat head, the pericranium was peeled off, the anterior fontanelle was exposed, 0.2mm behind the anterior fontanelle, 3.5mm on the right side of the sagittal suture, 4.8mm below the skull, 2 injection points were marked, 5μl each, 2g / L of 6-hydroxydopamine (containing 0.3% ascorbic acid) was slowly injected at the 2 injection points, the needle was slowly removed, the skin was sutured, and then anti-infection treatment was given. 1 week later, 0.5mg / kg apomorphine was subcutaneously injected into the neck of the rat to induce internal rotation in the rat. If the number of rotations in the rat within 30min is more than 210, the Parkinson's model was successfully prepared. The sham operation group was treated according to the above modeling method, but only injected with an equal dose of normal saline. The positive control group, test group and comparative group were administered from the first day of successful modeling. The positive control group (Medopar gavage dose 40 mg / kg / d), the test group (Example 1-4 group, gavage administration, gavage dose 1.4 g / kg / d, Example 5 group, gavage administration, gavage dose 200 mg / kg / d) and the comparative group (Comparative Example 1-3 group gavage administration, gavage dose 1.4 g / kg / d) were administered, and the model group and the sham operation group were gavaged with 10 ml / kg / d normal saline, once a day, for 28 consecutive days.

[0079] 2. Detection indicators and methods

[0080] Rats’ body weight measurement: After successful modeling, rats’ body weights were measured on the 1st day and on the 7th, 14th, 21st, and 28th days, with each measurement time fixed for a total of 5 times.

[0081] Behavioral testing: (1) Rotation test: Before and 4 weeks after drug treatment, rats were subcutaneously injected with 0.5 mg / kg apomorphine in the neck and the number of rotations of the rats within 30 min was recorded. (2) Open field test: The rats were placed in an observation box, and after they were fully adapted, the number of times they entered the peripheral and central areas of the open field was timed and observed every 5 minutes.

[0082] HE staining was used to observe the damage of striatal neurons: after behavioral testing, the rats were anesthetized with pentobarbital, the brain tissue was completely removed by decapitation, the striatal neurons were separated, and stored in a -80°C refrigerator. Part of the fixed brain tissue was rinsed in PBS, dried, and fixed in 4% paraformaldehyde for more than 24 hours, gradient dehydrated, embedded, sliced, dewaxed, stained with hematoxylin for 15 minutes, rinsed with distilled water, permeabilized with xylene, and sealed. The damage of striatal neurons was observed under an optical microscope.

[0083] ELISA was used to detect the changes in the contents of ROS, SOD, MDA and GSH in rat brain tissue: the brain tissue of the rat was taken at low temperature, made into a homogenate, and centrifuged at 3000r / min for 15min to separate the supernatant. The ELISA method was used according to the steps of the kit to detect the levels of ROS, SOD, MDA and GSH in the rat brain tissue.

[0084] RT-PCR was used to detect the expression levels of TH and DAT mRNA in the substantia nigra: 20 mg of brain tissue was weighed at low temperature, 1 mL of Trizol was added to lyse and extract mRNA, and reverse transcribed into cDNA according to the reverse transcription kit steps. The cDNA was used as a template for amplification, β-actin was used as an internal reference, and 2 -ΔΔCt The relative expression of mRNA of each target gene was analyzed by the method.

[0085] Table 1 RT-PCR amplification gene primer sequences

[0086] Gene Forward primer (5'-3') (SEQ ID NO.) Reverse primer (5'-3') (SEQ ID NO.) TH TCCTCCTTGTCTCGGGCTGTA(1) TTCCGACGCTGGCGATACA(4) DAT CGTCTAACTTCATGCTGTCTG(2) GTTTCCTCCATTTCACCTTC(5) β-actin GAGCCACCAATCCACACAGA(3) AGACCTCTATGCCAACACAGT(6)

[0087] 3. Experimental results

[0088] (1) Results of rat weight measurement

[0089] From the results, it can be seen that there is no significant difference in body weight among the rats in each group after 28 days of administration.

[0090] Table 2. Measurement of rat body weight

[0091]

[0092]

[0093] (2) Behavioral test results

[0094] like Figure 1 As shown in the results, it can be seen that compared with the sham operation group, the rotation frequency of the rats in the model group was significantly higher than that in the sham operation group (P<0.001); compared with the model group, the rotation frequency of the rats in the positive control group and the Example 1-5 groups was significantly reduced (P<0.01, P<0.05), and the comparison group 1-3 groups was reduced, but there was no significant difference. The study shows that the Example 1-5 groups can reduce the rotation frequency of rats and restore their motor function.

[0095] like Figure 2As shown, compared with the sham operation group, the open field test score of the model group mice was significantly increased (P < 0.001); compared with the model group, the open field test score of the positive control group and Example 4 group rats was significantly reduced (P < 0.01); the open field test score of the rats in Example 1-3 group and Example 5 group was reduced (P < 0.05); the score of the comparative example 1-3 group was reduced but there was no significant difference. The study shows that Example 1-5 groups can reduce the open field score and have a significant improvement effect on behavioral changes.

[0096] (3) HE staining to observe striatal neuron damage

[0097] like Figure 3 As shown, compared with the sham operation group, the number of striatal neurons in the model group rats was very small and the morphology was severely damaged; the number of neuronal cells in the rats in the Example 1-3 group and the Example 5 group increased, but not significantly; the number of neurons in the rats in the positive control group and the Example 4 group increased significantly, with clearer contours and more complete morphological structures; the number of neuronal cells in the rats in the comparative example 1-3 group was small, and there was no significant change compared with the model group. The study shows that the Example 1-5 group can significantly increase the number of rat neurons and reduce neuronal damage.

[0098] (4) ELISA detection of changes in ROS, SOD, MDA and GSH content in rat brain tissue

[0099] like Figure 4-Figure 7 As shown, compared with the sham operation group, the ROS and MDA contents in the brain tissue of the rats in the model group were significantly increased (P<0.001), and the GSH and SOD contents were significantly decreased (P<0.001); compared with the model group, the ROS and MDA contents in the Example 1-5 group and the positive control group were decreased (P<0.05, <0.01), and the GSH and SOD contents were increased (P<0.05, <0.01). The ROS and MDA contents in the brain tissue of the rats in the comparative example 1-3 group showed a downward trend, and the GSH and SOD contents showed an upward trend, but there was no significant difference. The study showed that the Example 1-5 group could restore the ROS and MDA contents in the brain tissue of the rats, reduce the GSH and SOD contents, and the Example 1-5 group had a good anti-oxidative stress effect.

[0100] (5) RT-PCR detection of THmRNA and DATmRNA expression levels in substantia nigra

[0101] like Figure 8 and Fig. 9As shown, compared with the sham operation group, the levels of THmRNA and DATmRNA in the brain tissue of the model group rats were significantly reduced (P < 0.001); compared with the model group, the positive control group was able to significantly restore the levels of DATmRNA and THmRNA in the mouse brain tissue (P < 0.01); the levels of THmRNA and DATmRNA in the brain tissue of the rats in Example 1-5 groups were restored (P < 0.05, P < 0.01). The levels of THmRNA and DATmRNA in the control group 1-3 groups were restored, but there was no significant difference. The study showed that the Example 1-5 groups can restore the expression of DATmRNA and THmRNA in the rat brain tissue, and play a protective role on the dopamine neurons of PD rats.

[0102] In summary, the groups of Examples 1-5 provided by the present invention can effectively prevent and improve Parkinson's disease, and have no significant effect on body weight. In particular, when the Cordyceps militaris extract is used together with the White Peony Root Extract, the Rehmannia Glutinosa Extract, the Gastrodia Elata Extract, the Uncaria Rhynchophylla Extract, etc., a synergistic effect is produced, further improving the therapeutic effect. Figure 3 The number of neurons in Examples 1-4 is much higher than that in Example 5 and Comparative Examples 1-3.

[0103] Example 6

[0104] The cordyceps militaris extract comprises the following components: 27% cordycepin, 5% cordycepic acid, 2% cordyceps adenosine, 30% cordyceps polysaccharide, 2% cordyceps polypeptide and 23% amino acid.

[0105] Example 7

[0106] The cordyceps militaris extract comprises the following components: 27% cordycepin, 15% cordycepic acid, 6% cordyceps adenosine, 45% cordyceps polysaccharide, 8% cordyceps polypeptide and 13% amino acid.

[0107] Animal experiments have shown that the Cordyceps militaris extracts provided in Examples 6 and 7 can also effectively prevent and improve Parkinson's disease and have no significant effect on body weight.

[0108] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A composition for preventing and / or improving Parkinson's disease, characterized in that: Including Cordyceps militaris extract, White Peony Root Extract, Rehmannia Glutinosa Extract and Gastrodia elata Extract.

2. The composition according to claim 1, characterized in that The weight proportions of the Cordyceps militaris extract, White Peony Root Extract, Rehmannia Glutinosa Extract and Gastrodia elata Extract are 12-26 parts, 44-66 parts, 60-88 parts and 28-44 parts respectively, preferably 14-24 parts, 46-64 parts, 62-86 parts and 30-42 parts, and preferably 16-22 parts, 48-62 parts, 64-84 parts and 32-40 parts.

3. The composition according to claim 1, characterized in that The weight proportions of the Cordyceps militaris extract, White Peony Root Extract, Rehmannia Glutinosa Extract and Gastrodia elata Extract are 12-20 parts, 44-52 parts, 60-68 parts and 28-36 parts respectively, preferably 14-18 parts, 46-50 parts, 62-66 parts and 30-34 parts, preferably 16 parts, 48 ​​parts, 64 parts and 32 parts respectively; Or, the weight proportions of the Cordyceps militaris extract, white peony extract, Rehmannia glutinosa extract and Gastrodia elata extract are 18-26 parts, 58-66 parts, 80-88 parts, 36-44 parts, preferably 20-24 parts, 60-64 parts, 82-86 parts, 38-42 parts, preferably 22 parts, 62 parts, 84 parts, 40 parts.

4. The composition according to any one of claims 1 to 3, characterized in that The Cordyceps militaris extract is a water extract of Cordyceps militaris; preferably, the mass ratio of cordycepin to cordyceps polysaccharide in the Cordyceps militaris extract is 3:2.1-8, preferably 3:3-6, and preferably 3:

4.

5. The composition according to any one of claims 1 to 4, characterized in that The composition further comprises any one or a combination of the following components: Uncaria rhynchophylla extract, Astragalus membranaceus extract and Salvia miltiorrhiza extract.

6. The composition according to claim 5, characterized in that The weight proportions of the Cordyceps militaris extract and the Uncaria rhynchophylla extract are 12-26 parts and 28-44 parts, preferably 14-24 parts and 30-42 parts, preferably 16-22 parts and 32-40 parts, respectively; The weight proportions of the Cordyceps militaris extract and the Astragalus membranaceus extract are 12-26 parts and 44-66 parts, respectively, preferably 14-24 parts and 46-64 parts, preferably 16-22 parts and 48-62 parts; The weight proportions of the Cordyceps militaris extract and the Salvia miltiorrhiza extract are 12-26 parts and 28-44 parts, preferably 14-24 parts and 30-42 parts, preferably 16-22 parts and 32-40 parts, respectively; Preferably, the weight proportions of the Cordyceps militaris extract, Uncaria rhynchophylla extract, Astragalus membranaceus extract and Salvia miltiorrhiza extract are 12-26 parts, 28-44 parts, 44-66 parts and 28-44 parts respectively, preferably 14-24 parts, 30-42 parts, 46-64 parts and 30-42 parts, preferably 16-22 parts, 32-40 parts, 48-62 parts and 32-40 parts.

7. A pharmaceutical composition for preventing and / or improving Parkinson's disease, characterized in that: The invention comprises (i) the composition or Cordyceps militaris extract according to any one of claims 1 to 6, and (ii) a pharmaceutically acceptable excipient.

8. The pharmaceutical composition according to claim 7, characterized in that The Cordyceps militaris extract is a water extract of Cordyceps militaris; preferably, the mass ratio of cordycepin to cordyceps polysaccharide in the Cordyceps militaris extract is 3:2.1-8, preferably 3:3-6, and preferably 3:

4.

9. Use of the composition according to any one of claims 1 to 6, the pharmaceutical composition according to claim 7 or 8, or the Cordyceps militaris extract in the preparation of drugs for preventing and / or improving Parkinson's disease.

10. The use according to claim 9, characterized in that: The Cordyceps militaris extract is a water extract of Cordyceps militaris; preferably, the mass ratio of cordycepin to cordyceps polysaccharide in the Cordyceps militaris extract is 3:2.1-8, preferably 3:3-6, and preferably 3:4.

Images