TFEB acetylation site K256 and application thereof in triple negative breast cancer treatment

Abstract

The invention discloses a TFEB acetylation site K256 and application of the TFEB acetylation site K256 in treatment of triple negative breast cancer, and belongs to the technical field of biological medicine. The acetylation site of the TFEB protein at the K256 position is identified for the first time, it is indicated that the site can serve as a treatment target of the triple negative breast cancer, and mutation of the K256 site can cause decrease of the autophagy level of cells, so that death of tumor cells is promoted. The discovery of the K256 acetylation site on the TFEB protein opens up a new path for the treatment of the triple negative breast cancer, by regulating and controlling the site, the transcriptional activity of the TFEB is enhanced, the lysosome function is promoted, and then the growth of tumor cells is inhibited, and the discovery has important significance in the aspects of early detection, illness monitoring, new drug research and development and the like of the triple negative breast cancer.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a TFEB acetylation site K256 and an application thereof in the treatment of triple-negative breast cancer. Background Art

[0002] Breast cancer is one of the most common malignant tumors in women worldwide and one of the leading causes of cancer death in women. Triple negative breast cancer (TNBC) refers to breast cancer in which the expression of estrogen receptors, progesterone receptors and HER2 are all negative, accounting for about 15% to 20% of breast cancer. TNBC has the worst prognosis among breast cancer types due to its young onset, strong invasiveness, high risk of recurrence and rapid development, and lack of specific targeted treatments for HER2. Exploring the mechanism of occurrence and development of TNBC and finding effective therapeutic targets for TNBC have become hot topics in the field of breast cancer research.

[0003] In recent years, with the deepening of epigenetic research, people have gradually realized that epigenetic regulation plays an important role in the pathogenesis of breast cancer. Epigenetic regulation includes DNA methylation, histone acetylation modification, and changes in non-coding RNA. Unlike gene mutations, epigenetic changes are reversible. Therefore, in-depth understanding of the epigenetic mechanism of action in the process of tumor occurrence and development and the development of tumor immunotherapy drugs targeting key epigenetic variation sites have become current research hotspots and have good application prospects.

[0004] Transcription Factor EB (TFEB) is a major regulator of lysosomal biogenesis, function, and autophagy. Its activity is affected by a variety of post-translational modifications (PTMs), including phosphorylation and acetylation. Acetylation is an important PTM that can change the functional properties of proteins, including stability, intracellular localization, and interactions with other proteins. Studies have shown that acetylation of TFEB can enhance its transcriptional activity, promote lysosomal function, and is associated with lysosome-dependent autophagy and apoptosis. In addition, acetylation of TFEB may interact with other post-translational modifications such as phosphorylation to jointly regulate the activity and function of TFEB. This complex regulatory network provides potential targets for the development of new therapeutic approaches.

[0005] Since TNBC lacks traditional therapeutic targets, finding new drug targets has become an urgent issue to be addressed in this field. Summary of the invention

[0006] In response to the problems existing in the prior art, the inventor's team discovered that histone deacetylase inhibitors can enhance the transcriptional function and acetylation level of TFEB in triple-negative breast cancer cells, identified the acetylation sites of TFEB through mass spectrometry analysis, and proposed the concept that TFEB in triple-negative breast cancer has acetylation modification; by constructing a lentivirus with a mutation in the acetylation site of TFEB and infecting triple-negative breast cancer cells, triple-negative breast cancer cells transfected with TFEB with an acetylation mutation site were obtained, and the therapeutic effect of the acetylation site K256 on triple-negative breast cancer cells was detected by comparing the changes in autophagy-related proteins through protein sequencing.

[0007] Specifically, the technical solution of the present invention is as follows:

[0008] A TFEB acetylation site K256, wherein the TFEB acetylation site is obtained by mutating the lysine K at position 256 of the TFEB protein to arginine R.

[0009] Furthermore, the identification of the TFEB acetylation site K256 comprises the following steps:

[0010] Deacetylase inhibitors were added to TFEB gene knockout triple-negative breast cancer cells and untreated triple-negative breast cancer cells, and samples were collected after culturing for 12 hours. Acetylation was detected by mass spectrometry, and the differential acetylation site was identified as the K256 site.

[0011] Furthermore, the triple-negative breast cancer cells are MDA-MB-468 cells.

[0012] Furthermore, the preparation of the TFEB gene knockout triple-negative breast cancer cells comprises the following steps:

[0013] The base sequence A targeting the TFEB gene and its corresponding primer sequence A are designed and synthesized; the base sequence A is amplified by PCR using a lentiviral expression vector pLVX-U6-CMV-Cas9-P2A-Puro as a template, and a DNA band containing a base sequence A fragment is recovered by 2% agarose gel electrophoresis; the lentiviral expression vector is subjected to an enzyme digestion reaction A, and the enzyme-digested large fragment A is recovered by 1% agarose gel electrophoresis; the DNA band containing the base sequence A fragment and the enzyme-digested large fragment A are recombined to construct a recombinant plasmid; the recombinant plasmid is transfected into 293T cells to obtain a lentivirus containing the base sequence A fragment; the lentivirus is used to infect triple-negative breast cancer cells to obtain the triple-negative breast cancer cells with the TFEB gene knocked out.

[0014] Furthermore, the RNA sequence A includes hTEFB-1sgRNA, hTEFB-2sgRNA or hTEFB-3sgRNA.

[0015] Furthermore, the PCR primer A includes hTFEB-1-F1, hTEFB-2-F1 or hTEFB-3-F1, sgRNA-F2 or sgRNA-R.

[0016] Furthermore, the hTEFB-1 sgRNA is 5'-CCACCATGGCGTCACGCATA GGG-3'.

[0017] Furthermore, the hTEFB-2 sgRNA is 5'-GTATTGATGGCCGGGGTGGG CGG-3'.

[0018] Furthermore, the hTEFB-3 sgRNA is 5'-GTGGCGACTGGAAGTGGACG GGG-3'.

[0019] Furthermore, the hTEFB-1-F1 is 5'-GGAAAGGACGAAACACCGGCCACCATGGCGTCACGCATAGTTTTAGA GCTAGAAATAGC-3'.

[0020] Furthermore, the hTEFB-2-F1 is 5'-GGAAAGGACGAAACACCGGGTATTGATGGCCGGGGTGGGGTTTTAGA GCTAGAAATAGC-3'.

[0021] Furthermore, the hTEFB-3-F1 is 5'-GGAAAGGACGAAACACCGGGTGGCGACTGGAAGTGGACGGTTTTAGA GCTAGAAATAGC-3'.

[0022] Furthermore, the sgRNA-F2 is 5'-TTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACT TGAAAAAGTG-3.

[0023] Furthermore, the sgRNA-R is 5'-ACTATTAATAACTAGAATTCAAAAAAGCACCGACTCGGTGCCACTTTTT CAAGTTGATA-3'.

[0024] Furthermore, the enzymes used in the restriction digestion reaction A include AgeI and EcoRI.

[0025] Furthermore, the length of the DNA band containing the base sequence A fragment is 140 bp.

[0026] Furthermore, the reaction temperature of the enzyme cleavage reaction A is 37° C. and the reaction time is 3 h.

[0027] Furthermore, the reaction temperature of the recombination reaction is 50° C. and the reaction time is 15 min.

[0028] Furthermore, the TFEB acetylation site K256 is used as a therapeutic target for triple-negative breast cancer.

[0029] Furthermore, a use of TFEB acetylation site K256 in the treatment of triple-negative breast cancer comprises the following steps:

[0030] The TFEB acetylation site mutation lentivirus was used to infect triple-negative breast cancer cells to obtain triple-negative breast cancer cells infected with TFEB at the acetylation mutation site; by comparing the WB and PCR results of the two cells before and after the mutation, it was shown that the TFEB acetylation site K256 can be used as a therapeutic target for triple-negative breast cancer; in vitro and in vivo experiments proved that the mutation of the K256 site can lead to a decrease in the level of cellular autophagy and promote the death of triple-negative breast cancer cells.

[0031] Furthermore, the construction of the TFEB acetylation site mutated lentivirus comprises the following steps:

[0032] A forward primer sequence SEQ ID NO.1 and a reverse primer sequence SEQ ID NO.2 for the TFEB gene were designed and synthesized, PCR amplification was performed using the plasmid pLVX-hTFEB-ZsGreen-Puro as a template, and the target plasmid containing the base sequence of SEQ ID NO.3 was recovered by 1% agarose gel electrophoresis; restriction enzyme digestion was performed on the target plasmid, and a large fragment containing the base sequence of SEQ ID NO.3 was recovered by 1% agarose gel electrophoresis; the large fragment was transfected into 293T cells to obtain the TFEB acetylation site mutated lentivirus.

[0033] Furthermore, the enzyme used in the restriction digestion reaction is DpnI.

[0034] Furthermore, the length of the target plasmid containing the base sequence of SEQ ID NO.3 is 10774 bp.

[0035] Furthermore, the reaction temperature of the enzyme cleavage reaction is 37° C. and the reaction time is 3 h.

[0036] Furthermore, the in vitro experiment is a protein detection experiment.

[0037] Furthermore, the in vivo experiment is a mouse tumor formation experiment.

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] (1) The present invention identifies for the first time the acetylation site of TFEB protein at lysine 256 (K256), which serves as a therapeutic target for triple-negative breast cancer and can reduce the level of cellular autophagy, thereby promoting the death of tumor cells.

[0040] (2) The discovery of the TFEB acetylation site provides a new target for the treatment of triple-negative breast cancer. By regulating this site, the transcriptional activity of TFEB is enhanced, thereby promoting lysosomal function and autophagy, thereby fighting tumor cells. This discovery is of great significance for the early detection, disease monitoring and new drug development of triple-negative breast cancer.

[0041] (3) Detection of the acetylation status of TFEB has become a new marker for assessing the prognosis of triple-negative breast cancer, which helps to evaluate the treatment effect and predict disease progression. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 is the TFEB gene knockout efficiency.

[0043] Figure 2 The results of WB and electrophoresis are shown.

[0044] Figure 3 Fluorescence images (left) and white light images (right) of 293T cells transfected with pLVX-hTFEB-K256R-ZsGreen-Puro 24 hours later.

[0045] Figure 4 Fluorescence images of MDA-MB-468 cells infected with rLV-hTFEB-K256R-ZsGreen-Puro for 72 hours.

[0046] Figure 5 The expression of P62 protein and LC3B protein.

[0047] Figure 6 Comparison pictures of tumors in mice. DETAILED DESCRIPTION

[0048] The technical solution of the present invention will be clearly and completely described below through the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0049] Unless otherwise specified, the raw materials and reagents used in the present invention are commercially available or can be prepared by known methods.

[0050] Preparation Example 1:

[0051] The preparation of TFEB gene knockout triple-negative breast cancer cells includes the following steps:

[0052] hTEFB-1sgRNA, hTEFB-1-F1, sgRNA-F2 and sgRNA-R were designed and synthesized; hTEFB-1sgRNA was amplified by PCR using pLVX-U6-CMV-Cas9-P2A-Puro as a template, and the DNA band (140 bp) containing hTEFB-1sgRNA was recovered by 2% agarose gel electrophoresis; pLVX-U6-CMV-Cas9-P2A-Puro was subjected to restriction enzyme digestion reaction A at 37°C in a water bath for 3 h, and the DNA fragments were purified by PCR. The enzyme-cut large fragment A was recovered by 1% agarose gel electrophoresis; the above-mentioned DNA band containing hTEFB-1sgRNA and the enzyme-cut large fragment A were reacted at 50°C for 15 min for recombination to construct a recombinant plasmid; the recombinant plasmid was transfected into 293T cells to prepare a lentivirus containing hTEFB-1sgRNA; the lentivirus was used to infect triple-negative breast cancer cells to prepare triple-negative breast cancer cells with TFEB gene knockout (MDA-MB-468-U6-hTFEB-1sgRNA-Cas9-Puro).

[0053] Preparation Example 2:

[0054] The preparation of TFEB gene knockout triple-negative breast cancer cells includes the following steps:

[0055] hTEFB-2sgRNA, hTEFB-2-F1, sgRNA-F2 and sgRNA-R were designed and synthesized; hTEFB-2sgRNA was amplified by PCR using pLVX-U6-CMV-Cas9-P2A-Puro as a template, and the DNA band (140 bp) containing hTEFB-2sgRNA was recovered by 2% agarose gel electrophoresis; pLVX-U6-CMV-Cas9-P2A-Puro was subjected to restriction enzyme digestion reaction A at 37°C in a water bath for 3 h, and the DNA fragments were purified by PCR. The enzyme-cut large fragment A was recovered by 1% agarose gel electrophoresis; the above-mentioned DNA band containing hTEFB-2sgRNA and the enzyme-cut large fragment A were reacted at 50°C for 15 min for recombination to construct a recombinant plasmid; the recombinant plasmid was transfected into 293T cells to prepare a lentivirus containing hTEFB-2sgRNA; the lentivirus was used to infect triple-negative breast cancer cells to prepare triple-negative breast cancer cells with TFEB gene knockout (MDA-MB-468-U6-hTFEB-2sgRNA-Cas9-Puro).

[0056] Preparation Example 3:

[0057] The preparation of TFEB gene knockout triple-negative breast cancer cells includes the following steps:

[0058] hTEFB-3sgRNA, hTEFB-3-F1, sgRNA-F2 and sgRNA-R were designed and synthesized; hTEFB-3sgRNA was amplified by PCR using pLVX-U6-CMV-Cas9-P2A-Puro as a template, and the DNA band (140 bp) containing hTEFB-3sgRNA was recovered by 2% agarose gel electrophoresis; pLVX-U6-CMV-Cas9-P2A-Puro was subjected to restriction enzyme digestion reaction A at 37°C in a water bath for 3 h, and the DNA fragments were purified by PCR. The enzyme-cut large fragment A was recovered by 1% agarose gel electrophoresis; the above-mentioned DNA band containing hTEFB-3sgRNA and the enzyme-cut large fragment A were reacted at 50°C for 15 min for recombination to construct a recombinant plasmid; the recombinant plasmid was transfected into 293T cells to prepare a lentivirus containing hTEFB-3sgRNA; the lentivirus was used to infect triple-negative breast cancer cells to prepare triple-negative breast cancer cells with TFEB gene knockout (MDA-MB-468-U6-hTFEB-3sgRNA-Cas9-Puro).

[0059] Preparation Example 4:

[0060] The construction of the TFEB acetylation site mutated lentivirus comprises the following steps:

[0061] The forward primer sequence SEQ ID NO.1 and the reverse primer sequence SEQ ID NO.2 for the TFEB gene were designed and synthesized, PCR amplification was performed using pLVX-hTFEB-ZsGreen-Puro as a template, and the target plasmid containing the base sequence of SEQ ID NO.3 was recovered by 1% agarose gel electrophoresis; the target plasmid was digested with DpnI at 37°C for 3h, and the large fragment (pLVX-hTFEB-K256R-ZsGreen-Puro) containing the base sequence of SEQ ID NO.3 was recovered by 1% agarose gel electrophoresis; the large fragment was transfected into 293T cells to obtain a TFEB acetylation site mutated lentivirus (rLV-hTFEB-K256R-ZsGreen-Puro).

[0062] Example:

[0063] The identification of TFEB acetylation site K256 includes the following steps:

[0064] Experimental group cell A: TFEB gene knockout triple-negative breast cancer cells (MDA-MB-468-U6-hTFEB-3sgRNA-Cas9-Puro) prepared in Preparation Example 3.

[0065] Control group cell B: untreated triple-negative breast cancer cells (MDA-MB-468).

[0066] Deacetylase inhibitors were added to cells A in the experimental group and cells B in the control group during the culture process, and samples were collected after 12 hours of culture. 7 The cells (supplemented with sirtuin inhibitors again 2 h before harvesting, and sirtuin inhibitors were also added to the protein lysate) were subjected to mass spectrometry analysis to determine the acetylation level.

[0067] Application Example 1: Western blot verification of TFEB gene knockout efficiency

[0068] Proteins of 293T cells and triple-negative breast cancer cells with TFEB gene knockout prepared in Preparation Examples 1 to 3 were extracted, and the knockout efficiency of TFEB gene was verified by Western blot. The results are as follows: Figure 1 shown.

[0069] exist Figure 1 It can be seen that the expression of TFEB protein in the treated cells was significantly reduced, among which the TFEB gene knockout effect in Preparation Example 3 was the best.

[0070] Application Example 2: WB and electrophoresis detection

[0071] Treatment of the experimental group cell A in the embodiment: 200 μL of cell lysis solution was added to cell A to suspend the cells, lysed in a 0°C environment for 10 minutes, centrifuged at 16000×g for 20 minutes at 4°C after lysis, and the supernatant was transferred to a new centrifuge tube at 0°C to obtain lysate A. 50 μL of lysate A was aspirated, and 50 μL of 2-fold concentrated SDS loading buffer was added to obtain hTFEB cell lysis. 50 μL of lysate A was aspirated and added to the primary antibody-magnetic bead complex, incubated at 4°C for 12 hours, the magnetic beads were washed off to obtain IP-enriched proteins, and then 50 μL of 2-fold concentrated SDS loading buffer was added to obtain hTFEB cell lysis after IP. 50 μL of cell A was aspirated and added to the primary antibody-magnetic bead complex, incubated at 4°C for 12 hours, the magnetic beads were washed off to obtain IP-enriched proteins, and then 50 μL of 2-fold concentrated SDS loading buffer was added to obtain hTFEB IP. Boil hTFEB cell lysis, hTFEB cell lysis after IP, and hTFEB IP at 100°C for 5 min, then aliquot and load.

[0072] Treatment of the control group cells B in the embodiment: 200 μL of cell lysis solution was added to the cells B to suspend the cells, lysed in a 0°C environment for 10 min, centrifuged at 16000×g for 20 min at 4°C after lysis, and the supernatant was transferred to a new centrifuge tube at 0°C to obtain lysate B. 50 μL of lysate B was aspirated, and 50 μL of 2-fold concentrated SDS loading buffer was added to obtain 468cell lysis. 50 μL of lysate B was aspirated and added to the primary antibody-magnetic bead complex, incubated at 4°C for 12 h, the magnetic beads were washed off to obtain proteins enriched by immunoprecipitation (IP), and then 50 μL of 2-fold concentrated SDS loading buffer was added to obtain 468cell lysis after IP. 50 μL of cell B was aspirated and added to the primary antibody-magnetic bead complex, incubated at 4°C for 12 h, the magnetic beads were washed off to obtain proteins enriched by IP, and then 50 μL of 2-fold concentrated SDS loading buffer was added to obtain 468IP. Boil 468cell lysis, 468cell lysis after IP and 468IP at 100°C for 5 min, then aliquot and load.

[0073] Electrophoresis and transfer: Load 2 μL of protein molecular weight standard solution into 12.5% ​​SDS-PAGE gel well to obtain sample 1, load 4 μL of hTFEB cell lysis into 12.5% ​​SDS-PAGE gel well to obtain sample 2, load 4 μL of 468 cell lysis into 12.5% ​​SDS-PAGE gel well to obtain sample 3, load 4 μL of hTFEB IP into 12.5% ​​SDS-PAGE gel well to obtain sample 4, load 4 μL of 468 IP into 12.5% ​​SDS-PAGE gel well to obtain sample 5, load 12 μL of hTFEB IP that has completed SDS-PAGE electrophoresis into 12.5% ​​SDS-PAGE gel well to obtain sample 6, and load 12 μL of 468IP that has completed SDS-PAGE electrophoresis into 12.5% ​​SDS-PAGE gel well to obtain sample 7. The samples were electrophoresed at a voltage of 100 V for 1 to 2 hours. After the electrophoresis, a voltage of 12 V was used for 12 to 16 hours to transfer the samples from the gel to the membrane.

[0074] WB detection: Block the membrane with 5% blocking solution at 25℃ for 1h, or block the membrane at 4℃ for 12h. After blocking, use the primary antibody with appropriate dilution to incubate the membrane in 2% blocking solution at 25℃ for 3h. After incubation, wash the membrane with TBST solution for 3 times, 5min each time, and then incubate the membrane with the labeled secondary antibody with recommended dilution in TBST solution at 25℃ for 1h. After incubation, wash the membrane with TBST solution for 3 times, 5min each time. After rinsing, expose the membrane to chemiluminescent solution for color development.

[0075] The experimental results are as follows Figure 2 As shown, the control group cell B (marked as: 468 in the figure) can detect the TFEB target protein band (red arrow), and the TFEB gene knockout cell WB represented by the experimental group cell A can not detect the target gene band. The sample after IP can see that the target band signal is significantly enhanced, while there is no target band in the cell lysate after IP (cell lysis after IP), indicating that IP enrichment of TFEB is very effective. After SDS-PAGE was stained with Coomassie Brilliant Blue, the 468IP lane was selected for cutting at 50-70kd, and trypsin and pepsin enzyme digestion and mass spectrometry identification were performed respectively. After identification, by comparing the experimental group and the control group, the differential acetylation sites were identified as shown in Table 1, among which the highest score was the K256 site (24.382 points).

[0076] Table 1. Differential acetylation sites

[0077]

[0078]

[0079] Application Example 3: Fluorescence Detection

[0080] The triple-negative breast cancer cells were infected with the TFEB acetylation site mutation lentivirus obtained in Preparation Example 4 to obtain triple-negative breast cancer cells infected with TFEB at the acetylation mutation site (MDA-MB-468-hTFEB-K256R-ZsGreen-Puro).

[0081] The infection effect of TFEB acetylation site mutation lentivirus on triple-negative breast cancer cells was detected by fluorescence. Figure 3 and Figure 4 As shown. Figure 3 The fluorescence and white light images of 293T cells transfected with pLVX-hTFEB-K256R-ZsGreen-Puro 24 hours after transfection are shown, indicating that pLVX-hTFEB-K256R-ZsGreen-Puro can be well expressed in 293T cells. Figure 4 The fluorescence images of MDA-MB-468 cells infected with rLV-hTFEB-K256R-ZsGreen-Puro for 72 hours are shown in the figure. The results show that rLV-hTFEB-K256R-ZsGreen-Puro has good infection efficiency in MDA-MB-468 cells.

[0082] Application example 4: Protein expression detection

[0083] Experimental group cell C: triple-negative breast cancer cells infected with TFEB at the acetylation mutation site obtained in Example 3 (MDA-MB-468-hTFEB-K256R-ZsGreen-Puro).

[0084] Control group cell D: non-mutated triple-negative breast cancer cells (MDA-MB-468).

[0085] Protein expression was detected in experimental group cell C and control group cell D. The test results are as follows Figure 5 Compared with the non-mutated control group, the levels of autophagy-related proteins P62 and LC3B in the acetylated site K256 mutation group were significantly increased, which further proved that the acetylated site K256-TFEB inhibited the occurrence of autophagy, indicating that the acetylated site K256 plays a key role in the regulation of triple-negative breast cancer and can be used as a therapeutic target for triple-negative breast cancer.

[0086] Application Example 5:

[0087] Positive group cell C: triple-negative breast cancer cells infected with TFEB at the acetylation mutation site obtained in Example 2 (MDA-MB-468-hTFEB-K256R-ZsGreen-Puro).

[0088] Control group cell D: non-mutated triple-negative breast cancer cells (MDA-MB-468).

[0089] MDA-MB-468 cells of different genotypes were cultured, and the amount of cell suspension used was shown in Table 2.

[0090] Table 2. Cell suspension dosage

[0091]

[0092]

[0093] Twelve 6-8 week old female NPSGs that had been adapted for one week were weighed on the day of inoculation and randomly divided into two groups according to their body weight, with 6 in each group, which was regarded as day 0 (D0). The grouping and inoculation conditions are shown in Table 3. When the tumor grew to 80-100 mm 3 After the tumor was measurable, the mice were measured twice a week for body weight and tumor volume, and the experimental endpoint was set at tumor growth to 1500mm 3 When the tumor was removed, it was measured, photographed and weighed. Half of the samples were quickly frozen and the rest were fixed. Figure 6 And as shown in Table 4.

[0094] Table 3. Grouping and vaccination information

[0095]

[0096] Table 4. Comparison of tumor size in mice

[0097]

[0098] The experimental results showed that the tumor size of positive cells C, i.e., mutant group cells, was significantly smaller than that of control group cells, i.e., non-mutated cells, indicating that the hTFEB-K256R mutation inhibited tumor growth.

[0099] The above-described embodiments provide a detailed description of the technical solutions and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected.

Claims

1. A TFEB acetylation site K256, characterized in that: The TFEB acetylation site is obtained by mutating the 256th lysine K of the TFEB protein to arginine R.

2. A TFEB acetylation site K256 according to claim 1, characterized in that The identification of the TFEB acetylation site K256 comprises the following steps: Deacetylase inhibitors were added to TFEB gene knockout triple-negative breast cancer cells and untreated triple-negative breast cancer cells, and samples were collected after culturing for 12 hours. Acetylation was detected by mass spectrometry, and the differential acetylation site was identified as the K256 site.

3. A TFEB acetylation site K256 according to claim 2, characterized in that: The triple-negative breast cancer cells are MDA-MB-468 cells.

4. The TFEB acetylation site K256 according to claim 1, characterized in that: The TFEB acetylation site K256 is used as a therapeutic target for triple-negative breast cancer.

5. Use of a TFEB acetylation site K256 in the treatment of triple-negative breast cancer according to any one of claims 1 to 4, characterized in that: The application comprises the following steps: The TFEB acetylation site mutation lentivirus was used to infect triple-negative breast cancer cells to obtain triple-negative breast cancer cells infected with TFEB at the acetylation mutation site; by comparing the WB and PCR results of the two cells before and after the mutation, it was shown that the TFEB acetylation site K256 can be used as a therapeutic target for triple-negative breast cancer; in vitro and in vivo experiments proved that the mutation of the K256 site can lead to a decrease in the level of cellular autophagy and promote the death of triple-negative breast cancer cells.

6. The use according to claim 5, characterized in that The construction of the TFEB acetylation site mutated lentivirus comprises the following steps: A forward primer sequence SEQ ID NO.1 and a reverse primer sequence SEQ ID NO.2 for the TFEB gene were designed and synthesized, PCR amplification was performed using the plasmid pLVX-hTFEB-ZsGreen-Puro as a template, and the target plasmid containing the base sequence of SEQ ID NO.3 was recovered by 1% agarose gel electrophoresis; the target plasmid was subjected to an enzyme digestion reaction, and a large fragment containing the base sequence of SEQ ID NO.3 was recovered by 1% agarose gel electrophoresis; the large fragment was transfected into 293T cells to obtain the TFEB acetylation site mutated lentivirus.

7. The use according to claim 5, characterized in that The in vitro experiment is a protein detection experiment.

8. The use according to claim 5, characterized in that The in vivo experiment is a mouse tumor formation experiment.

Images