Fusion protein and application thereof in identifying BCG vaccine immunity and naturally infected mycobacterium tuberculosis

Abstract

The invention provides a fusion protein and application thereof in identifying BCG vaccine immunity and naturally infected mycobacterium tuberculosis, and relates to the technical field of biology. The fusion protein provided by the invention comprises an Rv3615c-1 fragment and an Rv3615c-2 fragment. The fusion protein is high in antigen specificity, BCG vaccine immunization and naturally infected mycobacterium tuberculosis identification can be realized in a skin test detection, ELISA detection or in-vitro IFN-gamma detection mode, and the detection sensitivity and specificity are high.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a fusion protein and its application in distinguishing BCG vaccine immunity and natural infection of Mycobacterium tuberculosis. Background Art

[0002] Bovine tuberculosis is a chronic bacterial disease caused by Mycobacterium bovis infecting cattle. It can also infect humans and some other animals and cause corresponding diseases. It is listed as a notifiable animal disease by the International Veterinary Office (OIE). Bovine tuberculosis directly affects the productivity of cattle and the international trade of their products, causing huge economic losses. At the same time, as an important zoonosis, it is also a major threat to public health. Therefore, how to effectively prevent and detect bovine tuberculosis has important economic and social significance.

[0003] Given that the body's immune response in the early stage of mycobacterial infection is mainly based on cellular immunity, the quarantine of bovine tuberculosis is mainly based on cellular immune response detection methods, including tuberculin intradermal test (TST) and antigen-specific interferon-γ (IFN-γ) detection test. Among them, TST is the most commonly used bovine tuberculosis detection method designated by OIE, but its sensitivity and specificity are limited. The IFN-γ detection method mainly detects the level of IFN-γ produced after whole blood is stimulated in vitro by specific antigens, but it is mainly used as an auxiliary detection method for TST. Both methods use tuberculin purified protein derivative (PPD), which is obtained by inactivation and purification of mycobacterial culture. PPD has complex components and its specificity is easily affected by cross-reactions, which often causes false positives in diagnostic results and brings some unnecessary losses to production. In addition, BCG vaccination will interfere with the diagnosis of tuberculosis. The above detection methods often cannot distinguish between vaccine immunity and natural infection, which seriously hinders quarantine measures, and the epidemic state caused by the spread of pathogens is difficult to eliminate, making bovine tuberculosis prevention and control time-consuming and labor-intensive, and difficult to control. Therefore, exploring specific and sensitive detection antigens is of great significance for controlling bovine tuberculosis.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The first object of the present invention is to provide a fusion protein with high antigen specificity, which can be used for identification of BCG vaccine immunization and natural infection of Mycobacterium tuberculosis with high accuracy, so as to solve the above problems.

[0006] The second object of the present invention is to provide a biomaterial.

[0007] The third object of the present invention is to provide the use of the above fusion protein in distinguishing BCG vaccine immunization and natural infection of Mycobacterium tuberculosis.

[0008] The fourth object of the present invention is to provide a reagent.

[0009] A fifth object of the present invention is to provide an ELISA kit.

[0010] In order to achieve the above objectives, the following technical solutions are adopted:

[0011] In a first aspect, the present invention provides a fusion protein comprising an Rv3615c-1 fragment and an Rv3615c-2 fragment;

[0012] The amino acid sequence of the Rv3615c-1 fragment is shown as SEQ ID NO.5 or a sequence having at least 90% homology with the sequence; the amino acid sequence of the Rv3615c-2 fragment is shown as SEQ ID NO.6 or a sequence having at least 90% homology with the sequence.

[0013] As a further technical solution, the fusion protein comprises at least one repeating unit, and adjacent repeating units are connected by a connecting peptide;

[0014] The repeating unit is mainly composed of an ESAT6-1 fragment, an ESAT6-2 fragment, a CFP10-1 fragment, a CFP10-2 fragment, an Rv3615c-1 fragment and an Rv3615c-2 fragment, and adjacent fragments are connected by a connecting peptide;

[0015] The amino acid sequence of the ESAT6-1 fragment is shown in SEQ ID NO. 1 or a sequence having at least 90% homology thereto;

[0016] The amino acid sequence of the ESAT6-2 fragment is shown in SEQ ID NO. 2 or a sequence having at least 90% homology thereto;

[0017] The amino acid sequence of the CFP10-1 fragment is shown in SEQ ID NO. 3 or a sequence having at least 90% homology thereto;

[0018] The amino acid sequence of the CFP10-2 fragment is shown in SEQ ID NO. 4 or a sequence having at least 90% homology thereto.

[0019] As a further technical solution, the repeating unit is composed of ESAT6-1 fragment, ESAT6-2 fragment, CFP10-1 fragment, CFP10-2 fragment, Rv3615c-1 fragment and Rv3615c-2 fragment connected in series from N-terminus to C-terminus, and adjacent fragments are connected by connecting peptides.

[0020] As a further technical solution, the amino acid sequence of the connecting peptide is GGAGGG.

[0021] As a further technical solution, the fusion protein comprises 2 repeating units.

[0022] In a second aspect, the present invention provides a biomaterial, wherein the biomaterial is selected from any one of ac:

[0023] a. nucleotides, comprising a nucleotide sequence encoding the fusion protein;

[0024] b. a vector carrying the nucleotides in a;

[0025] c. A cell, which carries the nucleotide in a, or contains the vector in b, or expresses the fusion protein.

[0026] As a further technical solution, the nucleotide sequence of the nucleotide is shown in SEQ ID NO.7.

[0027] In a third aspect, the present invention provides the use of the above fusion protein in distinguishing BCG vaccine immunization and natural infection of Mycobacterium tuberculosis.

[0028] In a fourth aspect, the present invention provides a reagent comprising the fusion protein.

[0029] In a fifth aspect, the present invention provides an ELISA kit, comprising the fusion protein, an ELISA plate, a washing solution and a fluorescently labeled anti-bovine IgM antibody or a fluorescently labeled anti-bovine IgG antibody; preferably, the fluorescent label is CY5 or CY3.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] The present invention uses immunoinformatics software to predict antigenic sites of ESAT6, CFP10 and Rv3615c proteins, fuses the obtained antigenic sites, and obtains fusion proteins. The fusion protein has high antigenic specificity, and can distinguish BCG vaccine immunity and naturally infected Mycobacterium tuberculosis by skin test detection, ELISA detection or in vitro IFN-γ detection, and the detection sensitivity and specificity are high. In addition, by repeatedly fusing the obtained antigenic sites, the sensitivity of the fusion protein can be significantly improved. DETAILED DESCRIPTION

[0032] The embodiments of the present invention will be described in detail below in conjunction with the embodiments and examples, but it will be appreciated by those skilled in the art that the following embodiments and examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. If specific conditions are not specified, proceed according to normal conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0033] In a first aspect, the present invention provides a fusion protein comprising an Rv3615c-1 fragment and an Rv3615c-2 fragment;

[0034] The amino acid sequence of the Rv3615c-1 fragment is shown as SEQ ID NO.5 or a sequence having at least 90% homology with the sequence; the amino acid sequence of the Rv3615c-2 fragment is shown as SEQ ID NO.6 or a sequence having at least 90% homology with the sequence.

[0035] The sequence shown in SEQ ID NO.5 is as follows:

[0036] TVQPERLGVLASHHDNAAVD(SEQ ID NO.5);

[0037] The sequence shown in SEQ ID NO.6 is as follows:

[0038] RIAAKIYSEADEAWRKAIDG (SEQ ID NO. 6).

[0039] The present invention uses immunoinformatics software to predict antigenic sites of Rv3615c protein, fuses the obtained antigenic sites, and obtains fusion protein. The fusion protein has high antigenic specificity, and can distinguish BCG vaccine immunity and natural infection of Mycobacterium tuberculosis by skin test detection, ELISA detection or in vitro IFN-γ detection, and the detection sensitivity and specificity are high. In addition, by repeatedly fusing the obtained antigenic sites, the sensitivity of the fusion protein can be significantly improved.

[0040] In some optional embodiments, the Rv3615c-1 fragment and the Rv3615c-2 fragment are connected by a connecting peptide.

[0041] In some optional embodiments, the fusion protein comprises at least one repeating unit, and adjacent repeating units are connected by a connecting peptide;

[0042] The repeating unit comprises an Rv3615c-1 fragment and an Rv3615c-2 fragment, and adjacent fragments are connected by a connecting peptide;

[0043] The inventors have found that when the number of repeating units of the fusion protein is 1-3, it can effectively distinguish cattle immunized with BCG vaccine from cattle naturally infected.

[0044] In some optional embodiments, the fusion protein comprises at least one repeating unit, and adjacent repeating units are connected by a connecting peptide;

[0045] The repeating unit is mainly composed of an ESAT6-1 fragment, an ESAT6-2 fragment, a CFP10-1 fragment, a CFP10-2 fragment, an Rv3615c-1 fragment and an Rv3615c-2 fragment, and adjacent fragments are connected by a connecting peptide;

[0046] The amino acid sequence of the ESAT6-1 fragment is shown in SEQ ID NO.1 or a sequence having at least 90% homology thereto; the sequence shown in SEQ ID NO.1 is as follows:

[0047] SLLDEGKQSLTKLAAAWGGSGSEAY(SEQ ID NO.1);

[0048] The amino acid sequence of the ESAT6-2 fragment is shown in SEQ ID NO.2 or a sequence having at least 90% homology thereto; the sequence shown in SEQ ID NO.2 is as follows:

[0049] SGSEAYQGVQQKWDATATEL(SEQ ID NO.2);

[0050] The amino acid sequence of the CFP10-1 fragment is shown in SEQ ID NO.3 or a sequence having at least 90% homology thereto; the sequence shown in SEQ ID NO.3 is as follows:

[0051] LAQEAGNFERISGDLKTQID(SEQ ID NO.3);

[0052] The amino acid sequence of the CFP10-2 fragment is shown in SEQ ID NO.4 or a sequence having at least 90% homology thereto. The sequence shown in SEQ ID NO.4 is as follows:

[0053] VQYSRADEEQQQALSSQMGF(SEQ ID NO.4);

[0054] The present invention also predicts antigenic sites for ESAT6 and CFP10 proteins, fuses the obtained antigenic sites with the Rv3615c antigenic sites, and obtains fusion proteins. The fusion protein has high antigenic specificity, and can distinguish BCG vaccine immunity and naturally infected Mycobacterium tuberculosis by skin test detection, ELISA detection or in vitro IFN-γ detection, and the detection sensitivity and specificity are high. In addition, by repeatedly fusing the obtained antigenic sites, the sensitivity of the fusion protein can be significantly improved.

[0055] In some optional embodiments, the repeating unit is composed of ESAT6-1 fragment, ESAT6-2 fragment, CFP10-1 fragment, CFP10-2 fragment, Rv3615c-1 fragment and Rv3615c-2 fragment connected in series from N-terminus to C-terminus, and adjacent fragments are connected by connecting peptides.

[0056] The inventors have found that fusion proteins with different fragments (ESAT6-1 fragment, ESAT6-2 fragment, CFP10-1 fragment, CFP10-2 fragment, Rv3615c-1 fragment and Rv3615c-2 fragment) connected in different orders can effectively distinguish cattle immunized with BCG vaccine from naturally infected cattle. Among them, the fusion protein composed of ESAT6-1 fragment, ESAT6-2 fragment, CFP10-1 fragment, CFP10-2 fragment, Rv3615c-1 fragment and Rv3615c-2 fragment connected in sequence has the best detection sensitivity and specificity.

[0057] In some optional embodiments, the amino acid sequence of the connecting peptide is GGAGGG.

[0058] In some optional embodiments, the fusion protein comprises 2 repeating units.

[0059] The inventors have found that when the number of repeating units of the fusion protein is 1-3, it can effectively distinguish cattle immunized with BCG vaccine from cattle naturally infected, and when the number of repeating units is 2, the sensitivity and specificity of the detection are optimal.

[0060] In some optional embodiments, from N-terminus to C-terminus, the composition of the fusion protein is as follows:

[0061] ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2+lin ker+ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2.

[0062] The fusion protein has high antigenic specificity and is more sensitive and specific for identification of BCG vaccine immunization and naturally infected Mycobacterium tuberculosis.

[0063] In a second aspect, the present invention provides a biomaterial, wherein the biomaterial is selected from any one of ac:

[0064] a. nucleotides, comprising a nucleotide sequence encoding the fusion protein;

[0065] b. a vector carrying the nucleotides in a;

[0066] c. A cell, which carries the nucleotide in a, or contains the vector in b, or expresses the fusion protein.

[0067] In some optional embodiments, the nucleotide sequence of the nucleotide is shown in SEQ ID NO.8:

[0068] TCCCTCCTTGACGAGGGGAAGCAGTCCCTGACCAAGCTCGCAGCGGCCTGGGGCGGTAGCGGTTCGGAGGCGTACGGAGGGAGCGGTTCGGAGGCGTACCAGGGTGTCCAGCAAAAATGGGACGCCACGGCTACCGAGCTGGGAGGGCTCGCGCAGGAGGCAGGTAATTTCGAGCGGATCTCCGGCGACCTGAAAACCCAGATCGACGGAGGGGTCCAATACTCGAGGGCCGACGAGGAGCAGCAGCAGGCGCTGTCCTCGCAAATGGGCTTCGGAGGGACCGTCCAGCCCGAGCGTCTCGGTGTACTGGCGTCGCACCATGACAACGCGGCGGTCGATGGAGGGCGAATTGCGGCGAAGATATATAGCGAGGCCGACGAAGCGTGGCGCAAGGCTATCGACGGGGGAGGGTCCCTCCTTGACGAGGGGAAGCAGTCCCTGACCAAGCTCGCAGCGGCCTGGGGCGGTAGCGGTTCGGAGGCGTACGGAGGGAGCGGTTCGGAGGCGTACCAGGGTGTCCAGCAAAAATGGGACGCCACGGCTACCGAGCTGGGAGGGCTCGCGCAGGAGGCAGGTAATTTCGAGCGGATCTCCGGCGACCTGAAAACCCAGATCGACGGAGGGGTCCAATACTCGAGGGCCGACGAGGAGCAGCAGCAGGCGCTGTCCTCGCAAATGGGCTTCGGAGGGACCGTCCAGCCCGAGCGTCTCGGTGTACTGGCGTCGCACCATGACAACGCGGCGGTCGATGGAGGGCGAATTGCGGCGAAGATATATAGCGAGGCCGACGAAGCGTGGCGCAAGGCTATCGACGGG(SEQ ID NO.8).

[0069] In some alternative embodiments, the nucleotide sequence of the nucleotide is as shown in SEQ ID NO.7:

[0070] (SEQ ID NO.7).

[0071] The sequence was obtained by optimizing the nucleic acid sequence using cattle as the host.

[0072] In a third aspect, the present invention provides the use of the above fusion protein in distinguishing BCG vaccine immunization and natural infection of Mycobacterium tuberculosis.

[0073] The fusion protein provided by the present invention has high antigenic specificity, and can realize the identification of BCG vaccine immunity and natural infection of Mycobacterium tuberculosis by skin test detection, ELISA detection or in vitro IFN-γ detection, and the detection sensitivity and specificity are high.

[0074] In a fourth aspect, the present invention provides a reagent comprising the fusion protein.

[0075] This reagent can be used for skin test detection, and the results of the skin test can be used to distinguish between BCG vaccine immunity and natural infection with Mycobacterium tuberculosis.

[0076] In a fifth aspect, the present invention provides an ELISA kit, comprising the fusion protein, an ELISA plate, a washing solution, and a fluorescently labeled anti-bovine IgM antibody or a fluorescently labeled anti-bovine IgG antibody.

[0077] The kit uses the fusion protein provided by the invention to coat an ELISA plate, and uses a fluorescently labeled anti-bovine IgM antibody or a fluorescently labeled anti-bovine IgG antibody as a secondary antibody for identification of BCG vaccine immunization and naturally infected Mycobacterium tuberculosis.

[0078] In some optional embodiments, the fluorescent marker includes but is not limited to CY5 or CY3, or other markers known to those skilled in the art.

[0079] The present invention is further described below by means of specific examples. However, it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0080] Example 1

[0081] 1 Antigenic site selection

[0082] Through preliminary experiments, six optimized antigenic sites of ESAT6, CFP10, and Rv3615c were selected, which are:

[0083] ESAT6-1:SLLDEGKQSLTKLAAAWGGSGSEAY(SEQ ID NO.1);

[0084] ESAT6-2:SGSEAYQGVQQKWDATATEL(SEQ ID NO.2);

[0085] CFP10-1:LAQEAGNFERISGDLKTQID(SEQ ID NO.3);

[0086] CFP10-2: VQYSRADEEQQQALSSQMGF (SEQ ID NO.4);

[0087] Rv3615c-1: TVQPERLGVLASHHDNAAVD (SEQ ID NO.5);

[0088] Rv3615c-2: RIAAKIYSEADEAWRKAIDG (SEQ ID NO. 6).

[0089] 2 Antigen sequence optimization

[0090] The three proteins were combined by tandem expression, specifically: ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2+linker+ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2. The amino acid sequence of linker is GGAGGG (SEQ ID NO.16).

[0091] The nucleic acid sequence was optimized using cattle as the host, and the optimized sequence was:

[0092] TCCTTGCTCGACGAAGGCAAGCAATCCCTTACTAAATTGGCCGCGGCATGGGGGGGGAGTGGCAGCGAAGCCTACGGGGGCTCAGGATCCGAGGCTTACCAAGGGGTCCAGCAGAAGTGGGATGCAACCGCCACGGAGCTGGGCGGTTTGGCTCAAGAGGCCGGTAACTTTGAGCGGATATCCGGCGACCTGAAAACACAGATTGACGGCGGGGTGCAATACAGCAGAGCCGACGAAGAACAGCAGCAGGCTCTTTCCAGCCAAATGGGCTTCGGAGGCACCGTTCAGCCCGAGAGGCTTGGAGTCCTGGCCTCACATCACGACAACGCTGCCGTGGACGGCGGAAGGATTGCGGCCAAGATCTATTCCGAAGCTGACGAAGCTTGGCGCAAAGCAATCGACGGAGGAGGGTCACTCCTCGATGAGGGAAAGCAGTCCCTCACTAAGTTGGCGGCCGCTTGGGGCGGCTCTGGTTCTGAGGCTTATGGAGGAAGCGGATCAGAGGCATACCAGGGTGTGCAACAGAAGTGGGACGCCACCGCTACAGAACTGGGCGGGTTGGCTCAAGAGGCCGGCAACTTTGAGCGCATCTCTGGGGACCTGAAGACCCAGATAGACGGAGGGGTGCAGTACTCCAGAGCAGACGAGGAGCAGCAGCAGGCCCTCAGCTCACAGATGGGGTTCGGCGGGACAGTGCAGCCTGAACGGCTTGGCGTCCTCGCCTCCCACCACGATAACGCCGCAGTGGATGGGGGGCGCATTGCCGCCAAAATCTATAGCGAAGCTGATGAGGCTTGGAGGAAGGCCATTGACGGT(SEQ ID NO.7).

[0093] Construction of the strain expressing the 3 tandem fusion protein:

[0094] The optimized sequence was sent to Sangon Biotech (Shanghai) Co., Ltd. for gene synthesis, and the synthetic gene sequence was cloned into the expression plasmid pET-28a, and the plasmid was transformed into BL21 (DE3) competent cells, and the recombinant expression strain BL21-2ECRv was obtained after plating. The recombinant strain BL21-2ECRv was inoculated with LB medium to induce the fusion protein, which was recorded as BL21-2ECRv.

[0095] 4. Establishment of ELISA detection method:

[0096] The purified BL21-2ECRv fusion protein was coated on the ELISA plate, and the anti-bovine IgM antibody was labeled with CY5, and the anti-bovine IgG antibody was labeled with CY3 to obtain the fluorescent labeled secondary antibody. The fusion protein, the serum to be tested, and the fluorescent labeled secondary antibody working concentration were optimized to establish the detection method of the two antibodies. The protein coating concentration was determined to be 100-200 ng / well, the serum dilution was 1:200 times, the CY5 labeled IgM secondary antibody dilution was 1:8000, the CY3 labeled IgG secondary antibody dilution was 1:10000, and P / N≧2.1 was judged as positive.

[0097] 5. Establishment of intradermal allergy method:

[0098] The fusion protein BL21-2ECRv was diluted into working solutions of different concentrations and injected into tuberculosis-positive cattle. The skin wrinkle thickness was measured 72 hours after injection. The protein concentration greater than or equal to 4 mm was the optimal fusion protein concentration. The concentration of fusion protein BL21-2ECRv was determined to be 5-20 μg / 0.1 ml.

[0099] Example 2

[0100] The difference from Example 1 is that the antigen is a non-repeating unit fusion protein composed of ESAT6-1 fragment, ESAT6-2 fragment, CFP10-1 fragment, CFP10-2 fragment, Rv3615c-1 fragment and Rv3615c-2 fragment connected in series, named BL21-ECRv. Specifically: ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2.

[0101] Example 3

[0102] The difference from Example 1 is that the antigen is a 2-repeat unit fusion protein composed of Rv3615c-1 fragment, Rv3615c-2 fragment, CFP10-1 fragment, CFP10-2 fragment, ESAT6-1 fragment and ESAT6-2 fragment connected in series, named BL21-2RvCE. Specifically: Rv3615c-1+linker+Rv3615c-2+linker+CFP10-1+linker+CFP10-2+linker+ESAT 6-1+linker+ESAT6-2+linker+Rv3615c-1+linker+Rv3615c-2+linker+CFP10-1+linker+CFP10-2+linker+ESAT6-1+linker+ESAT6-2.

[0103] Example 4

[0104] The difference from Example 1 is that the antigen is a three-repeat unit fusion protein composed of ESAT6-1 fragment, ESAT6-2 fragment, CFP10-1 fragment, CFP10-2 fragment, Rv3615c-1 fragment and Rv3615c-2 fragment in series, named BL21-3ECRv. Specifically: ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2+linker+ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2+

[0105] linker+ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2.

[0106] Example 5

[0107] The difference from Example 1 is that the antigen is a 2-repeat unit fusion protein composed of a CFP10-1 fragment, an ESAT6-1 fragment, an ESAT6-2 fragment, a CFP10-2 fragment, an Rv3615c-2 fragment and an Rv3615c-1 fragment randomly connected in series, and is named BL21-2CERv. Specifically: CFP10-1+linker+ESAT6-1+linker+ESAT6-2+linker+CFP10-2+linker+Rv3615c-2+linker+Rv3615c-1+linker+CFP10-1+linker+ESAT6-1+linker+ESAT6-2+linker+CFP10-2+linker+Rv3615c-2+linker+Rv3615c-1.

[0108] Example 6

[0109] The difference from Example 1 is that the antigen is a 2-repeat unit fusion protein composed of Rv3615c-1 fragment and Rv3615c-2 fragment connected in series, named BL21-Rv. Specifically: Rv3615c-1+linker+Rv3615c-2+linker+Rv3615c-1+linker+Rv3615c-2.

[0110] Example 7

[0111] The difference from Example 1 is that the antigen is a 2-repeat unit fusion protein composed of Rv3615c-1 fragment and Rv3615c-2 fragment of different sequences (the amino acid sequences of the two fragments are SEQ ID NO.9 and SEQ ID NO.10, respectively, wherein SEQ ID NO.9 is AVQPERLGVLASHHDNAAVD, which has 95% homology with SEQ ID NO.5; SEQ ID NO.10 is YIAAKIYSEADEAWDKAIDG, which has 90% homology with SEQ ID NO.6) connected in series, and is named BL21-Rv2. Specifically:

[0112] Rv3615c-1+linker+Rv3615c-2+linker+Rv3615c-1+linker+Rv3615c-2.

[0113] Example 8

[0114] The difference from Example 1 is that the antigen is a 2-repeating unit fusion protein composed of CFP10-1 fragments and CFP10-2 fragments of different sequences (the amino acid sequences of the two fragments are SEQ ID NO.11 and SEQ ID NO.12, wherein SEQ ID NO.11 is LAQEAGNFERISGDLKTAID, which has 95% homology with SEQ ID NO.3, and SEQ ID NO.12 is VQYSRADEEQQQALSSQMQF, which has 95% homology with SEQ ID NO.4), Rv3615c-1 fragment and Rv3615c-2 fragment (the amino acid sequences of the two fragments are SEQ ID NO.9 and SEQ ID NO.10, respectively), which are connected in series in sequence and are named BL21-CRv2. Specifically:

[0115] CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2+linker+CFP10-1+linker+CFP10-2+linker+Rv3615c-1+linker+Rv3615c-2.

[0116] Example 9

[0117] The difference from Example 1 is that the antigen is a fusion protein composed of Rv3615c-1 fragment and Rv3615c-2 fragment connected in series, named BL21-Rv3. Specifically: Rv3615c-1+linker+Rv3615c-2+linker+Rv3615c-1+linker+Rv3615c-2+linker+Rv3615c-1+linker+Rv3615c-2.

[0118] Comparative Example 1

[0119] The difference from Example 1 is that the antigen is a fusion protein of two repeating units composed of ESAT6+CFP10+Rv3615c connected in series, named BL21-qECR, specifically: ESAT6+linker+CFP10+linker+Rv3615c.

[0120] Among them, the nucleotide sequence of ESAT6 is as follows:

[0121] ATGACAGAGCAGCAGTGGAATTTCGCGGGTATCGAGGCCGCGGC

[0122] AAGCGCAATCCAGGGAAATGTCACGTCCATTCATTCCCTCCTTGACGA

[0123] GGGGAAGCAGTCCCTGACCAAGCTCGCAGCGGCCTGGGGCGGTAGC

[0124] GGTTCGGAGGCGTACCAGGGTGTCCAGCAAAAATGGGACGCCACGG

[0125] CTACCGAGCTGAACAACGCGCTGCAGAACCTGGCGCGGACGATCAGC

[0126] GAAGCCGGTCAGGCAATGGCTTCGACCGAAGGCAACGTCACTGGGAT

[0127] GTTCGCA (SEQ ID NO.13).

[0128] The nucleotide sequence of CFP10 is as follows:

[0129] ATGGCAGAGATGAAGACCGATGCCGCTACCCTCGCGCAGGAGGC

[0130] AGGTAATTTCGAGCGGATCTCCGGCGACCTGAAAACCCAGATCGACC

[0131] AGGTGGAGTCGACGGCAGGTTCGTTGCAGGGCCAGTGGCGCGGCGC

[0132] GGCGGGGACGGCCGCCCAGGCCGCGGTGGTGCGCTTCCAAGAAGCA

[0133] GCCAATAAGCAGAAGCAGGAACTCGACGAGATCTCGACGAATATTCG

[0134] TCAGGCCGGCGTCCAATACTCGAGGGCCGACGAGGAGCAGCAGCAG

[0135] GCGCTGTCCTCGCAAATGGGCTTC (SEQ ID NO.14).

[0136] The nucleotide sequence of Rv3615c is as follows:

[0137] ATGACGGAAAACTTGACCGTCCAGCCCGAGCGTCTCGGTGTACT

[0138] GGCGTCGCACCATGACAACGCGGCGGTCGATGCCTCCTCGGGCGTCG

[0139] AAGCTGCCGCTGGCCTAGGCGAATCTGTGGCGATCACTCACGGTCCGT

[0140] ACTGCTCACAGTTCAACGACACGTTAAATGTGTACTTGACTGCCCACA

[0141] ATGCCCTGGGCTCGTCCTTGCATACGGCCGGTGTCGATCTCGCCAAAA

[0142] GTCTTCGAATTGCGGCGAAGATATATAGCGAGGCCGACGAAGCGTGG

[0143] CGCAAGGCTATCGACGGGTTGTTTACCTGA (SEQ ID NO. 15).

[0144] Comparative Example 2

[0145] The difference from Example 1 is that the antigen is a non-repeating unit fusion protein composed of ESAT6-1 fragment, ESAT6-2 fragment, CFP10-1 fragment and CFP10-2 fragment connected in series, named BL21-2EC. Specifically:

[0146] ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2+linker+

[0147] ESAT6-1+linker+ESAT6-2+linker+CFP10-1+linker+CFP10-2.

[0148] Test Example 1

[0149] Fifteen suspected tuberculosis cattle, 20 healthy cattle and 50 cattle vaccinated with BCG vaccine were tested using the ELISA method and skin test method established with BL21-2ECRv protein.

[0150] ELISA test:

[0151] The venous blood of cattle was collected from the jugular vein, and the serum was collected by centrifugation after the blood coagulated, and the ELISA was established for detection. The specific process was as follows: the fusion protein was diluted with carbonate buffer (pH 9.6) to a concentration of 1 μg / ml, and then 100 μl / well was coated on the ELISA plate at 4°C overnight, the coating solution was discarded, and the plate was blocked with 1% BSA solution, incubated at 37°C for 2 hours, and washed twice with PBST; 100 μl of the serum to be tested diluted 1:200 was added to each well, incubated at 37°C for 30 minutes, the serum was discarded, and the plate was washed 4 times with PBST; 100 μl of the secondary antibody labeled with CY3 and CY5 mixed in a ratio of 1:1 was added to each well, incubated at 37°C for 45 minutes, the secondary antibody was discarded, and the plate was washed 4 times with PBST; the values ​​were read at wavelengths of 550 nm and 650 nm, respectively, and the results are shown in Table 1. The results showed that, for 15 suspected tuberculosis cattle, the ELISA method established by the present invention was used to detect IgM and IgG, and 14 (typical tuberculosis nodules after autopsy) were positive, and 1 (no lesions after autopsy) was negative, and the test results were consistent with the clinical autopsy results, with a sensitivity of 100%; 20 negative cattle were all negative in ELISA, with a specificity of 100%; among the 50 cattle vaccinated with BCG vaccine, 50 were negative for IgM antibody, 49 were negative for IgG antibody, and 1 was positive, with a specificity of 98%. It can be seen that, with BL21-2ECRv as the antigen, ELISA detection can effectively distinguish between cattle immunized with BCG vaccine and cattle naturally infected.

[0152] Table 1 ELISA detection of BL21-2ECRv fusion protein

[0153]

[0154] Note: “+” indicates positive; “±” indicates suspected; “-” indicates negative.

[0155] Intradermal allergy testing:

[0156] Intradermal injection was performed in the neck of cattle, 100 μl was injected intradermally for each cattle, 10 μg / head, 72 hours after injection, the skin wrinkle thickness at the injection site was measured with a vernier caliper, and it was determined to be positive if it was greater than or equal to 4 mm, and the results are shown in Table 2. Among the 15 suspected tuberculosis cattle, 14 (with typical tuberculosis nodules after autopsy) had a skin wrinkle difference greater than 4 mm before and after injection, and the results were positive, and 1 had a skin wrinkle difference less than 2 mm before and after injection, and the result was negative. The test results were consistent with the clinical autopsy results, with a sensitivity of 100%; among the 20 healthy cattle, 20 had a skin wrinkle difference less than 2 mm before and after injection, and the specificity was 100%. Among the 50 cattle vaccinated with BCG vaccine, 49 had a skin wrinkle difference less than 2 mm before and after injection, and 1 had a skin wrinkle thickness of 3 mm before and after injection, with a specificity of 98%.

[0157] Table 2 BL21-2ECRv fusion protein skin test detection

[0158]

[0159] Note: “+” indicates positive; “±” indicates suspected; “-” indicates negative.

[0160] Test Example 2

[0161] The cattle in Experimental Example 1 were divided into groups and tested by ELISA and skin test using fusion proteins BL21-ECRv, BL21-2ECRv and BL21-3ECRv with different repetition times. The results are shown in Tables 3 and 4.

[0162] Table 3 ELISA detection of fusion proteins with different repetition times

[0163]

[0164] Note: “+” indicates positive; “±” indicates suspected; “-” indicates negative.

[0165] The results showed that for 15 suspected tuberculosis cattle, the ELISA method of BL21-ECRv protein, BL21-2ECRv protein and BL21-3ECRv protein was used for IgM and IgG detection. The sensitivity of BL21-ECRv protein detection was 85.7%, 100% and 92.8% respectively; for 20 negative cattle, the specificity of BL21-ECRv protein, BL21-2ECRv protein and BL21-3ECRv protein detection was 100%; among 50 cattle vaccinated with BCG vaccine, the specificity of BL21-ECRv protein, BL21-2ECRv protein and BL21-3ECRv protein detection was 98%. It can be seen that using it as an antigen, ELISA detection can effectively distinguish cattle immunized with BCG vaccine from cattle naturally infected.

[0166] Table 4 Fusion protein skin test detection with different repetition times

[0167]

[0168]

[0169] Note: “+” indicates positive, with a skin thickness difference of ≧4mm; “±” indicates suspected, with a skin thickness difference of 4mm≦ / ≧2mm; “-” indicates negative, with a skin thickness difference of 2mm≧.

[0170] For 15 suspected tuberculosis cattle, BL21-ECRv protein, BL21-2ECRv protein and BL21-3ECRv protein skin test were used for detection. The sensitivity of BL21-ECRv protein detection was 85.7%, 100% and 92.8% respectively. For 20 negative cattle, the specificity of BL21-ECRv protein, BL21-2ECRv egg and BL21-3ECRv protein detection was 100%. Among the 50 cattle vaccinated with BCG vaccine, the specificity of BL21-ECRv protein, BL21-2ECRv egg and BL21-3ECRv protein skin test was 98%. It can be seen that skin test can effectively distinguish cattle immunized with BCG vaccine from cattle naturally infected by using it as antigen.

[0171] Test Example 3

[0172] The cattle were divided into groups according to Experimental Example 1, and tested by ELISA and skin test using fusion proteins of different sequences, BL21-2ECRv, BL21-2RvCE and BL21-2CERv. The results are shown in Tables 5 and 6.

[0173] Table 5 ELISA detection of fusion proteins in different sequences

[0174]

[0175] Note: “+” indicates positive; “±” indicates suspected; “-” indicates negative.

[0176] The results showed that for 15 suspected tuberculosis cattle, ELISA was performed using BL21-2ECRv protein, BL21-2RvCE protein and BL21-2CERv protein. The sensitivity of BL21-2ECRv protein detection was 100%, the sensitivity of BL21-2RvCE protein detection was 92.8%, and the sensitivity of BL21-2CERv protein detection was 100% (IgG) and 92.8% (IgM); in 20 negative cattle, the specificity of BL21-2ECRv protein, BL21-2RvCE protein and BL21-2CERv protein detection was 100%; in 50 cattle vaccinated with BCG vaccine, the specificity of BL21-2ECRv protein, BL21-2RvCE protein and BL21-2CERv protein detection was 98%. It can be seen that using it as an antigen, ELISA detection can effectively distinguish between cattle immunized with BCG vaccine and cattle naturally infected.

[0177] Table 6 Skin test detection of fusion proteins in different sequences

[0178]

[0179] Note: “+” indicates positive, with a skin thickness difference of ≧4mm; “±” indicates suspected, with a skin thickness difference of 4mm≦ / ≧2mm; “-” indicates negative, with a skin thickness difference of 2mm≧.

[0180] The results showed that for 15 suspected tuberculosis cattle, the BL21-2ECRv protein, BL21-2RvCE protein and BL21-2CERv protein skin test methods were used for detection. The sensitivity of BL21-2ECRv protein detection was 100%, the sensitivity of BL21-2RvCE protein detection was 92.8%, and the sensitivity of BL21-2CERv protein detection was 87.5%; for 20 negative cattle, the specificity of BL21-2ECRv protein, BL21-2RvCE protein and BL21-2CERv protein skin test detection was 100%; among the 50 cattle vaccinated with BCG vaccine, the specificity of BL21-2ECRv protein skin test detection was 98%, and the specificity of BL21-2CERv protein and BL21-2RvCE protein detection was 96%. It can be seen that using it as an antigen, skin test detection can effectively distinguish BCG vaccine-immunized cattle from naturally infected cattle.

[0181] Test Example 4

[0182] The cattle were divided into groups according to Experimental Example 1, and tested by ELISA and skin test using fusion proteins BL21-Rv, BL21-Rv2, BL21-CRv2 and BL21-Rv3, respectively. The results are shown in Tables 7 and 8.

[0183] Table 7 ELISA detection of different fusion proteins

[0184]

[0185] Note: “+” indicates positive; “±” indicates suspected; “-” indicates negative.

[0186] The results showed that for 15 suspected tuberculosis cattle, ELISA method was used to detect BL21-Rv protein, BL21-Rv2 protein, BL21-CRv2 protein and BL21-Rv3 protein. The detection sensitivity of BL21-Rv protein was 92.8% (IgG) and 100% (IgM), and the detection sensitivity of BL21-Rv2 protein, BL21-CRv2 protein and BL21-Rv3 protein was 92.8%; among 20 negative cattle, the detection specificity of BL21-Rv protein was 100%, and the detection specificity of BL21-Rv2 protein, BL21-CRv2 protein and BL21-Rv3 protein was 95% (IgM) and 100% (IgG); among 50 cattle vaccinated with BCG vaccine, the detection specificity of BL21-Rv protein, BL21-Rv2 protein, BL21-CRv2 protein and BL21-Rv3 protein was 98%. It can be seen that using it as an antigen, ELISA testing can meet the needs of distinguishing cattle immunized with BCG vaccine from naturally infected cattle.

[0187] Table 8 Skin test detection of different fusion proteins

[0188]

[0189]

[0190] Note: “+” indicates positive, with a skin thickness difference of ≧4mm; “±” indicates suspected, with a skin thickness difference of 4mm≦ / ≧2mm; “-” indicates negative, with a skin thickness difference of 2mm≧.

[0191] The results showed that for 15 suspected tuberculosis cattle, the BL21-Rv protein, BL21-Rv2 protein, BL21-CRv2 protein and BL21-Rv3 skin test methods were used for detection. The sensitivity of BL21-Rv protein detection was 92.8%, the sensitivity of BL21-Rv2 protein and BL21-Rv3 detection was 92.8%, and the sensitivity of BL21-2CERv protein detection was 87.5%; for 20 negative cattle, the specificity of BL21-Rv protein skin test detection was 100%, and the specificity of BL21-Rv2 protein, BL21-CRv2 and BL21-Rv3 protein detection was 95%; among the 50 cattle vaccinated with BCG vaccine, the specificity of BL21-Rv protein, BL21-Rv2 and BL21-Rv3 protein skin test detection was 96%, and the specificity of BL21-CRv2 protein detection was 94%. It can be seen that using it as an antigen, skin test detection can meet the needs of distinguishing cattle immunized with BCG vaccine from naturally infected cattle.

[0192] Comparative test data of test example 5 and prior art

[0193] A total of 200 cattle were randomly selected from a bovine tuberculosis infected farm, of which 100 were immunized with BCG vaccine, subcutaneously via the neck, with 1×10 6 CFU / head, and the remaining 100 cattle were not treated in any way. 60 days after vaccination, the antibodies in the sera of all cattle were detected using a commercially available ELISA kit and an ELISA kit established by the present invention, respectively. Skin allergy and in vitro IFN-γ detection were performed using commercially available bovine tuberculin PPD-B, BL21-2ECRv prepared by the present invention, fusion protein qECR (ESAT6, CFP10, Rv3615c fusion expression) without sequence antigen site optimization, and fusion protein 2EC (ESAT6, CFP10) not containing Rv3615c. The results are shown in Table 9.

[0194] Table 9 Number of positive and negative cattle detected by different detection methods

[0195]

[0196] Note: “+” indicates positive; “±” indicates suspected; “-” indicates negative.

[0197] The test data show that the tandem fusion protein BL21-2ECRv constructed in the present invention can effectively distinguish between BCG vaccine immunity and natural infection, and the distinction efficiency is significantly better than the currently used detection methods.

[0198] The antibodies were detected by ELISA method. Among 100 cattle immunized with BCG vaccine, 100 were positive by commercial ELISA kits, 99 were negative by ELISA (BL21-2ECRv) method established by the present invention, 97 were negative by fusion protein qECR without optimization, and 96 were negative by fusion protein 2EC without Rv3615c; among 100 cattle not immunized with BCG, 22 were positive by commercial ELISA kits (16 had typical tuberculosis nodules after autopsy), 17 were positive by ELISA (BL21-2ECRv) method established by the present invention (16 had typical tuberculosis nodules after autopsy), 19 were positive by fusion protein qECR without optimization (16 had typical tuberculosis nodules after autopsy), and 18 were positive by fusion protein 2EC without Rv3615c (16 had typical tuberculosis nodules after autopsy). The ELISA products sold on the market can accurately detect immune antibodies and infection antibodies, but cannot distinguish between vaccine immunization and natural infection. The unoptimized fusion protein qECR and the fusion protein 2EC without Rv3615c can distinguish between vaccine immunity and natural infection, but the accuracy is insufficient. The ELISA (BL21-2ECRv) method established by the present invention can accurately detect infection antibodies, effectively distinguish between vaccine immunity and natural infection, and has a sensitivity (number of positive samples detected / (number of positive samples-false positives)×100%) of 100% and a specificity (number of negative samples detected / (negative-false negatives)×100%) of 99%.

[0199] Skin allergy test: among 100 cattle immunized with BCG vaccine, 98 were positive by commercial PPD-B test, 1 was positive by BL21-2ECRv test established by the present invention, 5 were positive by unoptimized fusion protein qECR test, and 5 were positive by fusion protein 2EC test without Rv3615c. Among 100 non-immunized cattle, 21 were positive by commercial PPD-B test (16 had typical tuberculosis nodules after autopsy), 1 was positive by BL21-2ECRv test established by the present invention, 16 heads were tested positive (16 had typical tuberculosis nodules after autopsy), 18 heads were tested positive without optimizing the fusion protein qECR (16 had typical tuberculosis nodules after autopsy), and 19 heads were tested positive without the fusion protein 2EC containing Rv3615c (16 had typical tuberculosis nodules after autopsy); the prior art PPD-B cannot distinguish between vaccine immunity and natural infection, and the fusion protein qECR that is not optimized and the fusion protein 2EC that does not contain Rv3615c have a certain degree of misjudgment and omission. The BL21-2ECRv skin allergy test established by the present invention has a specificity of 99% and a sensitivity of 100%, which can effectively distinguish between vaccine immunity and natural infection.

[0200] In the IFN-γ test, among 100 cattle immunized with BCG vaccine, 100 were positive for the commercially available PPD-B test, 0 were positive for the BL21-2ECRv established by the present invention, 7 were positive for the unoptimized fusion protein ECR test, and 3 were positive for the fusion protein 2EC that did not contain Rv3615c; among 100 non-immunized cattle, 23 were positive for the commercially available PPD-B test (16 had typical tuberculosis nodules after autopsy), 16 were positive for the BL21-2ECRv established by the present invention (16 had typical tuberculosis nodules after autopsy), 19 were positive for the unoptimized fusion protein qECR test (16 had typical tuberculosis nodules after autopsy), and 18 were positive for the fusion protein 2EC that did not contain Rv3615c (16 had typical tuberculosis nodules after autopsy).

[0201] It can be seen that the prior art PPD-B cannot distinguish between vaccine immunity and natural infection, and the two methods without optimizing qECR and fusion protein 2EC2 that do not contain Rv3615c have a certain degree of misjudgment and missed detection. The BL21-2ECRv in vitro IFN-γ detection established by the present invention has a specificity of 100% and a sensitivity of 100%, which can effectively distinguish between vaccine immunity and natural infection.

[0202] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A fusion protein, characterized in that The fusion protein comprises Rv3615c-1 fragment and Rv3615c-2 fragment; The amino acid sequence of the Rv3615c-1 fragment is shown as SEQ ID NO.5 or a sequence having at least 90% homology with the sequence; the amino acid sequence of the Rv3615c-2 fragment is shown as SEQ ID NO.6 or a sequence having at least 90% homology with the sequence.

2. The fusion protein according to claim 1, characterized in that The fusion protein comprises at least one repeating unit, and adjacent repeating units are connected by a connecting peptide; The repeating unit is mainly composed of an ESAT6-1 fragment, an ESAT6-2 fragment, a CFP10-1 fragment, a CFP10-2 fragment, an Rv3615c-1 fragment and an Rv3615c-2 fragment, and adjacent fragments are connected by a connecting peptide; The amino acid sequence of the ESAT6-1 fragment is shown in SEQ ID NO. 1 or a sequence having at least 90% homology thereto; The amino acid sequence of the ESAT6-2 fragment is shown in SEQ ID NO. 2 or a sequence having at least 90% homology thereto; The amino acid sequence of the CFP10-1 fragment is shown in SEQ ID NO. 3 or a sequence having at least 90% homology thereto; The amino acid sequence of the CFP10-2 fragment is shown in SEQ ID NO. 4 or a sequence having at least 90% homology thereto.

3. The fusion protein according to claim 2, characterized in that The repeating unit is composed of ESAT6-1 fragment, ESAT6-2 fragment, CFP10-1 fragment, CFP10-2 fragment, Rv3615c-1 fragment and Rv3615c-2 fragment in series from N-terminus to C-terminus, and adjacent fragments are connected by connecting peptides.

4. The fusion protein according to claim 2, characterized in that The amino acid sequence of the connecting peptide is GGAGGG.

5. The fusion protein according to claim 2, characterized in that The fusion protein comprises 2 repeating units.

6. Biomaterial, characterized in that The biological material is selected from any one of ac: a. nucleotides, comprising a nucleotide sequence encoding the fusion protein according to any one of claims 1 to 5; b. a vector carrying the nucleotides in a; c. A cell, which carries the nucleotide in a, or contains the vector in b, or expresses the fusion protein according to any one of claims 1 to 5.

7. The biomaterial according to claim 6, characterized in that The nucleotide sequence of the nucleotide is shown in SEQ ID NO.

7.

8. Use of the fusion protein according to any one of claims 1 to 5 in distinguishing BCG vaccine-immunized and naturally infected Mycobacterium tuberculosis.

9. A reagent, characterized in that The invention comprises the fusion protein according to any one of claims 1 to 5.

10. An ELISA kit, characterized in that: The method comprises the fusion protein according to any one of claims 1 to 5, an ELISA plate, a washing solution and a fluorescently labeled anti-bovine IgM antibody or a fluorescently labeled anti-bovine IgG antibody; preferably, the fluorescent label is CY5 or CY3.

Images