Flammulina velutipes variety 'Nongwanjin No.15' and specific molecular marker thereof

Abstract

The invention discloses a flammulina velutipes variety 'Nongwanjin No.15' and a specific molecular marker thereof. The flammulina velutipes is classified and named as flammulina velutipes, the flammulina velutipes is preserved in China General Microbiological Culture Collection Center (CGMCC), the preservation address is No.3, No.1 Yard, Beichen West Road, Chaoyang District, Beijing, the preservation date is November 18, 2024, and the preservation number is CGMCC NO.41600. The flammulina velutipes is named as flammulina velutipes. The flammulina velutipes variety 'Nongwanjin No.15' has the quality characteristics of excellent flammulina velutipes strains, such as moderate and uniform cap size, high per unit yield, relatively uniform stem color and the like, and is unique dark brown, and the defects that the parent 'Nongwanjin No.12' is low per unit yield and the other parent 'TB' is large in cap and easy to open are overcome; the average yield per unit is increased by 28.0% compared with that of the parent Nongwanjin 12.

Description

Technical Field

[0001] The invention belongs to the technical field of Flammulina velutipes, and in particular relates to a Flammulina velutipes variety 'Nong Wan Jin No. 15' and a specific molecular marker thereof. Background Art

[0002] Flammulina velutipes belongs to the phylum Basidiomycetes, class Hymenomycetes, order Agaricales, family Trichoderma, genus Flammulina, and is famous for its smooth cap, crisp stem, rich nutrition, and delicious taste. The output and output value of factory-based cultivation of Flammulina velutipes in my country rank first in the world. Currently, there are two main strains of Flammulina velutipes on the market: yellow and white. Wild Flammulina velutipes are all yellow, and the earliest cultivation of Flammulina velutipes in China was also a yellow variety. The white variety was first introduced from Japan in the 1980s. Due to its high yield and suitability for factory-based cultivation, it occupies the vast majority of the market share. At present, the varieties used by large domestic factory-based enterprises are mainly imported from Japan, which poses a risk of "stuck neck". There was no brown Flammulina velutipes on the market before. The present invention uses a brown wild Flammulina velutipes TB and the main cultivated yellow Flammulina velutipes 'Nong Wan Jin No. 12' for single spore hybridization, and selects a brown Flammulina velutipes variety 'Nong Wan Jin No. 15' for the first time in the world, and develops its specific molecular identification markers. Because the cap color of 'Nong Wanjin No. 15' is unique dark brown, and it has high yield, good taste, and great market promotion potential, it will become a new variety of Flammulina velutipes with great market prospects and commodity value. Summary of the invention

[0003] The purpose of the present invention is to provide a brown Flammulina velutipes variety 'Nong Wan Jin No. 15' with high yield, many buds, neat mushroom bodies, good crispness and unique color and its specific molecular marker to solve the technical problems of yellow Flammulina velutipes used in existing production, such as single variety, monotonous color, low yield, uneven fruiting, and many and twisted side buds.

[0004] To achieve the above object, the present invention adopts the following technical solution: The first aspect of the present invention provides a Flammulina velutipes variety 'Nong Wanjin No. 15', which is classified and named Flammulina velutipes, and is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is November 18, 2024, and the deposit number is CGMCCNO.41600.

[0005] Furthermore, the above-mentioned Flammulina velutipes variety 'Nong Wan Jin No. 15' is bred by hybridization of the parent yellow Flammulina velutipes 'Nong Wan Jin No. 12' and the brown wild Flammulina velutipes 'TB'; the mycelium of the Flammulina velutipes variety 'Nong Wan Jin No. 15' on the PDA culture medium is thick and dense, the colony morphology is round, and the mycelium grows fastest at 25°C; the fruiting body of the Flammulina velutipes variety 'Nong Wan Jin No. 15' at the harvest period has an overall mushroom cap that is dark brown, large, thick, and slimy, a thicker, dark yellowish stipe, a small amount of villi at the base, a tighter mushroom body, and a growth rate that is 4 days faster than the control variety 'Nong Wan Jin No. 12', and better mushroom root adhesion.

[0006] A second aspect of the present invention provides a specific molecular marker fragment for identifying the above-mentioned Flammulina velutipes variety 'Nong Wan Jin No. 15', wherein the specific molecular marker fragments are P21, P22, P23, P24, P26, P28, P29 and P30, and the specific nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQID NO.6, SEQ ID NO.7 and SEQ ID NO.8, respectively.

[0007] Furthermore, the amplification primers for the above-mentioned specific molecular marker fragments are as follows: The amplification primers for the specific molecular marker fragment P21 are: P21-F: GATCTACTTCGTTTGGCGGG; P21-R: CAGCCCATTCATCATCCCAG; The amplification primers for the specific molecular marker fragment P22 are: P22-F: GCTCTGGGTTCTCTTGTCTG; P22-R: TGGGTATCGTCTCGCATTTT; The amplification primers for the specific molecular marker fragment P23 are: P23-F: GGGGTAATCAGCGATGTAGG; P23-R: ATCGGTCAGCACAAGAAACA; The amplification primers for the specific molecular marker fragment P24 are: P24-F: TGGTCTACAAAAAGCGGCAA; P24-R: TGAGTTTCCCACTGGATTGAC; The amplification primers for the specific molecular marker fragment P26 are: P26-F: CAATCGCCCGTTATAGTCCA; P26-R: TCCTGTGGGATTCAACGAAC; The amplification primers for the specific molecular marker fragment P28 are: P28-F: AATCTGCCACGTTTGAGTT; P28-R: TGTCGGTAGGATGTCAGTGT; The amplification primers for the specific molecular marker fragment P29 are: P29-F: TCATTGCCTCTGCTTTCGTT; P29-R: CGTTAGGTGTCGTGCTAGTC; The amplification primers for the specific molecular marker fragment P30 are: P30-F: CAAGAAGATAGCCAGTCCCG; P30-R: GGATGCTTGACTTTGTGTGC.

[0008] The third aspect of the present invention provides the use of the above-mentioned Flammulina velutipes variety 'Nong Wan Jin No. 15' in Flammulina velutipes breeding.

[0009] The fourth aspect of the present invention provides the use of the above-mentioned Flammulina velutipes variety 'Nong Wan Jin No. 15' in food or medicine production.

[0010] The fifth aspect of the present invention provides the use of the above-mentioned specific molecular marker fragment in the identification of Flammulina velutipes varieties.

[0011] The present invention has the following advantages: 1. The average yield of Flammulina velutipes variety 'Nong Wan Jin No. 15' is 447.5g / bottle, while the average yield of the control Flammulina velutipes variety 'Nong Wan Jin No. 12' is 349.5g / bottle. The yield of Flammulina velutipes variety 'Nong Wan Jin No. 15' is 28.0% higher than that of Flammulina velutipes variety 'Nong Wan Jin No. 12', which improves the disadvantage of low yield of its parent Flammulina velutipes variety 'Nong Wan Jin No. 12'. The other parent Flammulina velutipes variety 'TB' has the disadvantages of large cap and easy to open. The cap of Flammulina velutipes variety 'Nong Wan Jin No. 15' is dark brown, hemispherical in shape, with moderate involution of the edge and uniform size, which improves the disadvantage of large cap and easy to open of its parent Flammulina velutipes variety 'TB'. In addition, the stipe of Flammulina velutipes variety 'Nong Wan Jin No. 15' has uniform color, good stipe ratio and few side buds. The growth cycle of the Flammulina velutipes variety 'Nong Wan Jin No. 15' is 42 days, 4 days earlier than the control 'Flammulina velutipes variety Nong Wan Jin No. 12'. Due to its novel color and excellent comprehensive characteristics, the Flammulina velutipes variety 'Nong Wan Jin No. 15' is suitable for factory production and has good promotion prospects.

[0012] 2. The specific molecular marker fragment of Flammulina velutipes variety 'Nong Wan Jin No. 15' is authentic, reliable and clear at a glance. It has a smaller error than the classic morphological identification, is not affected by environmental conditions, and is more intuitive.

[0013] 3. Strong specificity: Based on the gene sequencing and bioinformatics analysis of Flammulina velutipes, the present invention designs a marker fragment with specific identification of the Flammulina velutipes variety 'Nong Wan Jin No. 15'. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1The PCR electrophoresis diagrams of the specific molecular marker fragments are shown below. M1: 2000 bp Marker; 1: 'Nong Wan Jin No. 12'; 2: 'Nong Wan Jin No. 15'; 3: 'TB'.

[0015] Figure 2 Schematic diagram of the detection results of three Flammulina velutipes variety-specific molecular marker fragments.

[0016] Figure 3 The morphological diagram of Nong Wan Jin No. 15 and the control strain Nong Wan Jin No. 12. The left one is Nong Wan Jin No. 12, and the right one is Nong Wan Jin No. 15. DETAILED DESCRIPTION

[0017] In order to make the contents of the present invention easier to understand, the technical solution of the present invention is further explained below in combination with specific implementation methods. However, the following examples are merely examples of the present invention and do not represent the scope of protection of the rights limited by the present invention. The scope of protection of the present invention shall be subject to the claims.

[0018] The Flammulina velutipes variety 'Nong Wan Jin No. 12' (also known as FLV0231) is a cultivar of Flammulina velutipes jointly bred by Fujian Agriculture and Forestry University and Fujian Wanchen Biotechnology Group Co., Ltd., and was recognized by the Fujian Provincial Non-Major Crop Variety Recognition Committee in 2022, with the recognition number: Min Ren Jun 2022003. The Flammulina velutipes variety 'Nong Wan Jin No. 12' is also the main cultivated variety of yellow Flammulina velutipes at present. Its cap is yellow, the cap is small, the stem is thick, and the commercial characteristics are good, but the yield is low. The Flammulina velutipes variety 'Nong Wan Jin No. 12' is classified and named Flammulina velutipes and is preserved in the Fujian Provincial Edible and Medicinal Mushroom Germplasm Resource Preservation and Management Center (located at the Edible Mushroom Germplasm Resource Bank of the Fungus Research Center of Fujian Agriculture and Forestry University, No. 15, Cangshan District, Fuzhou City, Fujian Province). The preservation date is January 1, 2023, and the strain preservation number is: F0407.

[0019] The Flammulina velutipes variety 'TB' is a strain of Flammulina velutipes obtained by the Fungus Research Center of Fujian Agriculture and Forestry University in 2019 from wild Flammulina velutipes collected from Japan and separated by tissue. It has the advantages of brown cap and high yield, but also has the disadvantages of large cap and easy to open. The Flammulina velutipes variety 'TB' is classified and named Flammulina velutipes, and is preserved in the Fujian Provincial Edible and Medicinal Fungi Germplasm Resources Preservation and Management Center (located at the Edible Fungi Germplasm Resources Bank of the Fungus Research Center of Fujian Agriculture and Forestry University, No. 15, Cangshan District, Fuzhou City, Fujian Province). The preservation date is March 1, 2021, and the strain preservation number is: F0509.

[0020] Example 1: Breeding of Flammulina velutipes variety 'Nong Wan Jin No. 15' (1) The yellow Flammulina velutipes variety 'Nong Wan Jin No. 12' and the brown Flammulina velutipes variety 'TB' were selected as breeding parents. The basidiospores of the 'TB' strain were collected and the monospore strains were isolated. Ten monospore strains of 'TB' with normal mycelium growth were selected for single-double hybridization with the binucleate strain of 'Nong Wan Jin No. 12'. A total of 10 hybrid combinations were paired, and 8 hybrid strains with lock-like union were obtained. The mushrooms were grown at Fujian Wanchen Biotechnology Group Co., Ltd., and three hybrid strains with vigorous mycelium growth, uniform primordium formation, and high yield were obtained in the initial screening. After the re-screening, the hybrid strain numbered 'Flv9101' had a significantly higher yield than the parent and the control variety 'Nong Wan Jin No. 12', and had the characteristics of dark brown cap color, uniform size, and uniform stipe color. Based on the comprehensive re-screening yield and trait performance, the strain numbered Flv9101 was finally selected for variety testing and identification application, and the variety was named 'Nong Wan Jin No. 15' for subsequent batch testing.

[0021] Example 2: Using SV detection technology to compare the DNA differences between the Flammulina velutipes variety 'Nong Wan Jin No. 15' and its parents.

[0022] Test materials: There are 3 strains of Flammulina velutipes, namely: the strain to be tested is 'Nong Wan Jin No. 15', the control variety (parent) 'Nong Wan Jin No. 12', and the parent 'TB'.

[0023] Test method: Based on the genome sequencing data, Kmer subtractive assembly technology was used to obtain differential fragments (SVs), and several SV sequences were selected to design specific primers for amplification of the test samples. (References: Alkan, C., Coe, BP & Eichler, EEGenome structural variation discovery and genotyping. Nature reviews Genetics, 2011 (12), 363–376; ETELEEBAM, QUIGLEY DA, ZHAO SG, et al. SV-HotSpot: detection and visualization of hotspots targeted by structural variants associated with gene expression. Scientific Reports, 2020, 10: 15890. The SV test primer sequence was synthesized by Qingke Biotechnology Co., Ltd. The mycelium activation, culture, genomic DNA extraction and electrophoresis detection of the test strains were carried out in accordance with the agricultural industry standards of the People's Republic of China.

[0024] The 8 pairs of SV primers used for the authenticity identification of the strains are shown in Table 1: Table 1SV primer sequences and amplified specific fragment information Results and analysis: The PCR amplification results of each specific fragment are shown in Figure 1 The schematic diagram of the detection results of three Flammulina velutipes species-specific fragments is shown in Figure 2 As shown. The results showed that P21, P22, P23, and P24 were the common sequences of Nong Wan Jin No. 12 and Nong Wan Jin No. 15, which were different from TB; P26, P28, P29, and P30 were the common sequences of Nong Wan Jin No. 15 and TB, which were different from Nong Wan Jin No. 12. Based on the test results, it was found that Nong Wan Jin No. 15 inherited different specific fragments from its parents Nong Wan Jin No. 12 and TB, and it was determined to be a hybrid of Nong Wan Jin No. 12 and TB. There were significant differences in the DNA fingerprints between Nong Wan Jin No. 15, Nong Wan Jin No. 12, and TB.

[0025] Test conclusion: The SV analysis results show that the tested strain Flammulina velutipes 'Nong Wan Jin No. 15' is a hybrid of 'Nong Wan Jin No. 12' and 'TB'. It has significant differences in DNA fingerprints from its parents and can be determined to be a different variety.

[0026] The identified Flammulina velutipes variety 'Nong Wanjin No. 15' was classified and named Flammulina velutipes, and was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is November 18, 2024, and the deposit number is CGMCC NO.41600.

[0027] Example 3: Four independent batches of Flammulina velutipes variety 'Nong Wan Jin No. 15' were subjected to a variety comparison test. Four independent batches of Flammulina velutipes variety 'Nong Wan Jin No. 15' were subjected to a variety comparison test. The results showed that 'Nong Wan Jin No. 15' met the requirements for factory cultivation and its yield was significantly higher than that of the control variety 'Nong Wan Jin No. 12'.

[0028] The strains tested in the variety comparison test are: 'Nong Wan Jin No. 15' and 'Nong Wan Jin No. 12'.

[0029] Experimental location: Fujian Wanchen Biotechnology Co., Ltd. (hereinafter referred to as Wanchen Company).

[0030] Experimental arrangement: The strains were uniformly produced, and the experimental sites were planted in factory-style bottles according to the production management method of Wanchen Company, using a multi-zone mobile bed model for cultivation (plastic bottles, 378g (dry material) / bottle). Specific cultivation information is shown in Table 2: Table 2 Multi-batch test information table Mycelium growth test results (see Table 3): The growth rates of 'Nong Wan Jin No. 15' and 'Nong Wan Jin No. 12' increased with the increase of temperature, and both grew fastest at 25°C, and then the growth rate gradually decreased. At 25°C and 30°C, the mycelium growth rate of 'Nong Wan Jin No. 15' was faster than that of 'Nong Wan Jin No. 12' (very significant difference), at 10°C, the mycelium growth rate of 'Nong Wan Jin No. 15' was slower than that of 'Nong Wan Jin No. 12' (very significant difference), and there was no significant difference in mycelium growth rate between the two at other temperatures.

[0031] Table 3 Mycelium growth rate test results (unit: cm / day) variety 10℃ 15℃ 20℃ 25℃ 30℃ Nong Wan Jin No. 15 0.319 0.477 0.624 0.880 0.510 Nong Wan Jin No. 12 0.415 0.452 0.652 0.753 0.198 Multiple cultivation experiments found (see Table 4): (1) The average period from inoculation to harvest for the four batches of Nong Wan Jin 15 was 42 days, while the average period from inoculation to harvest for the four batches of the control variety Nong Wan Jin 12 was 46 days. The period of Nong Wan Jin 15 was 4 days shorter than that of the control variety Nong Wan Jin 12.

[0032] (2) The average yield of 'Nong Wan Jin No. 15' was 447.5 g / bottle, while the average yield of the control variety 'Nong Wan Jin No. 12' was 349.5 g / bottle. The average yield of 'Nong Wan Jin No. 15' was 28.0% higher than that of the control variety 'Nong Wan Jin No. 12' (the difference was extremely significant).

[0033] (3) In terms of overall appearance Figure 3 ), the control variety 'Nong Wan Jin No. 12' has a shorter stipe, the cap of 'Nong Wan Jin No. 15' is coffee-colored, the longitudinal section is hemispherical, the color uniformity and stipe adhesion are high, the cap of 'Nong Wan Jin No. 12' is yellow, the longitudinal section is flat spherical, the color uniformity and stipe adhesion are medium. The cap diameter, cap thickness, cap height, stipe diameter and stipe length of 'Nong Wan Jin No. 15' are larger than those of the control variety 'Nong Wan Jin No. 12' (extremely significant difference). 'Nong Wan Jin No. 15' has good overall performance, special and novel color, conforms to the factory cultivation model, and has great market potential.

[0034] Table 4 Results of multiple batches of cultivation experiments Note: '**' means P < 0.01, the difference is extremely significant; '*' means 0.01 < P < 0.05, the difference is significant.

[0035] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A Flammulina velutipes variety 'Nong Wan Jin No. 15', characterized by: The Flammulina velutipes variety 'Nong Wan Jin No. 15' is classified and named Flammulina velutipes ( Flammulina velutipes ), deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is November 18, 2024, and the deposit number is CGMCC NO.41600.

2. A specific molecular marker fragment for identifying the Flammulina velutipes variety 'Nong Wan Jin No. 15' according to claim 1, characterized in that: The specific molecular marker fragments are P21, P22, P23, P24, P26, P28, P29 and P30, and the specific nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, respectively.

3. The specific molecular marker fragment according to claim 2, characterized in that: The amplification primers of the specific molecular marker fragment are as follows: The amplification primers for the specific molecular marker fragment P21 are: P21-F: GATCTACTTCGTTTGGCGGG; P21-R: CAGCCCATTCATCATCCCAG; The amplification primers for the specific molecular marker fragment P22 are: P22-F: GCTCTGGGTTCTCTTGTCTG; P22-R: TGGGTATCGTCTCGCATTTT; The amplification primers for the specific molecular marker fragment P23 are: P23-F: GGGGTAATCAGCGATGTAGG; P23-R: ATCGGTCAGCACAAGAAACA; The amplification primers for the specific molecular marker fragment P24 are: P24-F: TGGTCTACAAAAAGCGGCAA; P24-R: TGAGTTTCCCACTGGATTGAC; The amplification primers for the specific molecular marker fragment P26 are: P26-F: CAATCGCCCGTTATAGTCCA; P26-R: TCCTGTGGGATTCAACGAAC; The amplification primers for the specific molecular marker fragment P28 are: P28-F: AATCTGCCACGTTTGAGTT; P28-R: TGTCGGTAGGATGTCAGTGT; The amplification primers for the specific molecular marker fragment P29 are: P29-F: TCATTGCCTCTGCTTTCGTT; P29-R: CGTTAGGTGTCGTGCTAGTC; The amplification primers for the specific molecular marker fragment P30 are: P30-F: CAAGAAGATAGCCAGTCCCG; P30-R: GGATGCTTGACTTTGTGTGC.

4. Use of the Flammulina velutipes variety 'Nong Wan Jin No. 15' described in claim 1 in Flammulina velutipes breeding.

5. Use of the Flammulina velutipes variety 'Nong Wan Jin No. 15' described in claim 1 in food production.

6. Use of the specific molecular marker fragment according to claim 2 in identifying varieties of Flammulina velutipes.

Images