Recombinant bacillus for heterologous synthesis of ovotransferrin as well as construction method and application of recombinant bacillus

Abstract

The invention relates to the technical field of biology, in particular to recombinant bacillus for heterologous synthesis of ovotransferrin as well as a construction method and application of the recombinant bacillus. According to the invention, bacillus (bacillus subtilis and bacillus amyloliquefaciens) is taken as a host, and the OVT gene is heterologously expressed by using a genetic engineering technology, so that heterologous secretory expression of OVT1 and OVT2 from different sources in chassis cells is realized; meanwhile, the invention also provides a method for more economically and efficiently increasing the expression level of ovotransferrin. Three different molecular chaperones PrsA, DnaK and CasA are further selected for co-expression with the ovotransferrin, correct folding of the ovotransferrin in host cells is promoted, the soluble secretory expression quantity of the ovotransferrin is increased, and the expression efficiency of the ovotransferrin is improved.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a recombinant bacillus capable of heterologously synthesizing ovotransferrin, a construction method and application thereof. Background Art

[0002] Ovotransferrin (OVT) is a glycoprotein that belongs to the iron-binding protein family and is mainly derived from the egg white part. It consists of 686 amino acids and has a molecular weight of about 78 kDa. The structural features of OVT include 15 disulfide bonds, which are essential for it to maintain a globular structure. The carbohydrate part in OVT consists of 4 mannose residues and 2 N-acetylglucosamine residues. The structure of OVT consists of an N lobe and a C lobe, each of which contains two domains and an iron binding site. In terms of secondary structure, OVT is generally composed of α-helix (17.9%), β-fold (28.8%), β-turn (17.3%), and random coil (36.0%). This structure enables OVT to bind iron through two iron binding sites, so it has two states: iron-deficient (ovotransferrin) or iron-saturated (full ovotransferrin).

[0003] Ovotransferrin can reversibly bind to iron ions, transfer iron ions from areas of absorption and storage in the body to various parts that need iron, and then release iron ions. These released iron ions are then used for the synthesis of hemoglobin in red blood cells, which not only promotes the absorption of iron in the body, but also helps prevent the occurrence of anemia. At the same time, ovotransferrin also has a variety of biologically active functions, including antibacterial, antiviral, anti-inflammatory, anti-tumor, antioxidant, and inhibition of angiotensin converting enzyme (ACE) activity. These functions make ovotransferrin have great benefits in the field of human health, especially in food, medicine and nutritional health products. For example, ovotransferrin and its derivative peptides have antibacterial activity and can be used as natural preservatives in food to prevent microbial corruption while enhancing nutritional value. Its antioxidant properties also make it potential in food processing, which can prevent undesirable oxidation reactions caused by metal ions, etc. In addition, ovotransferrin also shows the potential to promote bone formation and prevent osteoporosis, and can be used as a therapeutic and synthetic agent to promote bone repair. In the pharmaceutical field, ovotransferrin and its peptides have the potential to be used as drugs for regulating hypertension due to their ACE inhibitory activity. In general, ovotransferrin and its derived peptides have broad application prospects in the food industry and pharmaceutical fields due to their diverse biological activities.

[0004] At present, the preparation methods of ovotransferrin mainly include traditional precipitation method and various chromatography methods. The precipitation method is less used because the protein purity obtained is low and it is not easy to scale up production. Later, the chromatography method was widely used to improve the purity and yield of ovotransferrin, but it also has certain defects, such as modern purification technology requires high equipment and technical investment, and during the purification process, the structure of ovotransferrin may change, affecting its biological activity. A more economical and efficient method for preparing ovotransferrin needs further study. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a recombinant bacillus for heterologously synthesizing ovotransferrin in view of the deficiencies of the prior art.

[0006] The technical problem that the present invention needs to solve is to provide a method for constructing the above-mentioned recombinant Bacillus.

[0007] The final technical problem to be solved by the present invention is to provide the application of the above-mentioned recombinant Bacillus.

[0008] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0009] A recombinant Bacillus that heterologously synthesizes ovotransferrin, using Bacillus as a host cell, heterologously expressing the ovotransferrin OVT gene;

[0010] Wherein, the amino acid sequence of the ovotransferrin OVT is shown in SEQ ID NO.1.

[0011] Furthermore, a recombinant Bacillus that heterologously synthesizes ovotransferrin is provided, wherein the ovotransferrin OVT gene and a molecular chaperone gene are heterologously expressed using the Bacillus as a host cell;

[0012] Wherein, the amino acid sequence of the ovotransferrin OVT is shown in SEQ ID NO.1.

[0013] The ovotransferrin OVT gene is a gene obtained by codon optimization based on the ovotransferrin amino acid sequence shown in SEQ ID NO.1, and is the ovotransferrin gene OVT1 or the ovotransferrin gene OVT2.

[0014] Specifically, the nucleotide sequence of the ovotransferrin gene OVT1 is shown in SEQ ID NO.2; the nucleotide sequence of the ovotransferrin gene OVT2 is shown in SEQ ID NO.3.

[0015] Wherein, the Bacillus is any one of Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus licheniformis and Bacillus megaterium.

[0016] Preferably, the Bacillus is Bacillus subtilis or Bacillus amyloliquefaciens.

[0017] More preferably, the Bacillus subtilis is Bacillus subtilis MATE01, and the Bacillus amyloliquefaciens is Bacillus amyloliquefaciens CF.

[0018] Preferably, the Bacillus subtilis MATE01 is purchased from Tianjin Chunyao Biotechnology Co., Ltd., and the Bacillus amyloliquefaciens CF has been disclosed in patent CN116004496A (a genetically engineered bacterium for producing hyaluronic acid and its application).

[0019] The molecular chaperone includes any one of PrsA, DnaK and CsaA, and the amino acid sequences thereof are shown in SEQ ID NOs. 4 to 6, respectively.

[0020] Preferably, the molecular chaperone is DnaK.

[0021] A method for constructing a recombinant Bacillus capable of heterologously synthesizing ovotransferrin is provided. An expression vector containing an ovotransferrin OVT gene is transformed into Bacillus to construct the recombinant Bacillus.

[0022] Furthermore, a method for constructing a recombinant Bacillus that heterologously synthesizes ovotransferrin is provided, wherein an expression vector containing an ovotransferrin OVT gene and a molecular chaperone gene is transformed into Bacillus to construct the recombinant Bacillus.

[0023] Wherein, when the recombinant Bacillus is Bacillus subtilis, the expression vector is the expression vector pMATE05; when the recombinant Bacillus is Bacillus amyloliquefaciens, the expression vector is the expression vector pHT01.

[0024] Specifically, the expression vector pMATE05 contains P mat promoter, the expression vector pHT01 contains P grac Promoter.

[0025] The use of the above-mentioned recombinant Bacillus in the fermentation production of ovotransferrin is also within the scope of protection of the present invention.

[0026] Specifically, the activated recombinant Bacillus seed liquid is inoculated into the fermentation medium, and after fermentation for 3 to 6 hours, an inducer is added to induce expression, thereby fermenting and producing ovotransferrin.

[0027] The preparation process of the recombinant Bacillus seed liquid is as follows: the recombinant Bacillus colony is transferred to a culture medium for cultivation; wherein the culture medium is LB culture medium; the culture conditions are: 30-37°C, 180-220rpm / min overnight culture for 12-16h.

[0028] Wherein, the inoculation has an inoculation amount of 1 to 10% v / v;

[0029] Wherein, the fermentation medium is TB medium;

[0030] The fermentation conditions are as follows: 30-37°C, 180-220 rpm / min, and a total fermentation time of 24-48 hours.

[0031] Wherein, when the recombinant Bacillus is Bacillus subtilis, the inducer is 1-10 g / L maltose. In some embodiments of the present invention, the amount of maltose added is 10 g / L; when the recombinant Bacillus is Bacillus amyloliquefaciens, the inducer is 0.2-0.4 mM IPTG. In some embodiments of the present invention, the amount of IPTG added is 0.4 mM.

[0032] Beneficial effects:

[0033] (1) The present invention uses Bacillus subtilis and Bacillus amyloliquefaciens as chassis cells respectively, and utilizes genetic engineering technology to not only achieve heterologous secretory expression of ovotransferrin genes OVT1 or OVT2 from different sources in chassis cells, but also provides a method for increasing protein expression levels.

[0034] (2) In order to promote the correct folding of ovotransferrin, improve its solubility, stability and activity, and achieve efficient expression of ovotransferrin, the present invention further uses Bacillus amyloliquefaciens as a host cell, selects three different molecular chaperones PrsA, DnaK, and CasA to co-express with ovotransferrin, respectively, promotes the correct folding of ovotransferrin in the host cell, and increases its soluble secretory expression. Comparing the effect of improving the expression efficiency of ovotransferrin, it is found that the molecular chaperone DnaK has the best effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] The present invention will be further described in detail below with reference to the accompanying drawings, and the above and / or other advantages of the present invention will become more clear.

[0036] Figure 1 This is a SDS-PAGE comparison of protein expression of recombinant strains containing target genes optimized with codons from different sources; among them, 1: CF-pHT-OVT1; 2: CF-pHT-OVT2; 3: MATE01-pMATE05-OVT1; 4: MATE01-pMATE05-OVT2.

[0037] Figure 2 Comparison chart of the growth and ovotransferrin expression of control bacteria and recombinant strains of different host bacteria (24h).

[0038] Figure 3 This is a SDS-PAGE comparison of protein expression of recombinant strains of Bacillus amyloliquefaciens co-expressing molecular chaperones; wherein, M: protein Maker; 1: CF-pHT-OVT2; 2: CF-pHT-OVT2 (not induced); 3: CF-pHT-OVT2-PrsA; 4: CF-pHT-OVT2-PrsA (not induced); 5: CF-pHT-OVT2-DnaK; 6: CF-pHT-OVT2-DnaK (not induced); 7: CF-pHT-OVT2-CsaA; 8: CF-pHT-OVT2-CsaA (not induced);

[0039] Figure 4 Comparison chart of the growth and ovotransferrin expression levels of the recombinant Bacillus amyloliquefaciens strain co-expressing the molecular chaperone (24 h). DETAILED DESCRIPTION

[0040] The present invention will be further described in detail below in conjunction with specific implementations, and the above and / or other advantages of the present invention will become more clear.

[0041] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0042] In the following examples, the expression vector pMATE05 was purchased from Tianjin Chunyao Biotechnology Co., Ltd., the expression vector pHT01 was purchased from General Biotechnology (Anhui) Co., Ltd., the Bacillus subtilis MATE01 was purchased from Tianjin Chunyao Biotechnology Co., Ltd., and the Bacillus amyloliquefaciens CF has been disclosed in patent CN116004496A (A genetically engineered bacterium for producing hyaluronic acid and its application).

[0043] In the following examples, the production of ovotransferrin was detected using an ELISA kit purchased from Aimi Technology Co., Ltd., and the detection method was carried out according to the instructions.

[0044] Example 1: Acquisition of ovotransferrin OVT gene

[0045] The cDNA sequence of ovotransferrin (OVT) was retrieved from NCBI (NCBI database gene accession number is NP_990635.2), and the gene was codon optimized according to the codon preference of different sources, and a biological company was commissioned to chemically synthesize it. Two codon-optimized OVT genes were obtained by different optimization methods, and named OVT1 and OVT2. The nucleotide sequences of OVT1 and OVT2 are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0046] Specific primers corresponding to the OVT1 gene and OVT2 gene were designed for the expression vector pMATE05 and the expression vector pHT01, respectively (Table 1). Using OVT1 and OVT2 as templates and the corresponding specific primers, PCR amplification was performed to obtain PCR products, namely, the gene fragments of ovotransferrin OVT1 with homology arms (named: OVT1-M, OVT1-H) and the gene fragments of ovotransferrin OVT2 with homology arms (named: OVT2-M, OVT2-H).

[0047] The PCR amplification system was: 2×Phanta Max Master Mix 25μL, template 2μL, upstream and downstream primers 2μL×2, ddH2O 19μL. The amplification program was: 95℃ pre-denaturation for 5min, 95℃ denaturation for 15s, 55℃ annealing for 15s, 72℃ extension for 1.2min, 35 cycles; 72℃ extension for 5min.

[0048] Table 1 Primer sequences for amplifying target genes

[0049]

[0050] After the PCR amplification is completed, nucleic acid gel electrophoresis is performed. After verification of success, the PCR product is purified using a column purification kit from Novozymes.

[0051] Example 2: Construction of recombinant plasmids pMATE05-OVT and pHT-OVT

[0052] 1. After reverse PCR amplification of the expression vector pMATE05, nucleic acid gel electrophoresis was performed. After successful verification, the PCR product was purified using a column purification kit from Novozymes.

[0053] The reverse PCR primers are as follows:

[0054] 05-F:ACTAGTTCTAGAGTCACGCGTTCTAGAGGTCGAAAT

[0055] 05-R: CTCGAGGACTCTAGACATATGCCAACTGTCGGAACGAG

[0056] 2. The expression vector pHT01 was purified after double digestion with BamHⅠ and SmaⅠ. The double digestion system was 30μL of expression vector, 5μL of 10× buffer, 2μL of BamHⅠ, 2μL of SmaⅠ, 11μL of ddH2O, 37℃, reaction for 1h.

[0057] 3. The purified target genes (OVT1-M gene fragment, OVT1-H gene fragment, OVT2-M gene fragment, OVT2-H gene fragment) in Example 1 were connected to the vector fragment pMATE05 after inverse PCR and the linear vector pHT01 after enzyme digestion at 37 ° C for 30 minutes using a single-fragment homologous recombinase, and then transformed into E. coli DH5α competent cells respectively. After extraction using a plasmid extraction kit and PCR verification, they were sent to General Bio (Anhui) Co., Ltd. for sequencing verification. The sequencing was successful to obtain recombinant plasmids pMATE05-OVT1, pMATE05-OVT2, pHT-OVT1, and pHT-OVT2.

[0058] The connection system is: linearized vector mμL, inserted fragment nμL, 5×CE II buffer 2μL, ExnaseII 2μL, ddH2O fill 20μL; wherein, m = (0.02×the number of vector base pairs) / concentration; n = (0.04×the number of inserted fragment base pairs) / concentration.

[0059] Example 3: Transformation of recombinant plasmid into Bacillus (Bacillus subtilis, Bacillus amyloliquefaciens)

[0060] 1. Transformation of recombinant plasmid into Bacillus subtilis

[0061] Take a 100 μL tube of Bacillus subtilis MATE01 competent cells and place it on ice for 5 to 10 minutes to thaw, then add 1 mL of GM transformation reagent and mix well, and culture at 37°C and 200 rpm / min for 1.5 hours. Take 50 to 200 ng of the recombinant plasmid pMATE05-OVT1 or pMATE05-OVT2 obtained in Example 2 and transform them into the above-cultured Bacillus subtilis MATE01 competent cells, mix well, and continue to culture at 37°C and 200 rpm / min for 1.5 hours. Centrifuge the above bacterial solution at 5000 rpm / min for 3 minutes, discard part of the supernatant, resuspend the bacteria with 200 μL of GM transformation reagent, then absorb 50 to 200 μL of the bacterial solution and spread it on an LB plate containing 25 mg / L kanamycin resistance, turn the plate upside down and place it at 37°C for 16 to 24 hours to obtain recombinant Bacillus subtilis.

[0062] MATE01-pMATE05-OVT1 and MATE01-pMATE05-OVT2.

[0063] 2. Transformation of recombinant plasmid into Bacillus amyloliquefaciens

[0064] (1) The recombinant plasmid was first transformed into E. coli GM2163: 100 μL of competent cells of E. coli GM2163 was placed on ice for 5-10 minutes. After thawing, 50-200 ng of the recombinant plasmid pHT-OVT1 or pHT-OVT2 obtained in Example 2 was added, and the cells were placed on ice for 30 minutes. Then, the cells were heat-shocked at 42°C for 1.5 minutes, and the cells were kept in an ice bath for 5-10 minutes. Then, 1 mL of LB culture medium was added and the cells were shaken at 37°C and 200 rpm / min for 1 hour for recovery. The bacterial solution was centrifuged at 5000 rpm / min for 3 minutes, part of the supernatant was discarded, and the resuspended cells were spread on an LB plate containing 100 mg / L ampicillin resistance. The plate was inverted and placed at 37°C for 16-24 hours. A single positive clone was picked and inoculated into 3-5 mL of LB medium containing 100 mg / L ampicillin antibiotics, and cultured overnight at 37°C and 200 rpm / min with shaking. The recombinant plasmid was extracted for positive clone identification.

[0065] (2) Transformation of recombinant plasmid into Bacillus amyloliquefaciens CF: The recombinant plasmids extracted and verified successfully from E. coli GM2163 were transformed into Bacillus amyloliquefaciens CF. Specifically, 80 μL of Bacillus amyloliquefaciens CF competent cells were placed on ice for 5 to 10 minutes to thaw, and then 50 to 200 ng of the recombinant plasmid extracted and verified successfully from E. coli GM2163 was added, and transferred to a 0.2 cm electroporation cup that had been ice-bathed at -20°C, and the electroporation cup containing the mixed solution was ice-bathed for 10 minutes. Adjust the parameters of the electroporation instrument, voltage 3 kV, time 4 milliseconds. After electroporation, quickly add 1 mL of ice-cold recovery medium (mannitol 0.38 M, sorbitol 0.5 M, peptone 10 g / L, NaCl 10 g / L, yeast powder 5 g / L) to the electroporation cup, gently pipette to mix, transfer the mixture to a centrifuge tube, and shake and recover at 37°C, 200 rpm / min for 1 hour. Centrifuge the above bacterial solution at 5000 rpm / min for 3 minutes, discard part of the supernatant, and resuspend the bacteria on a 25 mg / L chloramphenicol resistance LB plate. Place the plate upside down at 37°C for 16 to 24 hours to obtain recombinant Bacillus amyloliquefaciens CF-pHT-OVT1 and CF-pHT-OVT2.

[0066] Example 4: Secretory expression of ovotransferrin in recombinant strains

[0067] The colonies of the recombinant Bacillus subtilis and recombinant Bacillus amyloliquefaciens obtained in Example 3 were transferred to 5 mL of LB medium, and cultured overnight at 37° C., 220 rpm / min for 12 h. According to the inoculum amount of 1% v / v, they were transferred to 250 mL conical flasks containing 50 mL of TB medium, cultured at 37° C., 220 rpm / min for 3 h, and 10 g / L of maltose (Bacillus subtilis MATE01) and 0.4 mM IPTG (Bacillus amyloliquefaciens CF) were added to induce expression, and then transferred to 37° C., 220 rpm / min for further culture for 24 h.

[0068] The antibacterial effect of ovotransferrin after expression was observed by measuring the growth changes of recombinant Bacillus subtilis and recombinant Bacillus amyloliquefaciens, and the synthesis of ovotransferrin was detected by SDS-PAGE. Figure 1 and Figure 2 shown.

[0069] Figure 1 This is a comparison of the protein expression of recombinant strains containing target genes with optimized codons from different sources. The bands marked in lanes 1 and 2 are the expression of ovotransferrin in recombinant Bacillus amyloliquefaciens CF-pHT-OVT1 and CF-pHT-OVT2, and the bands marked in lanes 3 and 4 are the expression of ovotransferrin in recombinant Bacillus subtilis MATE01-pMATE05-OVT1 and MATE01-pMATE05-OVT2. The results showed that recombinant Bacillus amyloliquefaciens was more suitable for the expression of ovotransferrin, and in different host strains, the target gene OVT2 was more suitable for the expression of ovotransferrin.

[0070] Figure 2 Comparison of the growth and ovotransferrin expression of the control and recombinant strains of different host strains at 24h of fermentation. 600 The results showed that the expression of ovotransferrin in the recombinant strain was significantly lower than that in the control strain, indicating that the fermentation culture of the recombinant strain showed a significant antibacterial effect, which is consistent with the antibacterial activity of ovotransferrin. The ovotransferrin production of the recombinant strain was detected using an ELISA kit (Aimejie Technology Co., Ltd.) (the figure only shows the expression of ovotransferrin in the recombinant strain group containing the target gene OVT2, which is more suitable for the expression of ovotransferrin). The results showed that the host strain of Bacillus amyloliquefaciens is more suitable for the secretory expression of ovotransferrin, and the expression of ovotransferrin can reach 44 mg / L. Subsequent protein expression optimization studies will be carried out in the recombinant strain CF-pHT-OVT2 of Bacillus amyloliquefaciens.

[0071] Example 5: Recombinant plasmid co-expression of molecular chaperones

[0072] On the basis of successfully constructing and verifying the recombinant expression vector pHT-OVT2 most suitable for expressing ovotransferrin, the primers shown in Table 2 were used to PCR amplify the PrsA, DnaK, and CsaA molecular chaperone gene fragments on the Bacillus amyloliquefaciens CF genome, and the primers shown in Table 3 were used to PCR amplify the target gene O VT2 fragments corresponding to different molecular chaperones, and overlap PCR was performed with the corresponding molecular chaperone fragments to obtain the corresponding fusion fragments. The fusion fragments were then connected to the linear vector pHT01 after enzyme digestion at 37°C for 30 minutes, and then transformed into E.coli DH5α competent cells, respectively. After extraction using a plasmid extraction kit and PCR verification, they were sent to General Bio (Anhui) Co., Ltd. for sequencing verification. The sequencing was successful, and the recombinant plasmids pHT-OVT2-PrsA, pHT-OVT2-Dna K, and pHT-OVT2-CsaA were obtained. The recombinant plasmid was then transformed into Bacillus amyloliquefaciens according to the experimental steps in Example 3 to obtain recombinant Bacillus amyloliquefaciens CF-pHT-OVT2-PrsA, CF-pHT-OVT2-DnaK, and CF-pHT-OVT2-CsaA, respectively. The recombinant Bacillus amyloliquefaciens CF-pHT-OVT2-PrsA, CF-pHT-OVT2-DnaK, and CF-pHT-OVT2-CsaA were then secreted and expressed according to the experimental steps for secretory expression of ovotransferrin in recombinant strains in Example 4.

[0073] Table 2 Primer sequences for amplifying molecular chaperones

[0074]

[0075] Table 3 Primer sequences for amplifying target genes

[0076]

[0077] The antibacterial effect of ovotransferrin expression was observed by the growth changes of the recombinant strains, and the synthesis of ovotransferrin was detected by SDS-PAGE. The results showed that the recombinant strains after co-expression of molecular chaperones could promote the expression of ovotransferrin. The experimental results are shown in Figure 3 and Figure 4 .

[0078] Figure 3This is a comparison chart of the expression of recombinant Bacillus amyloliquefaciens proteins co-expressing molecular chaperones. Lane 1 is labeled as the induced expression of ovotransferrin in recombinant Bacillus amyloliquefaciens CF-pHT-OVT2, and lanes 3, 5, and 7 are labeled as the induced expression of ovotransferrin in recombinant Bacillus amyloliquefaciens strains CF-pHT-OVT2-PrsA, CF-pHT-OVT2-DnaK, and CF-pHT-OVT2-CsaA. Lanes 2, 4, 6, and 8 are labeled as controls for induced expression without the addition of inducers corresponding to lanes 1, 3, 5, and 7. The results show that when the DnaK molecular chaperone is co-expressed, the ovotransferrin band is the darkest, and its expression level is increased the most.

[0079] Figure 4 Comparison of the growth and ovotransferrin expression of the control and recombinant strains of different host strains at 24h of fermentation. 600 The results showed that the expression of ovotransferrin in the recombinant strain was significantly lower than that in the control strain, indicating that the recombinant strain had a significant antibacterial effect during fermentation, which was consistent with the antibacterial activity of ovotransferrin. The ovotransferrin production of the recombinant strain was detected using an ELISA kit. The results showed that the co-expression of the molecular chaperone DnaK had the greatest effect on the expression of ovotransferrin, and the expression level of ovotransferrin could reach 193 mg / L.

[0080] The present invention provides a recombinant Bacillus for heterologous synthesis of ovotransferrin and its construction method and application ideas and methods. There are many methods and approaches to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. A recombinant Bacillus that heterologously synthesizes ovotransferrin, characterized in that: Using Bacillus as host cells, the ovotransferrin OVT gene was heterologously expressed; Wherein, the amino acid sequence of the ovotransferrin OVT is shown in SEQ ID NO.

1.

2. A recombinant Bacillus that heterologously synthesizes ovotransferrin, characterized in that: Using Bacillus as host cells, ovotransferrin OVT gene and molecular chaperone genes were heterologously expressed; Wherein, the amino acid sequence of the ovotransferrin OVT is shown in SEQ ID NO.

1.

3. The recombinant Bacillus according to any one of claims 1 or 2, characterized in that The ovotransferrin OVT gene is a codon-optimized gene, which is an ovotransferrin gene OVT1 or an ovotransferrin gene OVT2.

4. The recombinant Bacillus according to claim 3, characterized in that The nucleotide sequence of the ovotransferrin gene OVT1 is shown in SEQ ID NO.2; the nucleotide sequence of the ovotransferrin gene OVT2 is shown in SEQ ID NO.

3.

5. The recombinant Bacillus according to any one of claims 1 or 2, characterized in that The Bacillus is any one of Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus licheniformis and Bacillus megaterium; preferably, the Bacillus subtilis is Bacillus subtilis or Bacillus amyloliquefaciens; more preferably, the Bacillus subtilis is Bacillus subtilis MATE01, and the Bacillus amyloliquefaciens is Bacillus amyloliquefaciens CF.

6. The recombinant Bacillus according to claim 2, characterized in that The molecular chaperone includes any one of PrsA, DnaK and CsaA, and the amino acid sequences thereof are shown in SEQ ID NOs. 4 to 6, respectively.

7. The method for constructing the recombinant Bacillus according to claim 1, characterized in that: The expression vector containing the ovotransferrin OVT gene is transformed into Bacillus to construct the recombinant Bacillus.

8. The method for constructing the recombinant Bacillus according to claim 2, characterized in that: The expression vector containing the ovotransferrin OVT gene and the molecular chaperone gene is transformed into Bacillus to construct the recombinant Bacillus.

9. Use of the recombinant Bacillus according to claim 1 or the recombinant Bacillus according to claim 2 in fermentation production of ovotransferrin; Specifically, the activated recombinant Bacillus seed liquid is inoculated into the fermentation medium, and after fermentation for 3 to 6 hours, an inducer is added to induce expression, thereby fermenting and producing ovotransferrin.

10. The use according to claim 9, characterized in that: The inoculation has an inoculation amount of 1-10% v / v; the fermentation medium is a TB medium; the fermentation has fermentation conditions of 30-37°C, 180-220 rpm / min, and a total fermentation time of 24-48 hours; when the recombinant Bacillus is Bacillus subtilis, the inducer is 1-10 g / L maltose, and when the recombinant Bacillus is Bacillus amyloliquefaciens, the inducer is 0.2-0.4 mM IPTG.

Images