Conditional immortalization-olfactory ensheathing cell line and construction method thereof

Abstract

The invention provides a conditional immortalization-olfactory ensheathing cell line and a construction method thereof, and the method comprises the following steps: obtaining primary olfactory ensheathing cells by using olfactory bulb tissues of animals; culturing the primary olfactory ensheathing cells for preset days, and performing marker detection on the cultured primary olfactory ensheathing cells; carrying out lentivirus transfection operation on the primary olfactory ensheathing cells by utilizing conditional immortalized lentivirus under the condition that a marker detection result meets an expected target to generate an olfactory ensheathing cell line; and carrying out continuous subculture on the olfactory ensheathing cell line under a preset induction condition to obtain the conditionally immortalized-olfactory ensheathing cell line. The method is convenient to operate and low in cost, it is guaranteed that a proper number of olfactory ensheathing cells with certain functional characteristics are harvested within a short time, the cell malignant proliferation risk existing in traditional line establishment is avoided, practicability and safety are high, and the key problem that in basic and clinical application, the number source of primary olfactory ensheathing cells is insufficient is expected to be solved.

Description

Technical Field

[0001] The present application relates to the field of bioengineering, and in particular to a conditionally immortalized olfactory ensheathing cell line and a construction method thereof. Background Art

[0002] Olfactory Ensheathing Cells (OECs) are a type of glial cell derived from the neural crest. During the development of OECs, the epiblast cells filling the olfactory placode migrate out from the olfactory mucosal epithelium along with the olfactory axons growing in the lamina propria, pass through the cribriform plate to move toward the olfactory bulb and eventually form the olfactory nerve layer, becoming one of the most important components of the olfactory system. Previous studies have shown that OECs have the following functional characteristics, including but not limited to: directional migration, secretion of a variety of neurotrophic factors, promotion of axon growth, promotion of myelin regeneration, phagocytosis, promotion of angiogenesis, interaction with astrocytes, and a variety of immunomodulatory functions (anti-inflammatory, antioxidant, etc.). Due to their rich functional characteristics, OECs are widely used in cell therapy for neurodegenerative diseases such as central nervous system (brain, spinal cord) and peripheral nerve injury, Parkinson's disease, and amyotrophic lateral sclerosis, with significant results.

[0003] However, primary olfactory ensheathing cells are limited by their own Hayflick limit (i.e., the phenomenon that some primary cells in animals have poor proliferation in vitro); the number of primary olfactory ensheathing cells extracted from animals is small and their cell proliferation ability is poor, which limits their large-scale application in basic and clinical applications.

[0004] Through immortalization technology, it is expected that primary olfactory ensheathing cells can cross their own Hayflick limit and achieve an immortalized state. It is a general term for a series of technologies that artificially introduce exogenous immortalized gene fragments into target cells to construct a proliferative cell line. The mechanism of action of immortalization technology is to reverse the replicative aging of primary cells and their natural apoptosis process. However, the cell lines constructed by simple cell immortalization technology have the risk of uncontrollable proliferation and malignant tendency. Conditional immortalization technology is based on immortalization technology. Its basic principle is to enable the constructed immortalized cells to maintain an immortalized state (including continuous proliferation, life extension, etc.) under specific conditions, and to return to their original post-mitotic state after the conditions are removed. The reversible immortalized cell line prepared based on this technology can not only harvest an ideal number of target cells in a short period of time, but also avoid the malignant tendency caused by unlimited cell proliferation, ensuring the safety of its basic and clinical applications. Summary of the invention

[0005] The embodiments of the present application provide a conditionally immortalized olfactory ensheathing cell line and a method for constructing the same. The constructed olfactory ensheathing cell line can remain immortalized under preset induction conditions and has the advantages of low cost, simple culture, multiple passages, good uniformity, and controllable conditions.

[0006] In a first aspect, the present invention provides a method for constructing a conditionally immortalized olfactory ensheathing cell line, the method comprising:

[0007] S11: Obtain primary olfactory ensheathing cells using animal olfactory bulb tissue;

[0008] S12: culturing the primary olfactory ensheathing cells for a preset number of days, and performing marker detection on the cultured primary olfactory ensheathing cells; the marker detection is used to determine the purity of the cells;

[0009] S13: When the result of the marker detection meets the expected target, the primary olfactory ensheathing cells are subjected to lentiviral transfection operation using conditionally immortalized lentivirus to generate an olfactory ensheathing cell line;

[0010] S14: Continuously subculturing the olfactory ensheathing cell line under preset induction conditions to obtain a conditionally immortalized olfactory ensheathing cell line; wherein the preset induction conditions are determined based on the conditionally immortalized lentivirus.

[0011] In some embodiments, the conditionally immortalized lentivirus comprises an immortalization gene fragment SV40Tag and a tetracycline conditional control system Tet-On element; wherein the Tet-On element causes the SV40Tag to be expressed in the presence of tetracycline, and the Tet-On element causes the expression of the SV40Tag to be inhibited in the absence of tetracycline; and the preset induction condition is induction by tetracycline or a tetracycline analog.

[0012] In some embodiments, the conditionally immortalized olfactory ensheathing cell line presents astrocyte-like olfactory ensheathing cell morphology and Schwann cell-like olfactory ensheathing cell morphology, and the conditionally immortalized olfactory ensheathing cell line expresses nerve growth factor receptor P75NTR protein; there is no statistical difference in the migration ability of the primary olfactory ensheathing cells and the conditionally immortalized olfactory ensheathing cell line; there is a statistical difference in the proliferation ability of the primary olfactory ensheathing cells and the conditionally immortalized olfactory ensheathing cell line, and the proliferation ability of the conditionally immortalized olfactory ensheathing cells is better than that of the primary olfactory ensheathing cells.

[0013] In some embodiments, during the process of continuously subculturing the OECD cell line under preset induction conditions, the method further comprises: performing marker detection on the obtained OECD cell line every preset number of generations; when the result of the marker detection meets the expected target, continuing to continuously subculture the OECD cell line; wherein, the marker detection adopts immunofluorescence staining method, and the marker is P75NTR protein.

[0014] In some embodiments, after step S14, the method further includes: S15: after removing the preset induction conditions, culturing the conditionally immortalized-olfactory ensheathing cell line to produce a comparison olfactory ensheathing cell line; wherein, there is no statistical difference in the migration ability of the comparison olfactory ensheathing cell line and the primary olfactory ensheathing cells, and the proliferation ability of the comparison olfactory ensheathing cell line and the primary olfactory ensheathing cells are both weaker than the proliferation ability of the conditionally immortalized-olfactory ensheathing cell line.

[0015] In some embodiments, before step S13, the method further includes: calculating the volume of the conditionally immortalized lentivirus using a multiplicity of infection formula for the optimal multiplicity of infection; wherein the multiplicity of infection formula is: MOI=lentivirus titer (IU / mL)×virus volume (mL) / number of transfected cells, and MOI refers to the multiplicity of infection.

[0016] In some embodiments, step S11 specifically includes:

[0017] S111: Take the olfactory bulb tissue of the rat, cut the olfactory bulb tissue after removing the meninges in a pre-cooled PBS solution until it becomes viscous, blow the obtained solution with a pipette tip and centrifuge it, and discard the supernatant to obtain the solution to be digested;

[0018] S112: digesting, terminating, centrifuging, and discarding the supernatant of the solution to be digested, and configuring the treated precipitate into a single cell suspension using a complete culture medium;

[0019] S113: performing a secondary differential adhesion purification process on the single cell suspension, and using the purified single cell suspension for culturing to produce the primary olfactory ensheathing cells.

[0020] In some embodiments, step S113 specifically includes: plating and culturing the single-cell suspension; obtaining the secondary attached cells to reconfigure the single-cell suspension, and plating the generated single-cell suspension in a culture dish coated with 0.01% poly-lysine solution PLL, and continuing to culture in a 37°C, 5% CO2 incubator.

[0021] In some embodiments, after the lentivirus transfection, the expression level of the SV40Tag is detected; wherein, the forward primer sequence of the target gene SV40Tag used for detection is GTGGCATTGCTTTGCTTCTTA, and the reverse primer sequence is GTCCAATCTCTCTTTCCACTCC; the forward primer sequence of the internal reference gene GAPDH used for detection is ACAGCAACAGGGTGGTGGAC, and the reverse primer sequence is TTTGAGGGTGCAGCGAACTT.

[0022] In a second aspect, an embodiment of the present application provides a conditionally immortalized olfactory ensheathing cell line, which is constructed by the method described in the first aspect.

[0023] The embodiment of the present application provides a conditionally immortalized olfactory ensheathing cell line and a construction method thereof, wherein a lentivirus constructed by combining a tetracycline conditional control system (Tet-On system) and a simian vacuolating virus 40 large T antigen gene (Simian vacuolating virus40, SV40) is used to transfect primary olfactory ensheathing cells derived from the olfactory bulb of rats, thereby breaking through the inherent "Hayflick limitation" of the cells, thereby constructing a conditionally immortalized olfactory ensheathing cell line having the advantages of low cost, simple culture, multiple passages, good uniformity, and controllable conditions. The lentivirus can be used not only as an in vitro tool cell model for studying the functional characteristics of olfactory ensheathing cells for basic research, but also as a reliable cell source for the treatment of neurotrauma and neurodegenerative diseases, and has a wide range of application scenarios. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 A flowchart for constructing a conditionally immortalized olfactory ensheathing cell line provided in the present application is shown;

[0025] Figure 2 A schematic diagram of the steps for isolating and culturing olfactory ensheathing cells from the rat olfactory bulb provided in the present application is shown;

[0026] Figure 3 The morphological observation diagram of primary rat olfactory ensheathing cells provided in the present application is shown;

[0027] Figure 4 The immunofluorescence identification diagram of primary rat olfactory ensheathing cells provided in the present application is shown;

[0028] Figure 5 The MOI screening diagram of the TetOn-SV40Tag conditional immortalization lentivirus of rat primary olfactory ensheathing cells provided in the present application is shown;

[0029] Figure 6 The cell morphology observation diagrams of each generation of the conditionally immortalized olfactory ensheathing cell line provided in the present application are shown;

[0030] Figure 7 The immunofluorescence identification diagram of each generation of cells of the conditionally immortalized olfactory ensheathing cell line provided in the present application is shown;

[0031] Figure 8 The SV40Tag gene expression diagram of the conditionally immortalized olfactory ensheathing cells provided in the present application at the 10th generation under the conditions of removing / retaining tetracycline intervention and the primary olfactory ensheathing cell group is shown;

[0032] Fig. 9 The CCK-8 experiment diagram of the conditionally immortalized olfactory ensheathing cells provided in the present application and the primary olfactory ensheathing cells group under the conditions of removing / retaining tetracycline intervention at the 10th generation is shown;

[0033] Fig.10 The conditional immortalized olfactory ensheathing cells provided in the present application are shown in the scratch experiment diagram of the primary olfactory ensheathing cells group under the conditions of removing / retaining tetracycline intervention at the 10th generation;

[0034] Fig.11 A Transwell experiment diagram of conditionally immortalized olfactory ensheathing cells provided in the present application at passage 10 with tetracycline removed / retained is shown together with primary olfactory ensheathing cells. DETAILED DESCRIPTION

[0035] The technical solutions in the embodiments of the present application will be described clearly and completely below in conjunction with the accompanying drawings in the embodiments of the present application. It is to be understood that the specific embodiments described herein are only used to explain the related applications, rather than to limit the present application. It should also be noted that, for ease of description, only the parts related to the related applications are shown in the accompanying drawings.

[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein are only for the purpose of describing the embodiments of this application and are not intended to limit this application.

[0037] In the following description, reference is made to “some embodiments”, which describe a subset of all possible embodiments, but it will be understood that “some embodiments” may be the same subset or different subsets of all possible embodiments and may be combined with each other without conflict.

[0038] In order to overcome the defect of insufficient proliferation and passage ability of primary olfactory ensheathing cells and retain the functional characteristics of primary cells, this application uses conditional immortalization lentivirus to infect primary olfactory ensheathing cells derived from the olfactory bulb of SD rats, so that they can break through their inherent "Hayflick limitation" and thus construct a conditional immortalization-olfactory ensheathing cell line with the advantages of low cost, simple culture, multiple passages, good uniformity, and controllable conditions. This application can be used as an in vitro tool cell model for basic research on the functional characteristics of olfactory ensheathing cells, and can also be used as a reliable cell source for the treatment of neurotrauma and neurodegenerative diseases, and has high practicality.

[0039] The embodiments of the present application will be described in detail below with reference to the accompanying drawings.

[0040] In one embodiment, see Figure 1 , which provides a schematic flow chart of a method for constructing a conditionally immortalized olfactory ensheathing cell line, the method comprising the following steps:

[0041] S11: Use animal olfactory bulb tissue to obtain primary olfactory ensheathing cells.

[0042] It should be noted that the animal can be any kind of animal, such as rats, mice, dogs, humans, etc.

[0043] S12: The primary olfactory ensheathing cells are cultured for a preset number of days, and markers of the cultured primary olfactory ensheathing cells are detected.

[0044] It should be noted that marker detection is used to determine the purity of cells. Specifically, the cells obtained in step S11 may not be entirely olfactory ensheathing cells, and may be mixed with miscellaneous cells such as endothelial cells. If there are too many mixed cells, it will have a greater impact on subsequent results. Therefore, marker detection is used to determine whether the purity of the obtained primary olfactory ensheathing cells meets the requirements.

[0045] The marker is a substance that can clearly identify a cell as an olfactory ensheathing cell. In a specific example, the marker is the neurotrophic factor receptor P75NTR protein, which is mainly distributed on the cell membranes of olfactory ensheathing cells and peripheral nerve Schwann cells. At the same time, since the cells obtained in this application are extracted from the central olfactory bulb tissue, there are fewer Schwann cells. Therefore, if the P75NTR protein is detected, the cell can be considered to be an olfactory ensheathing cell.

[0046] Here, the preset number of days needs to be determined according to the specific type of animal, culture conditions, etc. In a specific example, the preset number of days can be 9 days.

[0047] S13: When the results of the marker detection meet the expected targets, the primary olfactory ensheathing cells are transfected with lentivirus using conditional immortalized lentivirus to generate an olfactory ensheathing cell line.

[0048] In a specific example, the expected target is: the expression rate of the marker is 90%. That is, after immunofluorescence staining, the number of cells expressing the marker (P75NTR protein) under the microscope accounts for more than 90% of the total number of cells. That is, the cell purity of the olfactory ensheathing cells is more than 90%.

[0049] It should be noted that the conditional immortalization lentivirus comprises at least two parts, one part is used to introduce the immortalization gene fragment, and the other part is used to make the introduced immortalization gene fragment expressed under preset induction conditions, and make the introduced immortalization gene fragment not expressed after removing the preset induction conditions.

[0050] S14: Continuously subculturing the olfactory ensheathing cell line under preset induction conditions to obtain a conditionally immortalized olfactory ensheathing cell line; wherein the preset induction conditions are determined based on the conditionally immortalized lentivirus.

[0051] In this way, the obtained conditional immortalized-olfactory ensheathing cell line can have the characteristics of immortalization under the preset induction conditions, that is, the proliferation ability of the conditional immortalized-olfactory ensheathing cell line and the primary olfactory ensheathing cells is statistically different. Specifically, the conditional immortalized-olfactory ensheathing cell line constructed in this application has the advantages of high stability in passage, easy culture, low technical difficulty and cost, high safety and effectiveness, etc., has potential value for finished products, and has high commercial value and economic benefits.

[0052] In a specific embodiment, the conditionally immortalized lentivirus used in step S12 is HBLV-TetOn-SV40Tag-PURO, which contains the immortalized gene fragment SV40Tag and the tetracycline conditional control system Tet-On element; wherein the Tet-On element enables the expression of SV40Tag under the condition of tetracycline, and the Tet-On element inhibits the expression of SV40Tag under the condition of tetracycline removal. Accordingly, the preset induction condition is tetracycline or tetracycline analogue induction.

[0053] There is a statistical difference in the proliferation ability of primary OECs and conditional immortalized OECs, and the proliferation ability of conditional immortalized OECs is better than that of primary OECs, indicating that the obtained conditional immortalized OECs have immortalized characteristics. In this way, more OECs can be easily obtained through conditional immortalized OECs for clinical treatment and experimental research.

[0054] It should be noted that, taking the olfactory ensheathing cells of SD rats as an example, the conditionally immortalized olfactory ensheathing cell line established using TetOn-SV40Tag exhibits astrocyte-like olfactory ensheathing cell morphology (flat type) and Schwann cell-like olfactory ensheathing cell morphology (spindle shape), and the conditionally immortalized olfactory ensheathing cell line expresses the neurotrophic factor receptor P75NTR protein.

[0055] In some embodiments, for step S14, during the process of continuously subculturing the olfactory ensheathing cell line under the preset induction conditions, the method further comprises:

[0056] Step S14a: performing marker detection on the obtained olfactory ensheathing cell line every a preset number of generations; when the result of the marker detection meets the expected target, continuing to culture the olfactory ensheathing cell line continuously.

[0057] It should be noted that the marker detection involved in step S12 and step S14a can be immunofluorescence staining or flow cytometry, etc., and the specific marker detected can be P75NTR protein, or P75NTR protein combined with other markers (such as GFAP, S100β), etc.; thereby proving the presence of olfactory ensheathing cells.

[0058] In some embodiments, after step S14, the method further includes:

[0059] S15: After removing the preset induction conditions, the conditionally immortalized OEC line was cultured to generate a control OEC line.

[0060] There was no statistical difference in the migration ability between the OECs and primary OECs. The proliferation ability of the OECs was weaker than that of the conditionally immortalized OECs. The OECs partially recovered to a proliferation ability similar to that of primary OECs.

[0061] Overall, there was no statistical difference in the migration ability between primary OECs and control OECs, indicating that the control OECs at least retained some of the cell characteristics of primary OECs after removing the tetracycline condition; and the conditionally immortalized OECs had better proliferation ability than primary OECs, which can easily obtain more OECs for clinical treatment and experimental research.

[0062] In some embodiments, before step S13, the method further includes:

[0063] The volume of the conditionally immortalized lentivirus was calculated using the multiplicity of infection formula for the optimal multiplicity of infection; wherein the multiplicity of infection formula is: MOI=lentivirus titer (IU / mL)×virus volume (mL) / number of transfected cells, and MOI refers to the multiplicity of infection.

[0064] Here, the optimal infection multiplicity can be obtained by experimental screening. For example, multiple infection multiplicity is set first, and a lentiviral transfection experiment is performed for each infection multiplicity. It is best to select the infection multiplicity corresponding to the group with the best transfection effect as the optimal infection multiplicity.

[0065] In a specific embodiment, step S11 specifically includes:

[0066] S111: The olfactory bulb tissue of the rat is taken out, and the olfactory bulb tissue after removing the meninges is cut into pieces in a pre-cooled PBS solution until it becomes viscous, and then the solution is blown and centrifuged with a pipette tip, and the supernatant is discarded to obtain the solution to be digested.

[0067] Here, PBS solution is the most widely used buffer in biochemical research. Its main components are Na2HPO4, KH2PO4, NaCl and KCl, and it is generally used as a solvent.

[0068] S112: digesting, terminating, centrifuging, and discarding the supernatant of the solution to be digested, and configuring the treated precipitate into a single cell suspension using a complete culture medium.

[0069] S113: performing secondary differential adhesion purification on the single cell suspension, and using the purified single cell suspension for culture to produce primary olfactory ensheathing cells.

[0070] In some embodiments, step S113 includes:

[0071] The single cell suspension was plated and cultured;

[0072] The secondary adherent cells were obtained to prepare a single cell suspension, and the single cell suspension was plated on a culture dish coated with a 0.01% poly-lysine solution PLL, and cultured in a 37° C., 5% CO 2 incubator.

[0073] Here, PLL refers to 0.01% poly-lysine solution, which is used to promote the adherent growth of OECs.

[0074] In some implementations, the complete culture medium formula in step S113 is: 90% DMEM / F12 culture medium; 10% fetal bovine serum; 1% penicillin / streptomycin solution or other double or triple antibodies. Among them, DMEM / F-12 is a widely used basic culture medium used to promote the growth of many different mammalian cells, including dog kidney cells MDCK, glial cells, fibroblasts, human endothelial cells and rat fibroblasts. At the same time, in order to prevent cell contamination in cell culture, a mixture containing two antibiotics, penicillin and streptomycin, is used.

[0075] In some embodiments, after lentiviral transfection, the expression level of SV40Tag is detected; wherein the primer sequences of the target gene SV40Tag and the internal reference gene GAPDH are shown in Table 1.

[0076] Table 1

[0077]

[0078] In this way, through the above steps, the present application constructs a conditionally immortalized-olfactory ensheathing cell line. The method for constructing the conditionally immortalized-olfactory ensheathing cell line provided can significantly make up for the quantitative deficiency of primary olfactory ensheathing cells due to their inherent insufficient proliferation and passage ability. On the basis of retaining the basic functions (proliferation and migration) of primary olfactory ensheathing cells, a considerable number of olfactory ensheathing cells with high purity can be harvested in a short time; and its passage ability is artificially controllable and has high safety; it is expected to be used as a reliable cell source for the treatment of neurotrauma and neurodegenerative diseases. In addition, the provided conditionally immortalized-olfactory ensheathing cell line can be used as an in vitro tool cell model for studying the functional characteristics of olfactory ensheathing cells.

[0079] Please refer to Figure 2 Taking SD rats as an example, the following provides the construction steps of a conditionally immortalized olfactory ensheathing cell line in a specific scenario and the detailed parameters involved therein, but it is only used as an example and does not constitute a specific limitation to the present application.

[0080] 1. Please refer to Figure 2 , using the olfactory bulb tissue of the animal, primary olfactory ensheathing cells are obtained, and the primary olfactory ensheathing cells are cultured for a preset number of days. That is, primary olfactory ensheathing cells derived from the olfactory bulb of SD rats are extracted, purified, and cultured.

[0081] (1) Take SD rats, cut the scalp, subcutaneous tissue, and skull layer by layer along the midline; fully expose the two olfactory bulbs connected to the brain in the anterior cranial fossa and carefully remove them completely; remove the meningeal tissue under a dissecting microscope;

[0082] (2) Cut the olfactory bulb tissue after removing the meninges in pre-cooled PBS solution until it becomes viscous, transfer it to a 15 mL centrifuge tube, pipette 100 times, and centrifuge at 1200 revolutions per minute (rpm) for 5 minutes (minute, min);

[0083] (3) After centrifugation, discard the supernatant and add 0.25% trypsin to digest in a 37°C water bath for 3 min;

[0084] (4) Complete medium was added to terminate digestion, and the mixture was gently pipetted 50 times. The mixture was centrifuged again at 1200 rpm for 5 min, and then a single-cell suspension was prepared using complete medium and the solution after centrifugation.

[0085] (5) The extracted olfactory ensheathing cell suspension was plated, and after 18 hours (hour, h), the non-adherent cells in the supernatant were transferred to an empty culture dish and cultured for 36 hours;

[0086] (6) Carefully pipette the supernatant after secondary adhesion into a centrifuge tube and centrifuge at 1200 rpm for 5 min;

[0087] (7) Discard the supernatant, resuspend in complete medium, plate in a culture dish coated with PLL in advance, and continue culturing in a 37°C, 5% CO2 incubator.

[0088] During the above process, the morphology of rat primary olfactory ensheathing cells was observed under a microscope as shown in the figure below. Figure 3 shown.

[0089] 2. Perform marker detection on the cultured primary olfactory ensheathing cells, i.e., identify the primary olfactory ensheathing cells by immunofluorescence staining.

[0090] (1) Primary olfactory ensheathing cells were inoculated on PLL-coated slides in 24-well plates and cultured for 24 h;

[0091] (2) The culture medium was discarded, and the cells were washed with PBS and fixed with 4% paraformaldehyde (Biosharp, China) for 30 min;

[0092] (3) Add blocking solution (Beyotime, China) and block for 30 min;

[0093] (4) Incubate with primary antibody against neurotrophin receptor P75 (P75NTR) marker (abcam, USA) at 4°C overnight;

[0094] (5) After washing with PBS, the corresponding fluorescent secondary antibody (Bioss, China) was incubated at 37°C for 60 min;

[0095] (6) After washing with PBS, DAPI (Beyotime, China) was added to stain the cell nucleus for 5 min;

[0096] (7) Observe the expression of olfactory ensheathing cell marker P75NTR under immunofluorescence microscopy. Figure 4 As shown: Figure 4 a is the P75NTR staining image (red), Figure 4 b is the cell nucleus staining (also called DAPI staining) (blue), Figure 4 c is the Merge staining image (Merge is an image processing method that superimposes multiple staining images to simultaneously display the locations of different markers in cells). Figure 4 d is the positive rate of P75NTR in primary olfactory ensheathing cells OECs. The results showed that primary olfactory ensheathing cells from the olfactory bulb can express neurotrophic factor receptor P75 (P75NTR), and the positive rate of P75NTR is above 90%, with high purity.

[0097] 3. Use the conditional immortalized lentivirus TetOn-SV40Tag to perform lentiviral transfection on primary olfactory ensheathing cells to produce an olfactory ensheathing cell line.

[0098] (1) Setting the MOI gradient, which in this embodiment are 3 / 10 / 20 / 30 / 50 respectively, and calculating the volume of lentivirus required for each MOI value according to the MOI calculation formula MOI = lentivirus titer (IU / mL) × virus volume (mL) / number of transfected cells;

[0099] (2) Primary olfactory ensheathing cells were plated in 24-well plates, and virus transfection was performed 24 hours later. The fluorescence results were observed 48-72 hours after transfection to select the optimal MOI value. Figure 5 a is the green fluorescence image of olfactory ensheathing cells corresponding to different MOI values ​​in the bright field of the microscope, the dark field of the microscope and after merging. Figure 5 b is the green fluorescence intensity of olfactory ensheathing cells corresponding to different MOI values; the results show that when the MOI is 30, the primary olfactory ensheathing cells have the best transfection efficiency, that is, the best multiplicity of infection is 30;

[0100] (3) Primary olfactory ensheathing cells were seeded into 6-well plates at a density of 70% and infected with viruses 24 h later;

[0101] (4) Remove the original culture medium in the 6-well plate, add 2 mL of complete culture medium, and add an appropriate amount of TetOn-SV40Tag conditional immortalized lentivirus (MOI = 30) for incubation;

[0102] (5) After 24 h, replace the complete medium and continue culturing;

[0103] (6) After 72 hours, puromycin selection and subculture were performed according to the cell growth status.

[0104] 4. The olfactory ensheathing cell line was continuously subcultured under the preset induction conditions (the presence of tetracycline) to obtain a conditionally immortalized olfactory ensheathing cell line, and the cells of each generation of the conditionally immortalized olfactory ensheathing cell line were morphologically observed and identified by immunofluorescence staining.

[0105] (1) Morphological observation.

[0106] After successful lentiviral transfection, the constructed olfactory ensheathing cell line was serially subcultured, and the cell morphology was observed under an optical microscope every three generations (P4, P7, and P10). Figure 6 Microscopic morphological images of primary olfactory ensheathing cells OECs, 4th generation olfactory ensheathing cells P4, 7th generation olfactory ensheathing cells P7 and 10th generation olfactory ensheathing cells P10 under a 20x objective lens (20X) and a 40x objective lens (40X), respectively, are shown.

[0107] The results showed that under tetracycline conditions, cells of each generation, P4, P7, and P10, stably presented two cell morphologies: typical astrocyte-like olfactory ensheathing cell morphology (flat shape) and Schwann cell-like olfactory ensheathing cell morphology (spindle shape).

[0108] (2) Immunofluorescence identification.

[0109] The olfactory ensheathing cell line is continuously subcultured under preset induction conditions to obtain a conditionally immortalized olfactory ensheathing cell line.

[0110] After successful lentiviral transfection, the constructed olfactory ensheathing cell line was serially subcultured, and immunofluorescence staining was performed every three generations (P4, P7, and P10) to detect the expression of the olfactory ensheathing cell marker (P75NTR) in the cells. Figure 7 a is the microscope image of each generation of cells (primary olfactory ensheathing cells OECs, 4th generation olfactory ensheathing cells P4, 7th generation olfactory ensheathing cells P7 and 10th generation olfactory ensheathing cells P10) after P75NTR staining, DAPI staining and merging. Figure 7 b is the quantitative statistical result of the proportion of P75NTR positive cells in the total cells of each generation. The results showed that the neurotrophin receptor P75 (P75NTR) marker was positively expressed in cells of each generation P4, P7, and P10, with a positive rate of more than 90% and a stable purity.

[0111] 5. Conditional immortalization - Immortality detection of olfactory ensheathing cell lines under tetracycline regulation.

[0112] Primary olfactory ensheathing cells (OECs) and conditionally immortalized olfactory ensheathing cells (P10) infected with TetOn-SV40Tag conditional immortalized lentivirus and passed to the 10th generation under the action of tetracycline were taken. tet+ , and conditionally immortalized olfactory ensheathing cells P10 after tetracycline removal at passage 10 tet- ; RNA was extracted from each group of cells, and the expression level of SV40Tag gene in each group of cells was detected by real-time quantitative polymerase chain reaction (RT-qPCR). The specific results are as follows Figure 8 The sequences of SV40Tag and internal reference primers are shown in Table 1 above.

[0113] Figure 8 The results showed that compared with primary olfactory ensheathing cells (OECs), P10 tet+ The expression of SV40Tag gene in cells increased significantly, and the removal of tetracycline-stimulated P10 tet- The expression of SV40Tag gene in cells was significantly reduced to a level similar to that of primary OECs.

[0114] 6. Compare the proliferation ability of this cell line (i.e., comparison olfactory ensheathing cell line) with that of primary olfactory ensheathing cells after removing tetracycline induction conditions.

[0115] The three groups of cells OECs, P10 tet+ 、P10 tet- CCK-8 cell proliferation assay (a commonly used method for detecting cell proliferation and viability) was performed respectively. Fig. 9 As shown, P10 tet+ The proliferation activity of cells was higher, while that of OECs group and P10 tet- The proliferation activity of cells in the two groups was similar, indicating that the conditionally immortalized OECs under the action of tetracycline had a higher proliferation activity. After the removal of tetracycline, the proliferation ability of the cells decreased and partially recovered to a level similar to that of primary OECs.

[0116] 7. Compare the migration ability of this cell line (i.e., comparison olfactory ensheathing cell line) with that of primary olfactory ensheathing cells after removing tetracycline induction conditions.

[0117] (1) Three groups of cells: OECs, P10 tet+ 、P10 tet- Scratch tests were performed separately. Fig.10 (a) shows three groups of cells: OECs, P10 tet+ 、P10 tet- Scratch area images at 0h, 48h, and 96h, Fig.10 (b) is the comparison result of the migration rate between cells in each group at 48h and 96h after scratching. Fig.10 (c) shows the comparison of migration rates of different groups of cells at 48h and 96h. The results show that the SV40Tag gene has little effect on the migration ability of OECs, and after removing tetracycline, the OECs can basically recover to a migration level similar to that of primary OECs.

[0118] (2) The three groups of cells, OECs, P10 tet+ 、P10 tet- Transwell experiments were performed separately. Fig.11 (a) shows the cell migration images of the three groups of cells 24 hours after seeding. Fig.11 (b) is the semi-quantitative analysis result of the relative cell number between each group of cells. This result is basically consistent with the result of the scratch test.

[0119] In this protocol, the olfactory ensheathing cell line that continuously proliferates under tetracycline conditions mainly presents typical astrocyte-like olfactory ensheathing cell morphology (flat shape) and Schwann cell-like olfactory ensheathing cell morphology (spindle shape), expresses the human SV40Tag gene and is positive for the neurotrophin receptor P75 (P75NTR) marker; and after removing the tetracycline-inducing conditions, the expression of the SV40Tag gene is significantly reduced, and the cells can basically recover to a proliferation and migration level similar to that of primary olfactory ensheathing cells, indicating that the conditionally immortalized olfactory ensheathing cell line is basically established.

[0120] At present, there is still a lack of immortalized olfactory ensheathing cell lines and their preparation technologies with the advantages of low cost, simple culture, multiple passages, good uniformity, high safety, and retention of the characteristics of primary olfactory ensheathing cells in China. This application extracts primary olfactory ensheathing cells from rat olfactory bulbs and processes them with conditional immortalization technology to obtain conditional immortalized-olfactory ensheathing cell lines, filling the technical gap in the domestic industry. Previous studies have shown that olfactory ensheathing cells have shown outstanding performance in cell therapy for a variety of nerve injuries and neurodegenerative diseases. However, so far, basic and clinical research on olfactory ensheathing cells has not been widely and extensively carried out; and from a commercial point of view, there is no reliable immortalized olfactory ensheathing cell line product on the market. On the one hand, due to the uneven extraction levels of primary olfactory ensheathing cells by various research teams, there is no unified standard, resulting in low credibility of the research results; on the other hand, due to the high requirements for the separation and purification technology of primary olfactory ensheathing cells, the long culture cycle, and the problem of insufficient quantity sources due to the poor proliferation and passage ability of the cells themselves, it is difficult to conduct corresponding functional experiments and cannot fully meet the needs of various studies. Therefore, researchers have been eager to solve the above problems, so as to obtain a considerable number of olfactory ensheathing cells in a relatively short period of time. The technical solution of this application overcomes this technical difficulty. The successful construction of this cell line not only solves the problem of the number of olfactory ensheathing cells, but also has the advantages of simple preparation operation, low cost, short culture cycle, good uniformity, high safety, and retention of primary characteristics, thereby meeting the needs of related research and effectively solving the problem of cell source that has troubled researchers in conducting research or application related to olfactory ensheathing cells.

[0121] In another embodiment of the present application, a conditionally immortalized olfactory ensheathing cell line is provided, which is constructed by the aforementioned method. The proliferation ability of the conditionally immortalized olfactory ensheathing cell line under tetracycline-induced culture conditions is better than that of primary olfactory ensheathing cells, and the migration ability of the conditionally immortalized olfactory ensheathing cell line under tetracycline-induced culture conditions is not statistically different from that of primary olfactory ensheathing cells.

[0122] Therefore, the provided conditionally immortalized olfactory ensheathing cell line at least partially retains the cell characteristics of primary olfactory ensheathing cells, but has better proliferation ability and can serve as a stable source of olfactory ensheathing cells.

[0123] It should be noted that the conditionally immortalized OECS cell line can also be used as an in vitro tool cell model for studying the functional characteristics of OECS.

[0124] In summary, the conditionally immortalized olfactory ensheathing cell line preparation technology provided in this application can significantly make up for the quantitative deficiency of primary olfactory ensheathing cells due to their inherent insufficient proliferation and translocation ability. On the basis of retaining the basic functions of primary olfactory ensheathing cells (proliferation and migration), a considerable number of olfactory ensheathing cells with high purity can be harvested in a short period of time; and its translocation ability is artificially controllable, stable, and highly safe; this preparation technology can also be applied to the construction of human-derived olfactory ensheathing cell lines, and is expected to become a reliable cell source for the treatment of neurotrauma and neurodegenerative diseases.

[0125] Details not disclosed in the embodiments of the present application may be understood by referring to the description of the aforementioned embodiments.

[0126] The above are only preferred embodiments of the present application and are not intended to limit the protection scope of the present application.

[0127] It should be noted that, in this application, the terms "include", "comprises" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, an element defined by the sentence "includes a ..." does not exclude the existence of other identical elements in the process, method, article or device including the element.

[0128] The serial numbers of the above-mentioned embodiments of the present application are for description only and do not represent the advantages or disadvantages of the embodiments.

[0129] The methods disclosed in several method embodiments provided in this application can be arbitrarily combined without conflict to obtain new method embodiments.

[0130] The features disclosed in several product embodiments provided in this application can be arbitrarily combined without conflict to obtain new product embodiments.

[0131] The features disclosed in several method or device embodiments provided in this application can be arbitrarily combined without conflict to obtain new method embodiments or device embodiments.

[0132] The above is only a specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any person skilled in the art who is familiar with the present technical field can easily think of changes or substitutions within the technical scope disclosed in the present application, which should be included in the protection scope of the present application. Therefore, the protection scope of the present application should be based on the protection scope of the claims.

Claims

1. A method for constructing a conditionally immortalized olfactory ensheathing cell line, characterized in that: The method comprises: S11: Obtain primary olfactory ensheathing cells using animal olfactory bulb tissue; S12: culturing the primary olfactory ensheathing cells for a preset number of days, and performing marker detection on the cultured primary olfactory ensheathing cells; the marker detection is used to determine the purity of the cells; S13: When the result of the marker detection meets the expected target, the primary olfactory ensheathing cells are subjected to lentiviral transfection operation using conditionally immortalized lentivirus to generate an olfactory ensheathing cell line; S14: Continuously subculturing the olfactory ensheathing cell line under preset induction conditions to obtain a conditionally immortalized olfactory ensheathing cell line; wherein the preset induction conditions are determined based on the conditionally immortalized lentivirus.

2. The construction method according to claim 1, characterized in that: The conditionally immortalized lentivirus comprises an immortalized gene fragment SV40Tag and a tetracycline conditional control system Tet-On element; wherein the Tet-On element enables the SV40Tag to be expressed under the condition of the presence of tetracycline, and the Tet-On element inhibits the expression of the SV40Tag under the condition of the removal of tetracycline; The preset induction condition is tetracycline or tetracycline analogue induction.

3. The construction method according to claim 1, characterized in that: The conditionally immortalized olfactory ensheathing cell line presents astrocyte-like olfactory ensheathing cell morphology and Schwann cell-like olfactory ensheathing cell morphology, and the conditionally immortalized olfactory ensheathing cell line expresses nerve growth factor receptor P75NTR protein; There is no statistical difference in the migration ability of the primary olfactory ensheathing cells and the conditionally immortalized olfactory ensheathing cell line; there is a statistical difference in the proliferation ability of the primary olfactory ensheathing cells and the conditionally immortalized olfactory ensheathing cell line, and the proliferation ability of the conditionally immortalized olfactory ensheathing cell line is better than that of the primary olfactory ensheathing cells.

4. The construction method according to claim 1, characterized in that: In the process of continuously subculturing the olfactory ensheathing cell line under preset induction conditions, the method further comprises: Performing marker detection on the obtained olfactory ensheathing cell line every preset number of generations; if the result of the marker detection meets the expected target, continuing to perform continuous subculture on the olfactory ensheathing cell line; Wherein, the marker detection adopts immunofluorescence staining method, and the marker is P75NTR protein.

5. The construction method according to claim 1, characterized in that: After step S14, the method further includes: S15: after removing the preset induction conditions, culturing the conditionally immortalized-olfactory ensheathing cell line to produce a control olfactory ensheathing cell line; There is no statistical difference in the migration ability between the comparison OECs and the primary OECs, and the proliferation ability of the comparison OECs and the primary OECs is weaker than that of the conditionally immortalized OECs.

6. The construction method according to claim 1, characterized in that: Before step S13, the method further includes: The volume of the conditionally immortalized lentivirus was calculated using the multiplicity of infection formula for the optimal multiplicity of infection; wherein the multiplicity of infection formula is: MOI=lentivirus titer (IU / mL)×virus volume (mL) / number of transfected cells, and MOI refers to the multiplicity of infection.

7. The construction method according to claim 1, characterized in that: Step S11 specifically includes: S111: Take the olfactory bulb tissue of the rat, cut the olfactory bulb tissue after removing the meninges in a pre-cooled PBS solution until it becomes viscous, blow the obtained solution with a pipette tip and centrifuge it, and discard the supernatant to obtain the solution to be digested; S112: digesting, terminating, centrifuging, and discarding the supernatant of the solution to be digested, and configuring the treated precipitate into a single cell suspension using a complete culture medium; S113: performing a secondary differential adhesion purification process on the single cell suspension, and using the purified single cell suspension for culturing to produce the primary olfactory ensheathing cells.

8. The construction method according to claim 7, characterized in that: Step S113 specifically includes: Plating and culturing the single cell suspension; The secondary adherent cells were obtained and reconfigured into a single cell suspension, and the resulting single cell suspension was plated on a culture dish coated with a 0.01% poly-lysine solution PLL, and cultured in a 37° C., 5% CO 2 incubator.

9. The construction method according to claim 1, characterized in that: The method further comprises: After the lentivirus transfection, the expression level of the SV40Tag was detected; wherein, the forward primer sequence of the target gene SV40Tag used for detection was GTGGCATTGCTTTGCTTCTTA, and the reverse primer sequence was GTCCAATCTCTCTTTCCACTCC; the forward primer sequence of the internal reference gene GAPDH used for detection was ACAGCAACAGGGTGGTGGAC, and the reverse primer sequence was TTTGAGGGTGCAGCGAACTT.

10. A conditionally immortalized olfactory ensheathing cell line, characterized in that: The conditionally immortalized olfactory ensheathing cell line is constructed by the method according to any one of claims 1 to 9.

Images