A lipase mutant and its application
By performing site-directed amino acid mutations on lipase CALB, recombinant genetically engineered bacteria were constructed, and the problem of low enzyme selectivity in the prior art was solved, and efficient and low-cost industrial production of (S)-3-cyclohexene-1-formic acid was achieved.
Patent Information
- Application Number
- CN202510027385.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-08
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2045-01-08
AI Technical Summary
The existing methods for biological enzyme catalyzing the preparation of (S)-3-cyclohexene-1-formic acid have low enzyme selectivity and low catalytic efficiency, which is difficult to be applicable to industrial production, and there is a lack of reports on the catalytic synthesis of (S)-3-cyclohexene-1-formic acid of lipase CALB.
By performing site-directed amino acid mutations on Candida Antarctic lipase B (CALB), the mutation sites were designed as positions 40, 134, 154, 189, 278, and 281, the recombinant lipase CALB mutant was constructed and expressed in E. coli to form a recombinant genetically engineered bacteria, which was used to catalyze the resolution of racemic 3-cyclohexene-1-carboxylate methyl ester.
The stereoselectivity and catalytic activity of lipase CALB are improved, production costs are reduced, industrial production is achieved, reaction conditions are mild, environmentally friendly, and conversion rate and optical purity are significantly improved.
Smart Images

Figure CN119432809B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the fields of biopharmaceuticals and biotransformation, and particularly relates to a lipase mutant and its application. Background Art
[0002] Lipase has good catalytic ability for reactions such as hydrolysis, transesterification, esterification, and transesterification, and is widely used in industries such as food, chemical engineering, medicine, and bioenergy. Lipases derived from microorganisms have become the main source of lipases in industrial applications. Candida antarctica lipase B (CALB) is derived from Candida antarctica. Due to its excellent catalytic activities such as ester synthesis, hydrolysis, and transesterification, CALB is widely used in fields such as food, medicine, and chemical engineering.
[0003] (S)-3-Cyclohexene-1-carboxylic acid, as a chiral compound, is an important chemical reagent or pharmaceutical intermediate and is widely used in multiple fields such as medicine and chemical engineering. (S)-3-Cyclohexene-1-carboxylic acid can be used to produce (S)-3,4-diaminocyclohexanecarboxylic acid, which is a key chiral building block of the coagulation factor Xa (fXa) inhibitor edoxaban (trade name: Savaysa). This drug is used to treat cancer-related venous thromboembolism. Compared with the same type of coagulation factor Xa inhibitor drugs such as rivaroxaban and apixaban, it has outstanding advantages such as a small renal burden, a small bleeding risk, and safety and reliability, and has a broad market prospect. And (S)-3-Cyclohexene-1-carboxylic acid, as the key intermediate of this drug, its efficient preparation technology has become a research hotspot.
[0004] Currently, there are mainly three methods for the synthesis of chiral 3-cyclohexene-1-carboxylic acid: the Diels-Alder reaction, the chemical method of racemic acid resolution, and the enzymatic method of asymmetric hydrolysis resolution of methyl 3-cyclohexene-1-carboxylate. Among them, the Diels-Alder reaction is the main method for the synthesis of chiral 3-cyclohexene-1-carboxylic acid at present. However, in this reaction, butadiene is a gas and the product is not easy to separate, the reaction steps are numerous, and the final yield is low. This method still needs to be further improved. The separation of the chemical method of racemic acid resolution requires at least six recrystallization processes in acetone. This chemical resolution method not only consumes a large amount of acetone, but also the resolution yield is only between 20-30%, and the economic performance is low. It can be seen that the synthesis of chiral 3-cyclohexene-1-carboxylic acid by the chemical method has problems such as numerous operation steps, low yield, and consumption of a large amount of acetone. The use of biocatalysts to catalyze the resolution of chiral compounds has the advantages of mild reaction conditions, high stereoselectivity, low pollution, and simple operation, which makes it an important way to replace or supplement traditional chemical synthesis routes in the process of promoting sustainable development.
[0005] In 2004, Cihangir T et al. studied three enzymes: porcine liver esterase (PLE), horse liver esterase (HLE), and porcine pancreatic lipase (PPL), which have the function of hydrolyzing racemic methyl 3-cyclohexene-1-carboxylate. The results showed that the hydrolysis products of PLE and HLE were both (S)-3-cyclohexene-1-carboxylic acid, and the ee values exceeded 99% and reached 97% respectively; while the hydrolysis product of PPL was (R)-3-cyclohexene-1-carboxylic acid, with an ee value of 91%. However, all three of these enzymes are from animals and face multiple challenges in practical applications as commercial enzymes, including: high costs, interference from isoenzymes, significant differences between batches, and potential risks of virus contamination.
[0006] In 2019, Dou Zhe et al. used methyl 3-cyclohexene-1-carboxylate as a substrate to screen wild strains and successfully discovered a strain named Acinetobacter sp. JNU9335, which could selectively catalyze the hydrolysis of the substrate, leaving behind (S)-methyl 3-cyclohexene-1-carboxylate. Through further hydrolysis under alkaline conditions, the target product (S)-3-cyclohexene-1-carboxylic acid was obtained. In a 50 mL reaction, 3.50 g of racemic methyl 3-cyclohexene-1-carboxylate was added and reacted for 12 h, and finally the target product with a yield of 40% and an e.e. value as high as 99% was obtained. In 2020, Dou Zhe et al. successfully obtained cyclohexene formate hydrolase AcEst1 and its mutants. Using the crude enzyme powder of the mutant F78V / A202K / G326A with enhanced activity, 58.7 g of racemic methyl 3-cyclohexene-1-carboxylate could be catalyzed, leaving behind (S)-methyl 3-cyclohexene-1-carboxylate. Through alkaline hydrolysis treatment, 22.3 g of (S)-3-cyclohexene-1-carboxylic acid was obtained, with a yield of 38%, and the gas chromatography (GC) purity of the product was 99%, and the optical purity was as high as 99.5% e.e. Then in 2021, Dou Zhe et al. also disclosed a novel carboxylesterase CarEst3 and its mutants, which have excellent catalytic ability and can process up to 500 g / L of racemic methyl 3-cyclohexene-1-carboxylate, and finally the total yield of (S)-3-cyclohexene-1-carboxylic acid obtained was 37%, and the optical purity was 99% e.e.
[0007] Compared with the traditional chemical synthesis method, the method for preparing (S)-3-cyclohexene-1-carboxylic acid by biocatalytic enzyme has the advantages of mild reaction conditions, high enantioselectivity, environmental friendliness and simple operation. However, at present, the preparation method of (S)-3-cyclohexene-1-carboxylic acid is limited to the laboratory scale, and there are also defects such as low enzyme selectivity resulting in low product yield, which is not suitable for industrial production, and there is a lack of reports on the catalytic synthesis of (S)-3-cyclohexene-1-carboxylic acid by lipase CALB. Therefore, it is necessary to screen mutants of lipase CALB with high catalytic efficiency and enantioselective complementarity to meet the demand for industrial production of (S)-3-cyclohexene-1-carboxylic acid. Summary of the Invention
[0008] The present invention aims to overcome the defects in the prior art that the process for preparing (S)-3-cyclohexene-1-carboxylic acid by biocatalytic enzyme has low enzyme selectivity, resulting in low product yield, low catalytic efficiency and difficulty in being applicable to industrial production. The present invention provides a lipase mutant, a mutant-encoding gene, a recombinant vector containing the mutant-encoding gene, a recombinant genetic engineering bacterium containing the mutant-encoding gene, and applies the lipase mutant to the industrial production process of preparing (S)-3-cyclohexene-1-carboxylic acid.
[0009] To achieve the above-mentioned invention objectives, the present invention is realized through the following technical solutions:
[0010] A lipase CALB mutant is derived from the amino acid sequence shown in SEQ ID NO.1 by site-directed mutagenesis, and the mutated site is one or more of the following: (1) position 40, (2) position 134, (3) position 154, (4) position 189, (5) position 278, (6) position 281.
[0011] Preferably, the lipase CALB mutant is derived from the amino acid sequence shown in SEQ ID NO.1 by site-directed mutagenesis, and the mutated site is one or two of the following: (2) position 134, (6) position 281.
[0012] Preferably, the mutant is obtained by mutating the amino acid sequence shown in SEQ ID NO.1 at one or more of the following sites: (1) mutating threonine at position 40 to lysine, (2) mutating aspartic acid at position 134 to serine, (3) mutating valine at position 154 to isoleucine, (4) mutating isoleucine at position 189 to arginine, (5) mutating lysine at position 278 to aspartic acid, (6) mutating alanine at position 281 to glutamine.
[0013] A nucleic acid molecule, which contains the coding sequence of the lipase CALB mutant as described above.
[0014] A recombinant vector, said recombinant vector containing the coding sequence as described above.
[0015] A recombinant genetically engineered bacterium, said recombinant genetically engineered bacterium containing the recombinant vector as described above.
[0016] Preferably, said recombinant genetically engineered bacterium uses Escherichia coli as the expression host.
[0017] The present invention provides a coding gene of a recombinant lipase CALB mutant, a recombinant vector containing the coding gene, and a recombinant genetically engineered bacterium constructed with the recombinant vector. The expression vector is pET28b(+), and the host of the recombinant genetically engineered bacterium is E. coli BL21(DE3).
[0018] The recombinant lipase CALB mutant of the present invention is obtained by mutating multiple specific amino acid sites of the wild-type lipase CALB, with the aim of enhancing its enantioselective resolution ability for racemic methyl 3-cyclohexene-1-carboxylate. First, the coding gene of the wild-type Candida antarctica lipase B (whose sequence is shown in SEQ ID NO.2) is ligated to the expression vector pET28b(+) plasmid to construct a recombinant expression plasmid. Then, the successfully constructed recombinant expression plasmid is transformed into E. coli BL21(DE3). Using the recombinant expression plasmid containing the lipase CALB coding gene as a template, gene modification is carried out by site-directed mutagenesis technology, and then the successfully constructed recombinant plasmid is transformed into E. coli BL21(DE3) to obtain a recombinant genetically engineered bacterium containing the coding gene of the recombinant lipase CALB mutant. The obtained recombinant genetically engineered bacterium is fermented and cultured, induced to express, and the fermentation broth is centrifuged to obtain wet cell bodies containing the recombinant lipase CALB mutant. The wet cell bodies are resuspended in phosphate buffer solution, and under ice bath conditions, ultrasonic disruption is carried out, and the supernatant is collected by low-temperature centrifugation to finally obtain a crude enzyme solution of the lipase CALB mutant. The stereoselectivity of the mutant lipase CALB is compared with that of the wild-type lipase CALB to screen mutants with excellent resolution performance.
[0019] Use of the lipase CALB mutant as described above in the preparation of (S)-3-cyclohexene-1-carboxylic acid.
[0020] Preferably, said use is as follows: Phosphate buffer solution, methyl 3-cyclohexene-1-carboxylate, wet cell bodies obtained by fermenting and culturing a recombinant genetically engineered bacterium containing the coding gene of the lipase CALB mutant, or a crude enzyme solution extracted after ultrasonic disruption of the wet cell bodies are mixed evenly, and a catalytic reaction is carried out to obtain (S)-3-cyclohexene-1-carboxylic acid.
[0021] Compared with the preparation of (S)-3-cyclohexene-1-carboxylic acid by traditional chemical methods, the lipase CALB mutant provided by the present invention has high stereoselectivity, mild reaction conditions, is environmentally friendly, and has low requirements for equipment, greatly reducing production costs and showing broad application prospects in industrial production. The lipase CALB provided by the present invention has high catalytic activity, enabling mild reaction conditions, high substrate conversion rate, high enantioselectivity, reduced production costs and environmental friendliness. By designing mutations at multiple different sites of amino acids, the present invention can improve the catalytic activity and stereoselectivity of lipase CALB towards racemic methyl 3-cyclohexene-1-carboxylate. The present invention has the advantages of mild reaction conditions, high substrate concentration, high stereoselectivity, simple catalyst treatment steps and environmental friendliness. For example, at 10°C, 40 g / L of the lipase CALB mutant can catalyze 70 g / L of racemic methyl 3-cyclohexene-1-carboxylate within 6 h, with a conversion rate of 52% and an e.e. p value of 72%.
[0022] Preferably, the reaction temperature of the catalytic reaction is 0~40°C, and the reaction time is 2~12 h.
[0023] More preferably, the reaction temperature of the catalytic reaction is 10°C, and the reaction time is 6 h.
[0024] Preferably, the concentration of phosphate in the phosphate buffer solution is 50~200 mM.
[0025] More preferably, the concentration of phosphate in the phosphate buffer solution is 200 mM.
[0026] Preferably, the phosphate buffer solution includes disodium hydrogen phosphate and sodium dihydrogen phosphate.
[0027] Preferably, the pH value of the phosphate buffer solution is 6~9.
[0028] More preferably, the pH value of the phosphate buffer solution is 7.
[0029] Preferably, the concentration of methyl 3-cyclohexene-1-carboxylate is 20~140 g / L.
[0030] More preferably, the concentration of methyl 3-cyclohexene-1-carboxylate is 70 g / L.
[0031] Preferably, the concentration of the wet bacterial cells obtained by fermentation culture of the recombinant genetic engineering bacteria containing the lipase CALB mutant encoding gene added in the catalytic reaction is 10~100 g / L.
[0032] As a further preference, the concentration of the wet bacterial cells obtained by fermenting and culturing the recombinant genetically engineered bacterium containing the gene encoding the lipase CALB mutant added in the catalytic reaction is 40 g / L.
[0033] As a preference, the method for extracting (S)-3-cyclohexene-1-carboxylic acid from the enzymatic reaction solution by an organic reagent comprises the following steps:
[0034] After the enzymatic reaction ends, an equal volume of 3M HCl is added to terminate the reaction, then twice the volume of the organic reagent ethyl acetate is added for extraction, and the extraction is carried out 3 times in total. The extracted organic phases are combined, anhydrous sodium sulfate is added to dry and remove the excess water, filtered, and (S)-3-cyclohexene-1-carboxylic acid is obtained after rotary evaporation.
[0035] As a preference, the method for preparing the wet bacterial cells comprises the following steps:
[0036] The engineered bacterium containing the gene encoding the recombinant lipase CALB mutant is inoculated into an LB liquid medium containing 50 μg / mL ampicillin resistance at a final concentration, cultured at 37 °C and 180 rpm for 10 - 12 h, and then inoculated into an LB liquid medium containing 50 μg / mL ampicillin resistance at a final concentration at an inoculation amount of 2% (v / v), cultured at 37 °C and 180 rpm until the OD600 of the bacterial cells is 0.6 - 0.8, 1 mM IPTG at a final concentration is added, induced and cultured at 28 °C and 180 rpm for 12 h, then centrifuged at 4 °C, 8000 rpm for 10 min, the supernatant is discarded, and the precipitate is collected to obtain the wet bacterial cells of the recombinant genetically engineered bacterium containing the gene encoding the recombinant lipase CALB mutant.
[0037] As a preference, the method for preparing the crude enzyme solution comprises the following steps:
[0038] The wet bacterial cells obtained by fermenting and culturing the engineered bacterium containing the gene encoding the recombinant lipase CALB mutant are resuspended with 9.6 mL of 200 mM sodium phosphate buffer solution with a pH of 7.0 for every 0.4 g of wet bacterial cells; the cell resuspension is ultrasonically disrupted under ice bath and a power of 60 W, lasting for 2 s, intermittent for 4 s, and continuously disrupted for 10 min to obtain a cell disruption solution; the cell disruption solution obtained after ultrasonic disruption is centrifuged at 8000 rpm and 4 °C for 10 min, and the supernatant obtained is the crude enzyme solution.
[0039] Therefore, the present invention has the following beneficial effects:
[0040] (1) By designing mutations at multiple different sites of amino acids, the present invention can improve the catalytic activity and stereoselectivity of lipase CALB towards racemic methyl 3-cyclohexene-1-carboxylate;
[0041] (2) The present invention has the advantages of mild reaction conditions, high substrate concentration, high stereoselectivity, simple catalyst treatment steps, and environmental friendliness. Moreover, the requirements for equipment are reduced, greatly reducing the production cost, showing broad application prospects in industrial applications;
[0042] (3) Compared with the preparation of (S)-3-cyclohexene-1-carboxylic acid by traditional chemical methods, the lipase CALB mutant provided by the present invention has high stereoselectivity and high conversion rate. At 10 °C, 40 g / L of the lipase CALB mutant can catalyze 70 g / L of racemic methyl 3-cyclohexene-1-carboxylate within 6 h, and the highest conversion rate can reach 52%, and the e.e. p value can reach up to 72%. Description of the Drawings
[0043] Figure 1 It is the SDS-PAGE diagram of lipase CALB.
[0044] Figure 2 It is a schematic diagram of the enzymatic resolution of racemic methyl 3-cyclohexene-1-carboxylate.
[0045] Figure 3 It is a schematic diagram of the high-performance gas chromatography (GC) detection of the product S / R-3-cyclohexene-1-carboxylic acid after 6 h of the catalytic reaction of the recombinant lipase CALB mutant CALB-D134S / A281Q.
[0046] Figure 4 It is a schematic diagram of the conversion rates of wild-type lipase CALB and recombinant lipase CALB mutant.
[0047] Figure 5 It is a schematic diagram of the e.e.p values of wild-type lipase CALB and recombinant lipase CALB mutant. Detailed Embodiments
[0048] The present invention will be further described below in conjunction with the drawings of the specification and specific embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are usually only a part of the embodiments of the present invention, rather than all of the embodiments. Therefore, all other embodiments obtained by those of ordinary skill in the art without creative efforts based on the embodiments of the present invention shall fall within the scope of protection of the present invention.
[0049] Example 1: Construction of the genetic engineering bacterium E. coli BL21(DE3) / CALB of lipase CALB
[0050] The lipase B (CALB) gene sequence from Candida antarctica in the gene bank (the amino acid sequence is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2) was synthesized by whole gene synthesis and transferred into the vector pET28b(+) plasmid to obtain the pET28b(+)-CALB recombinant plasmid. This recombinant plasmid was transformed into E. coli BL21(DE3) to obtain the wild-type lipase CALB genetically engineered bacterium E. coli BL21(DE3) / CALB, and the corresponding lipase was denoted as wild-type lipase CALB.
[0051] Example 2: Site-directed mutagenesis to construct the recombinant esterase mutant genetically engineered bacterium E. coli BL21(DE3) / CALB-muts
[0052] Primers were synthesized according to the mutation sites, and the pET28b(+)-CALB recombinant plasmid containing the gene encoding Candida antarctica lipase B was used as a template for site-directed mutagenesis by PCR extension amplification (the site-directed mutagenesis primers are shown in Table 1).
[0053] Table 1: Nucleic acid sequences of the primers
[0054] Primer Name Sequence (5’-3’) T40K-R ATTTTACTGGTTCCAGGAAAGGGTACTACTGGA T40K-L TCCTGGAACCAGTAAAATAGGTTTACTAACGGA D134S-R CTTATGGCCTTTGCTCCTTCTTACAAAGGTACCG D134S-L AGGAGCAAAGGCCATAAGTCTGTCGACCTTTGA V154I-R GCAGTGTCCGCTCCTTCCAGGTGGCAACAAACC V154I-L GGAAGGAGCGGACACTGCCAAGGCGTCAAGTGG I189R-R TACTCAGCTACAGACGAAAGGGTTCAGCCTCAA I189R-L TTCGTCTGTAGCTGAGTATAGGTTAGTAGTGGG L278N-R GTCGCTGCCGCAGCCCTGAATGCTCCAGCAGCT L278N-L CAGGGCTGCGGCAGCGACCTTTTGTTCAGGGGT A281Q-R GCAGCCCTGCTGGCTCCACCAGCTGCCGCTATC A281Q-L TGGAGCCAGCAGGGCTGCGGCAGCGACCTTTTG
[0055] The PCR reaction procedure is as follows: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 3 min, repeated for 30 cycles; continue to extend at 72°C for 10 min. Add DpnI to the product after the PCR reaction and incubate at 37°C for 3 h. After the treatment, inactivate at 80°C for 10 min, and then chemically transform it into E. coli BL21(DE3) competent cells. Spread it on an LB solid plate containing ampicillin resistance at a final concentration of 50 mg / L and culture at 37°C for 12 h. Randomly pick single colonies for sequencing analysis to obtain recombinant E. coli E. coli BL21(DE3) / CALB-muts containing the recombinant lipase CALB mutant gene, namely E. coli BL21(DE3) / CALB-T40K, E. coli BL21(DE3) / CALB-D134S, E. coli BL21(DE3) / CALB-V154I, E. coli BL21(DE3) / CALB-I189R, E. coli BL21(DE3) / CALB-L278N, E. coli BL21(DE3) / CALB-A281Q, E. coli BL21(DE3) / CALB-D134S / A281Q. The corresponding lipase CALB mutants are respectively denoted as mutant CALB-T40K, CALB-D134S, CALB-V154I, CALB-I189R, CALB-L278N, CALB-A281Q, CALB-D134S / A281Q.
[0056] Example 3: Preparation of wet cells of recombinant E. coli expressing lipase CALB mutants
[0057] Inoculate the recombinant E. coli E. coli BL21(DE3) / CALB-muts containing the recombinant lipase CALB mutant gene obtained in Example 2 into a 10 mL LB test tube medium containing ampicillin resistance at a final concentration of 50 μg / mL, culture at 37°C and 180 rpm for 10 - 12 h, and then inoculate it into a 100 mL LB shake flask medium containing ampicillin resistance at a final concentration of 50 μg / mL at an inoculation amount of 2% (v / v). Culture at 37°C and 180 rpm until the cell OD600 reaches 0.6 - 0.8. Add IPTG at a final concentration of 1 mM and culture at 28°C for 12 h. Then centrifuge at 4°C and 8000 rpm for 10 min, discard the supernatant, and collect the precipitate to obtain the wet cells of recombinant E. coli expressing the recombinant lipase CALB mutant gene. The wet cells can be directly used as biocatalysts or for the preparation of crude enzyme solutions. Prepare the wet cells of recombinant E. coli E. coli BL21(DE3) / CALB expressing the recombinant lipase CALB gene by the same method.
[0058] Example 4: Preparation of crude enzyme solution of recombinant esterase and its mutants
[0059] Preparation of crude enzyme solution of recombinant lipase CALB: The wet cells collected according to the method in Example 3 were resuspended with 9.6 mL of 200 mM sodium phosphate buffer solution with pH 7.0 per 0.4 g of wet cells, and ultrasonic disruption was carried out under ice bath conditions (60 W power, continuous for 2 s, intermittent for 4 s, continuously disrupted for 10 min), and then the cell disruption solution was obtained. The cell disruption solution obtained after ultrasonic disruption was centrifuged at 8000 rpm and 4 °C for 10 min, and the supernatant obtained was the required crude enzyme solution of recombinant lipase CALB. The SDS-PAGE diagrams of the cell disruption supernatant and precipitate of E. coli BL21(DE3) / CALB (i.e., the SDS-PAGE diagram of lipase CALB) are as Figure 1 shown. Among them, Figure 1 in the leftmost lane 1 from the left is the protein molecular weight Marker, lane 2 is the crude enzyme sample of lipase CALB of the original strain, and lane 3 is the disrupted precipitate sample of lipase CALB of the original strain. It can be found from Figure 1 that the recombinant lipase CALB exists in a soluble form.
[0060] Example 5: Stereoselectivity determination of lipase CALB
[0061] The wet cells of wild-type lipase CALB and recombinant lipase CALB mutants CALB-T40K, CALB-D134S, CALB-V154I, CALB-I189R, CALB-L278N, CALB-A281Q, CALB-D134S / A281Q obtained in Example 3 were respectively used to catalyze racemic methyl 3-cyclohexene-1-carboxylate.
[0062] The enzyme catalytic system and catalytic conditions are as follows: 40 g / L of wet cells were added, 70 g / L of racemic methyl 3-cyclohexene-1-carboxylate was added, and 200 mM sodium phosphate buffer solution with pH 7.0 was used to form a 10 mL reaction system, and the reaction was carried out at 10 °C and 700 rpm for 6 h. After the reaction was completed, 100 μL of the reaction solution was taken and added with an equal volume of 100 μL of 3 M HCl to terminate the reaction, and it was extracted three times with ethyl acetate, a total of 800 μL of ethyl acetate was added, centrifuged at 12000 rpm for 1 min, the aqueous phase and the organic phase were separated, the organic phase was collected and a certain amount of anhydrous sodium sulfate was added to dry and remove water, and 200 μL of the supernatant was taken after centrifugation at 12000 rpm for 1 min. The schematic diagram of the enzymatic resolution of racemic methyl 3-cyclohexene-1-carboxylate is as Figure 2 shown.
[0063] The supernatant contains: methyl (S)-3-cyclohexene-1-carboxylate, methyl (R)-3-cyclohexene-1-carboxylate, (S)-3-cyclohexene-1-carboxylic acid, and (R)-3-cyclohexene-1-carboxylic acid. The contents of the substrate (methyl (S)-3-cyclohexene-1-carboxylate, methyl (R)-3-cyclohexene-1-carboxylate) and the products ((S)-3-cyclohexene-1-carboxylic acid and (R)-3-cyclohexene-1-carboxylic acid) were detected by high-performance gas chromatography (GC), and the conversion rate and e.e. were calculated. p value. Among them, the schematic diagram of the high-performance gas chromatography (GC) detection of the product S / R-3-cyclohexene-1-carboxylic acid after the recombinant lipase CALB mutant CALB-D134S / A281Q catalyzed the reaction for 6 h is as Figure 3 shown. The schematic diagram of the conversion rate of wild-type lipase CALB and recombinant lipase CALB mutants is as Figure 4 shown. The schematic diagram of the e.e. p value of wild-type lipase CALB and recombinant lipase CALB mutants is as Figure 5 shown.
[0064] e.e. p The calculation formula of the value is as follows:
[0065] e.e. p / % = (Sp - Rp) / (Sp + Rp), where Sp represents the content of (S)-3-cyclohexene-1-carboxylic acid and Rp represents the content of (R)-3-cyclohexene-1-carboxylic acid.
[0066] The GC detection method is as follows: Trace1610 gas chromatograph (Thermo Fisher Trace1610); chiral gas column: B-DM (0.25 mm × 30 m × 0.12 mm), injection port temperature: 250 °C; FID detector temperature: 250 °C; air flow rate 350 mL / min, make-up gas flow rate 40 mL / min; constant pressure: 137.9 kPa; constant flow 1 mL / min. Column oven temperature program: initial temperature 50 °C, hold for 2 min, increase the temperature to 120 °C at 6 °C / min, hold for 2 min, increase the temperature to 144 °C at 2 °C / min, hold for 2 min.
[0067] Analysis shows that: compared with wild-type lipase CALB, the selectivity of lipase CALB with single-site mutations (T40K, D134S, V154I, I189R, L278N, A281Q) is significantly improved. The selectivity and conversion rate of lipase CALB with combined-site mutations (D134S / A281Q) are better than those of the wild type, and the highest conversion rate can reach 52%, e.e. Figures 2 - 5 p The value can reach up to 72%, indicating that by designing mutations at multiple different sites of amino acids, the present invention can significantly improve the activity and selectivity of lipase CALB.
[0068] In summary, the present invention creatively discovers that by designing mutations at multiple different sites of amino acids, the activity and stereoselectivity of lipase CALB in catalyzing racemic methyl 3-cyclohexene-1-carboxylate can be improved, which is more conducive to the production of (S)-3-cyclohexene-1-carboxylic acid, reduces production costs, is environmentally friendly, is conducive to large-scale production through microbial fermentation, and is more suitable for commercial and industrial applications.
[0069] The above description only details the preferred embodiments and principles of the present invention. For those of ordinary skill in the art, based on the idea provided by the present invention, there will be changes in the specific implementation manners, and these changes should also be regarded as the protection scope of the present invention.
Claims
1. A lipase CALB mutant, characterized in that, The mutant is derived from the amino acid shown in SEQ ID NO.1 by site-directed mutagenesis. The mutated sites are: aspartic acid at position 134 is mutated to serine, and alanine at position 281 is mutated to glutamine.
2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the lipase CALB mutant as claimed in claim 1.
3. A recombinant vector, characterized in that, The recombinant vector contains the coding sequence of the lipase CALB mutant as claimed in claim 1.
4. A recombinant genetically engineered bacterium, characterized in that, The recombinant genetically engineered bacterium contains the recombinant vector as claimed in claim 3.
5. The recombinant genetically engineered bacterium according to claim 4, wherein The recombinant genetically engineered bacterium uses Escherichia coli as the expression host.
6. Use of the lipase CALB mutant as claimed in claim 1 in the preparation of (S)-3-cyclohexene-1-carboxylic acid.
7. The application according to claim 6, characterized in that, The use is as follows: Phosphate buffer solution, methyl 3-cyclohexene-1-carboxylate, and the wet cells obtained by fermentation culture of the recombinant genetically engineered bacterium containing the coding gene of the lipase CALB mutant or the crude enzyme solution extracted after ultrasonic disruption of the wet cells are mixed evenly, and a catalytic reaction is carried out to obtain (S)-3-cyclohexene-1-carboxylic acid.
8. The application according to claim 7, characterized in that, The reaction temperature of the catalytic reaction is 0 to 40 °C, and the reaction time is 2 to 12 h.
Citation Information
Patent Citations
Lipase variants and polynucleotides encoding same
CN103827298A