TFO-containing three-strand nucleic acid, and kit and method for detecting target sequence by using TFO

Abstract

The present disclosure relates to a three-stranded nucleic acid comprising a double-stranded nucleic acid and a triplex forming oligonucleotide (TFO), in which the double-stranded nucleic acid comprises a first strand and a second strand complementary to the first strand, and the TFO is bonded to the first strand. According to certain embodiments of the present disclosure, the second strand comprises a plurality of modified nucleotides selected from the group consisting of 5-fluoro-uridine nucleotides, 5-chloro-uridine nucleotides, 5-bromo-uridine nucleotides, and 5-formyl-uridine nucleotides, respectively. The present disclosure also relates to kits and methods for detecting a target sequence of a double-stranded nucleic acid.

Description

Technical Field

[0001] The present disclosure relates to the field of detecting sequences. More specifically, the present disclosure relates to a method for detecting a target sequence in a double-stranded nucleic acid using a primer pair and a triplex forming oligonucleotide (TFO). Background Art

[0002] TFO is a single-stranded deoxyribonucleic acid (ssDNA) that can be embedded in the major groove of double-stranded DNA (dsDNA) in a sequence-specific manner to form a triple helix structure. Based on the sequence composition, TFOs can be divided into three categories, including: (i) TC-rich TFOs, which are composed of thymine (T) and cytosine (C) nucleotides and form parallel bonds with the polypurine chains of dsDNA, i.e., Hoogsteen base pairing, such as T*A=T or C*G≡C, where the symbols "=" and "≡" represent Watson-Crick base pairing between the two dsDNA chains, and the symbol "*" represents Hoogsteen base pairing between the dsDNA polypurine chain and the TFO; (ii) GA-rich TFOs, which are composed of guanine (G) and adenine (A) nucleotides and form antiparallel bonds with the polypurine chains of dsDNA, i.e., reverse Hoogsteen base pairing. pairing), such as G*G≡C or A*A=T; and (iii) GT-rich TFOs, which are composed of G and T nucleotides and can form parallel and antiparallel structures with dsDNA, i.e., G*G≡C and T*A=T.

[0003] Based on sequence specificity, TFOs have been widely used in various studies, including transcriptional regulation, genome modification (e.g., site-specific mutation, site-specific recombination, site-specific cleavage and gene silencing), DNA repair, and in situ hybridization. In addition, TFOs can also be used as therapeutic agents to treat diseases by changing (e.g., increasing or inhibiting) the expression of specific genes; or as diagnostic agents (e.g., probes) to detect the expression or mutation of disease-related genes. However, regardless of the binding specificity, the formation of triple helical structures is limited to DNA regions with one strand being purine and the other being pyrimidine, where TFOs can only bind to purine-rich strands. It is known that the binding affinity of TFO decreases by about 30 times for each additional pyrimidine nucleotide in the purine-rich strand. In order to improve the binding affinity of TFO to pyrimidine-containing strands, many studies have been devoted to modifying the sequence or structure of TFO. Unfortunately, these modifications have an adverse effect on the stability and / or solubility of TFO, and therefore, have not produced satisfactory results.

[0004] In view of this, the relevant field urgently needs a method for improving the binding affinity of TFO to the pyrimidine nucleotides of dsDNA. Summary of the invention

[0005] The purpose of the summary is to provide a simplified summary of the present disclosure so that readers can have a basic understanding of the present disclosure. This summary is not a complete overview of the present disclosure, and it is not intended to point out the important / critical elements of the embodiments of the present invention or to limit the scope of the present invention.

[0006] The first aspect of the present disclosure relates to a triple-stranded nucleic acid comprising a double-stranded nucleic acid and a TFO, wherein the double-stranded nucleic acid is a double-stranded DNA, comprising a first strand, and a second strand complementary to the first strand. According to certain embodiments of the present disclosure, the first strand of the double-stranded nucleic acid is a polypurine sequence, and the second strand is a polypyrimidine sequence, wherein the first strand is bonded to the TFO by Hoostein base pairing or reverse Hoostein base pairing, and the second strand comprises a plurality of modified nucleotides. In these embodiments, the modified nucleotides are respectively selected from the group consisting of 5-fluoro-uridine nucleotides, 5-chloro-uridine nucleotides, 5-bromo-uridine nucleotides, and 5-formyl-uridine nucleotides.

[0007] Preferably, in the polypurine sequence, the number of pyrimidine nucleotides is equal to or less than one.

[0008] According to certain embodiments, the double-stranded nucleic acid is prepared by a polymerase (e.g., DNA polymerase) catalyzed reaction, for example, polymerase chain reaction (PCR), loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), or other methods via nucleic acid polymerase amplification reactions.

[0009] According to certain embodiments, the double-stranded nucleic acid has 9-40 base pairs (bp). Preferably, the TFO is the same length as the double-stranded nucleic acid.

[0010] A second aspect of the present disclosure relates to a method for detecting a target sequence of a double-stranded nucleic acid. The method comprises: (a) mixing the double-stranded nucleic acid with a polymerase chain reaction reagent, wherein the PCR reagent comprises a forward primer, a reverse primer, a DNA polymerase, a reaction buffer, and deoxynucleotide triphosphates (dNTPs), wherein The forward primer is connected to the first fluorescent group; The dNTPs are composed of deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP) and modified deoxyuridine triphosphate (dUTP); wherein the modified dUTP is selected from the group consisting of 5-bromo-dUTP, 5-chloro-dUTP, 5-fluoro-dUTP and 5-formyl-dUTP. (b) subjecting the mixture of step (a) to PCR; (c) mixing the amplification product of step (b) with TFO to form a triple-stranded complex, wherein the TFO is linked to a second fluorescent group, wherein one of the first and second fluorescent groups is a donor fluorescent group and the other is an acceptor fluorescent group; (d) irradiating the product of step (c) with light having a first wavelength to excite the donor fluorescent group; and (e) measuring the signal emitted by the acceptor fluorescent group at a second wavelength to detect the target sequence.

[0011] According to an embodiment of the present disclosure, the PCR reagent does not contain deoxythymidine triphosphate (dTTP); therefore, the obtained PCR amplification product is composed of dATP, dCTP, dGTP and modified dUTP. According to certain embodiments of the present disclosure, the dUTP is selected from the group consisting of 5-bromo-dUTP (5-bromo-dUTP, hereinafter referred to as "Br-dUTP"), 5-chloro-dUTP (5-chloro-dUTP, hereinafter referred to as "Cl-dUTP"), 5-fluoro-dUTP (5-fluoro-dUTP, hereinafter referred to as "F-dUTP") and 5-formyl-dUTP (5-formyl-dUTP, hereinafter referred to as "Fml-dUTP"). In a preferred embodiment, the dUTP is Br-dUTP.

[0012] According to certain optional embodiments, the method of the present invention further comprises reacting the product of step (c) at 37° C. to 40° C. for 30-60 minutes to form a triple-stranded complex (ie, step (c-1)).

[0013] Preferably, the PCR reagent also contains MgCl2.

[0014] According to an exemplary embodiment, the acceptor fluorescent group and the donor fluorescent group are fluorescein isothiocyanate (FITC) and carboxy-X-rhodamine (ROX), respectively. In this embodiment, the first and second wavelengths are 485-495 nanometers (nm) and 600-605 nanometers, respectively.

[0015] According to certain embodiments, the TFO comprises a nucleotide sequence having 9-40 nucleotides and being substantially in the opposite direction to the chain amplified by the forward primer (ie, the nucleotide sequence of the TFO is substantially reverse complementary to the chain amplified by the reverse primer). Preferably, the TFO has 10-25 nucleotides.

[0016] According to certain embodiments, the first fluorescent group is attached to the 5' end of the forward primer, and the second fluorescent group is attached to the 3' end of the TFO. In an exemplary embodiment, the first fluorescent group is a donor fluorescent group, and the second fluorescent group is an acceptor fluorescent group.

[0017] It is understood that, in addition to target sequences amplified by PCR, the TFO of the present invention can also be used to detect or combine target sequences obtained by other methods, for example, LAMP, RPA, or target sequences obtained by other nucleic acid amplification methods.

[0018] A third aspect of the present disclosure provides a kit for detecting a target sequence of a double-stranded nucleic acid. According to certain embodiments of the present disclosure, the kit comprises: A forward primer and a reverse primer for amplifying a target sequence in PCR, wherein the forward primer is linked to a first fluorescent group; A TFO comprising a nucleotide sequence having 9-40 nucleotides and being substantially in the reverse direction of the chain amplified by the forward primer (i.e., the nucleotide sequence of the TFO is substantially reverse complementary to the chain amplified by the reverse primer), wherein the TFO is linked to a second fluorescent group; wherein one of the first and second fluorescent groups is a donor fluorescent group and the other is an acceptor fluorescent group; and dNTPs, which are composed of dATP, dCTP, dGTP and modified dUTP, wherein the modified dUTP is selected from the group consisting of Br-dUTP, Cl-dUTP, F-dUTP and Fml-dUTP.

[0019] The technical feature of the kit of the present invention is that it does not contain dTTP.

[0020] Preferably, the TFO has 10-25 nucleotides.

[0021] Preferably, the modified dUTP is Br-dUTP.

[0022] Optionally, the kit of the present disclosure further comprises a DNA polymerase, a reaction buffer and MgCl2.

[0023] In certain embodiments of the present disclosure, the first fluorescent group is attached to the 5' end of the forward primer, and the second fluorescent group is attached to the 3' end of the TFO. In an exemplary embodiment, the first fluorescent group is a donor fluorescent group, and the second fluorescent group is an acceptor fluorescent group.

[0024] According to certain embodiments of the present disclosure, in the nucleotide sequence of the TFO, the number of pyrimidine nucleotides (ie, T and C nucleotides) is equal to or less than one. Preferably, the TFO is composed of purine nucleotides, wherein the purine nucleotides may be A nucleotides or G nucleotides.

[0025] According to an exemplary embodiment, the target sequence is programmed death-ligand 1 (PD-L1). In this embodiment, the forward primer and the reverse primer comprise the nucleotide sequences of SEQ ID NO: 1 and 2, respectively, and the TFO comprises the nucleotide sequence of SEQ ID NO: 3.

[0026] After referring to the following embodiments, a person having ordinary knowledge in the technical field to which the present invention belongs can easily understand the basic principles and other invention purposes of the present invention, as well as the technical means and embodiments adopted by the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] To make the above and other objects, features, advantages and embodiments of the present invention more clearly understood, the accompanying drawings are described as follows:

[0028] Figure 1 This is a bar graph drawn according to Example 5 of the disclosure, used to illustrate the effect of Br-U modification on the binding affinity between dsDNA and TFO. PD-L1 Dx: PD-L1 gene fragment without Br-U modification; PDL1 Dx-Br-U: PD-L1 gene fragment modified with Br-U. RFU: relative fluorescence units. Implementation

[0029] In order to make the description of the present disclosure more detailed and complete, the following is an illustrative description of the implementation and specific examples of the present invention; however, this is not the only form of implementing or using the specific examples of the present invention. The implementation covers the features of multiple specific examples and the method steps and sequences for constructing and operating these specific examples. However, other specific examples can also be used to achieve the same or equivalent functions and step sequences.

[0030] I. Definitions

[0031] Although the numerical ranges and parameters used to define the broader scope of the present invention are approximate values, the relevant numerical values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual testing methods. Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range. Alternatively, the term "about" means that the actual value falls within the acceptable standard error of the mean value, depending on the consideration of a person with ordinary knowledge in the technical field to which the present invention belongs. Except for the experimental examples, or unless otherwise explicitly stated, it should be understood that all ranges, quantities, values ​​and percentages used herein (for example, for describing the amount of material, the length of time, temperature, operating conditions, quantitative ratios and the like) are modified by "about". Therefore, unless otherwise stated to the contrary, the numerical parameters disclosed in this specification and the attached patent scope are approximate values ​​and can be changed as needed. At least these numerical parameters should be understood as the number of significant digits indicated and the values ​​obtained by applying the general rounding method. Herein, numerical ranges are expressed as from one end point to another point or between two end points; unless otherwise stated, the numerical ranges described herein include the end points.

[0032] Unless otherwise defined in this specification, the scientific and technical terms used herein have the same meanings as those understood and used by persons with ordinary knowledge in the technical field to which the present invention belongs. In addition, singular nouns used in this specification include plural forms of the nouns, and plural nouns used also include singular forms of the nouns, unless they conflict with the context.

[0033] In the present disclosure, the term "primer" has the meaning known to those with ordinary knowledge in the art to which the present invention belongs, and refers to a polynucleotide having 10-30 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30; preferably 15-25) nucleotides. When placed under appropriate conditions (e.g., PCR), the primer can serve as a starting point for the synthesis of the polynucleotide sequence. The primer can be completely or substantially complementary to a region of the target nucleotide sequence. Therefore, in an environment where hybridization can occur, the primer will bind to the complementary region of the target sequence. After adding appropriate reactants (e.g., but not limited to, polymerase, nucleotide triphosphates, etc.), the polymerase will extend from the primer to form a copy of the target sequence. In the present disclosure, the term "forward primer" refers to a primer that binds to the 3' end of one strand of the target DNA, and the term "reverse primer" refers to a primer that binds to the 3' end of the other strand (complementary strand) of the DNA.

[0034] "Triplex forming oligonucleotide" (TFO) - in the present disclosure, refers to a molecule that can bind to the major groove of dsDNA to form a triple helix structure. TFO will bind to the purine-rich strand of the double helix by Hoostein hydrogen bonding or reverse Hoostein hydrogen bonding. For example, see Yue Li et al., Cell Chemical Biology, 2016, 23: 1325-1333, or Rodrigo Maldonado et al., RNA, 2018, 24: 371-380; these documents are hereby incorporated in their entirety for reference.

[0035] In the present disclosure, when a sequence is "reverse" to a reference sequence (e.g., an exon sequence), it means that the sequence and the reference sequence have nucleotide sequences, and the two nucleotide sequences are in opposite directions. For example, if a strand contains the hypothetical sequence "5'-TAATCCGGTT-3'" (SEQ ID NO: 4), then its reverse sequence is "5'-TTGGCCTAAT-3'" (SEQ ID NO: 27). In the present disclosure, the term "substantially reverse" means that when the two reverse sequences are aligned, there are one or more nucleotide variations (nucleotide changes) between the two sequences, preferably one or two variations, and more preferably only one variation. For example, if one strand contains the hypothetical sequence "5'-TAATCCGGTT-3'" (SEQ ID NO: 4), its actual reverse sequence can be "5'-TTGGACTAAT-3'" (SEQ ID NO: 28, wherein the nucleotide "C" at position 6 of SEQ ID NO: 4 is mutated to the nucleotide "A" in the reverse sequence of SEQ ID NO: 28), or "5'-TCGGCCTAAT-3'" (SEQ ID NO: 29, wherein the nucleotide "T" at position 9 of SEQ ID NO: 4 is mutated to the nucleotide "C" in the reverse sequence of SEQ ID NO: 29).

[0036] In the present disclosure, the term "reverse complementary" has the meaning known to a person with ordinary knowledge in the technical field to which the present invention belongs, and refers to a sequence that is complementary to a specific nucleotide sequence (e.g., an exon sequence) in the same direction relative to the specific nucleotide sequence. For example, if one strand contains the hypothetical sequence "5'-TAATCCGGTT-3'" (SEQ ID NO: 4), then its reverse complementary sequence is "5'-ATTAGGCCAA-3'" (SEQ ID NO: 5). In the present disclosure, the term "substantially reverse complementary" means that when two reverse complementary sequences are aligned, there are one or more mismatches between the two sequences, preferably one or two mismatches, and more preferably only one mismatch. The term "mismatch" refers to a site where a base of one sequence is not complementary to a base of another sequence to which it is aligned. Two nucleic acids are "perfectly complementary" when the entire length of the nucleic acids is completely complementary. For example, when one strand contains the hypothetical sequence "5'-TAATCCGGTT-3'" (SEQ ID NO: 4), its substantially reverse complementary sequence may be "5'-ATTCGGCCAA-3'" (SEQ ID NO: 6; wherein the nucleotide "T" at position 4 is mismatched with the nucleotide "C"), or "5'-ATTAGACCAA-3'" (SEQ ID NO: 7; wherein the nucleotide "C" at position 6 is mismatched with the nucleotide "A").

[0037] As known to those with common knowledge in the technical field to which the present invention belongs, nucleic acid is an organic molecule composed of a base (nucleobase), a pentose (ribose or deoxyribose) and a phosphate group, wherein the base is guanine (G), adenine (A), cytosine (C) and / or thymine (T) in DNA, and guanine (G), adenine (A), cytosine (C) and / or uracil (U) in RNA. In the present disclosure, the term "pyrimidine nucleotide" covers any nucleotide containing a pyrimidine base, including, but not limited to, cytosine (C), thymine (T) and uracil (U) nucleotides. A pyrimidine nucleotide can be a ribose molecule (i.e., a pyrimidine ribonucleotide) or a deoxyribose molecule (i.e., a pyrimidine deoxyribonucleotide). The term "purine nucleotide" encompasses any nucleotide containing a purine base, including, but not limited to, adenine (A) and guanine (G) nucleotides. A purine nucleotide can be a ribose molecule (i.e., a purine ribonucleotide) or a deoxyribose molecule (i.e., a purine deoxyribonucleotide).

[0038] In the present disclosure, the term "polypurine sequence" refers to a nucleotide sequence in which at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) of the bases are purines. The term "polypyrimidine sequence" refers to a nucleotide sequence in which at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) of the bases are pyrimidines.

[0039] As is known to those skilled in the art, "Hoogsteen base pairing" and "reverse Hoogsteen base pairing" are two different bonding methods from Watson-Crick base pairing. Specifically, in Hoogsteen base pairing, the distance between C1' and C1' is approximately Compared to Watson-Crick base pairing, the number of Among them, pyrimidine uses its Watson-Crick surface to pair with N1, C6, and N7 of purine, and finally the pyrimidine rotates 180° to form a Hoostein base pairing with the purine; in this configuration, the two chains forming the Hoostein bond are in a parallel direction (parallelorientation). In contrast, in reverse Hoostein base pairing, purine is bonded to the same purine (e.g., G*G or A*A bonding), wherein the two chains forming the reverse Hoostein bond are in an antiparallel direction (antiparallelorientation). For example, see US 6,727,059 B1, WO 2012 / 139628A1, and AtulRangadurai, J Magn Reson., 2019, 308: 106589; these documents are hereby incorporated in their entirety for reference.

[0040] In the present disclosure, the term "fluorophore" refers to a molecule that absorbs energy at a specific wavelength (i.e., a first wavelength) and re-emits energy at another wavelength (i.e., a second wavelength). For example, when the fluorescent group is FITC, it can be excited by light at 485-495 nanometers (the first wavelength), absorbs energy, and emits energy at 520-530 nanometers (the second wavelength).

[0041] II. Detailed Description of the Invention

[0042] The present disclosure is based in part on the unexpected discovery by the inventors that replacing the T nucleotides of dsDNA with modified U nucleotides can improve the binding affinity between TFO and dsDNA. Based on this discovery, the purpose of the present disclosure is to provide a method and kit for detecting a target sequence of a double-stranded nucleic acid (e.g., dsDNA) using TFO.

[0043] Therefore, the first aspect of the present disclosure relates to a method for detecting a target sequence of a double-stranded nucleic acid. According to certain embodiments of the present disclosure, the method of the present invention comprises: (a) mixing the double-stranded nucleic acid with a PCR reagent; (b) subjecting the mixture of step (a) to PCR; (c) mixing the amplification product of step (b) with TFO; (d) irradiating the triple-stranded complex of step (c) with light having a first wavelength; and (e) Measuring the signal emitted by the triplex complex at a second wavelength to detect the target sequence.

[0044] In step (a), the double-stranded nucleic acid is first mixed with a PCR reagent, wherein the PCR reagent comprises a forward primer, a reverse primer, a DNA polymerase, a reaction buffer (e.g., Tris-HCl), and dNTPs. As known to those with common knowledge in the technical field to which the present invention belongs, the forward primer and the reverse primer can be respectively bound to a specific sequence in the double-stranded nucleic acid for amplifying a specific fragment in a PCR reaction. Generally speaking, the forward primer is bound to the 3' end of the first strand (e.g., the antisense strand or the sense strand) of the double-stranded nucleic acid, while the reverse primer refers to the 3' end of the second strand (complementary to the first strand; e.g., the sense strand or the antisense strand) of the double-stranded nucleic acid. In an appropriate reaction (e.g., a PCR reaction), the forward primer and the reverse primer can be respectively used as initiators of the polymerization reaction, and under the catalysis of the DNA polymerase, dNTPs are used as construction components to amplify a specific fragment (e.g., the target sequence of the present invention). Those skilled in the art can design primer sequences according to the DNA fragments to be amplified; the methods for designing and preparing primer sequences are common knowledge in the technical field to which the present invention belongs and will not be described in detail here for the sake of brevity.

[0045] According to certain embodiments of the present disclosure, the forward primer is connected to a first fluorescent group (e.g., a donor fluorescent group or an acceptor fluorescent group), and the dNTPs are composed of dATP, dCTP, dGTP and dUTP. The technical characteristics of the method of the present invention are: (i) the PCR reagent does not contain dTTP, so the amplified sequence formed does not contain T nucleotides and is only composed of C, U, A and G nucleotides; and (ii) the dUTP is a modified dUTP. Exemplary modified dUTPs suitable for the method of the present invention include, but are not limited to, (i) Br-dUTP, which has structure; (ii) Cl-dUTP, which has structure; (iii) F-dUTP, which has structure; and (iv) Fml-dUTP, which has structure.

[0046] In a preferred embodiment, the modified dUTP is Br-dUTP.

[0047] Preferably, the PCR reagent also contains MgCl2.

[0048] In step (b), the mixture of step (a) is subjected to PCR to amplify the target sequence. Generally speaking, PCR includes placing the mixture at 94°C for three minutes to completely denature the double strands, then placing it at 94°C for 45 seconds (denaturation reaction), 55-65°C for 30 seconds (binding reaction), and 72°C for 1 minute to 1 minute 30 seconds (extension reaction), and repeating the denaturation, binding and extension reactions for 25-30 cycles. It is understood that those skilled in the art can adjust the PCR conditions based on the common knowledge and actual needs at the time of application (for example, the sequence to be amplified and / or the length of the primers, etc.).

[0049] In step (c), the amplified product obtained in step (b) is mixed with TFO to form a three-strand complex (comprising the first and second strands of the amplified sequence, and the third strand of TFO). As described above, using TFO as a probe to detect a specific nucleotide sequence is a commonly used technical means in the technical field of the present invention. The design and preparation method of TFO is also a technology known to people with common knowledge in the technical field to which the present invention belongs. Those skilled in the art can select an appropriate TFO based on common knowledge and actual needs (e.g., the sequence to be detected) at the time of application. According to certain embodiments of the present disclosure, the TFO of the present invention is characterized in that the DNA fragment bound thereto contains only 0-5 T nucleotides (e.g., 0, 1, 2, 3, 4 or 5 T nucleotides), preferably only 0-2 T nucleotides (e.g., 0, 1, or 2 T nucleotides). According to certain embodiments, the TFO of the present invention is composed of 9-40 nucleotides (preferably 10-25 nucleotides) and is substantially opposite to the strand amplified by the forward primer, that is, the strand amplified by the TFO and the forward primer is opposite to each other, and there is one or two nucleotide variations between the two. In certain preferred embodiments, the sequence of TFO partially overlaps with the sequence of the forward primer. For example, in an exemplary embodiment of the present disclosure, the target sequence is PD-L1, which comprises a first chain (the sequence from 5' to 3' is "AGCAGAGGAGGAGAATGAAGAAAGA", SEQ ID NO: 8) and a second chain complementary to the first chain (the sequence from 5' to 3' is "TCTTTCTTCATTCTCCTCCTCTGCT", SEQ ID NO: 9), wherein the forward primer used to amplify the second chain has a nucleotide sequence of "AGCAGAGGAGGAGAGAA" (from 5' to 3'; SEQ ID NO: 1), and the TFO that binds to the forward primer (reverse Hoostein base pairing) has a nucleotide sequence of "AGAAAGAAGGAAGAGGAGGAGGAGA" (from 5' to 3'; SEQ ID NO: 3); in this embodiment, TFO is in the opposite direction to the first chain, and there is a nucleotide variation between the two, that is, TFO and the second chain are reverse complements with one nucleotide mismatch, see, TFO sequence (SEQ ID NO: 3), the nucleotide "G" in bold in the first strand (SEQ ID NO: 8), and the nucleotide "A" in bold in the second strand.

[0050] Preferably, in the nucleotide sequence of TFO, the number of pyrimidine nucleotides (ie, T and C nucleotides) is equal to or less than one (ie, one or zero). More preferably, TFO is composed of A and G nucleotides.

[0051] According to certain embodiments, TFO is connected to an acceptor fluorescent group. In the present disclosure, once TFO is bound to the amplification sequence, the acceptor fluorescent group connected to TFO will produce fluorescence resonance energy transfer (FRET) with the donor fluorescent group connected to the forward primer. As known to those skilled in the art, FRET refers to energy transfer between two fluorescent groups (i.e., a donor fluorescent group and an acceptor fluorescent group), wherein the emission spectrum of the donor fluorescent group overlaps the absorption spectrum of the acceptor fluorescent group. In this case, when the two fluorescent groups are close to each other (e.g., less than 10 nanometers), a non-radioactive energy transfer will occur, which reduces the emission fluorescence intensity of the donor fluorescent group and increases the emission fluorescence intensity of the acceptor fluorescent group. FRET technology has been widely used in related fields to analyze the interaction between biomolecules and protein binding. It can be imagined that those skilled in the art can select appropriate donor and acceptor fluorescent groups based on common knowledge and actual needs at the time of application. Exemplary fluorescent groups suitable for use in the present invention include, but are not limited to, cyan fluorescent protein (CFP), green fluorescent protein (GFP), yellow fluorescent protein (CFP), red fluorescent protein (CFP), far-red fluorescent protein (FFP), infrared fluorescent protein (IFP), fluorescein isothiocyanate (FITC), phycoerythrin (PE), allophycocyanin (APC), carboxy-X-rhodamine (ROX), Texas red, cyanine dyes (e.g., Cy2, Cy3, Cy5 or Cy7), and Dyes (e.g. or ). In an exemplary embodiment, the acceptor fluorescent group and the donor fluorescent group are FITC and ROX, respectively.

[0052] According to certain embodiments of the present disclosure, a donor fluorescent group (eg, FITC) is attached to the 5' end of the forward primer, and an acceptor fluorescent group (eg, ROX) is attached to the 3' end of TFO.

[0053] Optionally, before step (d), the method of the present invention further comprises placing the product of step (c) in an appropriate environment for a period of time (i.e., step (c-1)). According to certain embodiments, in order to form a triple-stranded complex, the mixture comprising TFO and the PCR amplification product is placed at 37°C to 40°C (e.g., 37°C, 37.1°C, 37.2°C, 37.3°C, 37.4°C, 37.5°C, 37.6°C, 37.7°C, 37.8°C, 37.9°C, 38°C, 38.1°C, 38.2°C, 38.3°C, 38.4°C, 38.5°C, 38.6°C, 38.7°C, 38.8°C, 38.9°C, 39°C , 39.1°C, 39.2°C, 39.3°C, 39.4°C, 39.5°C, 39.6°C, 39.7°C, 39.8°C, 39.9°C or 40°C) for 30-60 minutes (e.g., 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 or 60 minutes). It is conceivable that the reaction temperature and time will vary depending on the TFO and the amplified sequence. Those skilled in the art can adjust the reaction temperature and / or time according to actual needs. In an exemplary embodiment, the mixture containing TFO and PCR amplification product is placed at 37°C for 60 minutes to form a triple-stranded complex. In another exemplary embodiment, the mixture containing TFO and the PCR amplification product is reacted at 40° C. for 30 minutes to form a triple-stranded complex.

[0054] According to certain embodiments, the mixture of step (c) (i.e., the mixture comprising TFO and PCR amplification product) further comprises MgCl2, and its concentration in the mixture is 2-10 mM, for example, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5. 1, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85,

[0055] Next, the product of step (c) is irradiated with light having a first wavelength to excite the donor fluorescent group (step (d)), and the signal emitted by the acceptor fluorescent group at the second wavelength is measured for detecting the target sequence (step (e)). It can be imagined that the first and second wavelengths will vary depending on the type of donor and acceptor fluorescent groups. Those skilled in the art can select appropriate first and second wavelengths based on common knowledge at the time of application (i.e., the excitation / absorption and emission light waves corresponding to different fluorescent groups). According to an exemplary embodiment, the acceptor and donor fluorescent groups are FITC and ROX, respectively; in this embodiment, the first and second wavelengths are 485-495 nanometers and 600-605 nanometers, respectively.

[0056] The second aspect of the present disclosure relates to a method for detecting whether a target sequence (e.g., PD-L1) is contained in a test object. The method of the present invention comprises extracting DNA from the test object, and then performing the above-mentioned detection method (i.e., the above-mentioned steps (a)-(e)), wherein when a signal emitted by a fluorescent group at a second wavelength is detected, it represents that the test object contains a target sequence; conversely, when a signal emitted by a fluorescent group at a second wavelength is not detected, it represents that the test object does not contain a target sequence. By this method, those skilled in the art can diagnose or prognose different diseases (e.g., cancer).

[0057] According to certain embodiments of the present disclosure, the target sequence is derived from Staphylococcus aureus and comprises a first chain ("AAACCCCCACTGCAATGATTATCGCAATGGGGGAAAGAGGGGACTTA AAGCATATGTTTAGCTTTGAATACTTAAAATTCTCTTGCTATT", from 5' to 3'; SEQ ID NO: 30), and a second chain complementary to the first chain ("AATAGCAAGAGAATTTTAAGTATTCAAAGCTAAACATATGCTTTAAG TCCCCTCTTTCCCCCATTGCGATAATCATTGCAGTGGGGGTTT", from 5' to 3'; SEQ ID NO: 31). In these embodiments, when the target sequence is detected, it means that the individual derived from the biological test object is infected with Staphylococcus aureus.

[0058] A third aspect of the present disclosure provides a kit for detecting a target sequence of a double-stranded nucleic acid (e.g., DNA). The kit comprises: (1) a forward primer and a reverse primer designed according to the target sequence, wherein the forward primer is linked to a first fluorescent group (e.g., a donor fluorescent group; for example, FITC); (2) a TFO having 9-40 nucleotides (preferably 10-25 nucleotides) and substantially in the reverse direction of the forward primer amplification strand and linked to a second fluorescent group (e.g., an acceptor fluorescent group; for example, ROX); and (3) dNTPs, which are composed of dATP, dCTP, dGTP, and modified dUTP (e.g., Br-dUTP, Cl-dUTP, F-dUTP, and Fml-dUTP).

[0059] The technical feature of the kit of the present invention is that it does not contain dTTP.

[0060] The forward primer, reverse primer, TFO and dNTPs of the kit of the present invention are similar to the forward primer, reverse primer, TFO and dNTPs of the method of the first aspect, and will not be described in detail for the sake of brevity.

[0061] Optionally, the kit of the present invention further comprises a DNA polymerase, a reaction buffer (eg, Tris-HCL) and MgCl2.

[0062] According to an exemplary embodiment, the target sequence is PD-L1. In this embodiment, the forward primer and the reverse primer of the kit of the present invention respectively comprise the nucleotide sequences of "AGCAGAGGAGGAGAA" (SEQ ID NO: 1) and "TTGTTCAGAAGTATCCTTTC" (SEQ ID NO: 2), and TFO comprises the nucleotide sequence of "AGAAAGAAGGAAGAGGAGGAGA" (SEQ ID NO: 3).

[0063] According to another exemplary embodiment, the target sequence is derived from Staphylococcus aureus and comprises a first strand of SEQ ID NO: 30 and a second strand of SEQ ID NO: 31. In this embodiment, the TFO used to detect the target sequence comprises a nucleotide sequence of "AGGGGAGAAAGGGGGTAA" (SEQ ID NO: 32) or "GGGAGAAAGGGGGTAA" (SEQ ID NO: 33).

[0064] The present disclosure also provides a triple-stranded nucleic acid comprising a double-stranded nucleic acid (e.g., DNA) and a TFO, wherein the double-stranded nucleic acid comprises a first strand (e.g., a sense strand or an antisense strand of a DNA), and a second strand complementary to the first strand (e.g., an antisense strand or a sense strand of a DNA). According to certain embodiments of the present disclosure, the first strand of the double-stranded nucleic acid is a polypurine sequence (preferably, in the polypurine sequence, the number of pyrimidine nucleotides is equal to or less than one), and the second strand is a polypyrimidine sequence, wherein the first strand is bonded to the TFO by Hoostein base pairing or reverse Hoostein base pairing, and the second strand comprises a plurality of (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) modified nucleotides. In these embodiments, the modified nucleotide is a modified U nucleotide, which is selected from the group consisting of 5-fluoro-uridine nucleotides, 5-chloro-uridine nucleotides, 5-bromo-uridine nucleotides and 5-formyl-uridine nucleotides. In a preferred embodiment, the modified nucleotide is a 5-bromo-uridine nucleotide.

[0065] Preferably, the second strand consists of C, A, G and modified U nucleotides, and does not contain T nucleotides.

[0066] In various embodiments, the double-stranded nucleic acid can be prepared by a polymerase (e.g., DNA polymerase) catalyzed reaction, i.e., by amplifying the template nucleic acid using a polymerase as a catalyst. Exemplary polymerase catalyzed reactions include, but are not limited to, PCR, LAMP, RPA or other nucleic acid amplification methods. According to an exemplary embodiment, the double-stranded nucleic acid is prepared by PCR.

[0067] Preferably, the double-stranded nucleic acid has 9-40 base pairs (i.e., the first strand and the second strand each consist of 9-40 nucleotides), for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 base pairs. It is contemplated that the length of the TFO may be the same as or different from the length of the double-stranded nucleic acid. Preferably, the TFO has the same length as the double-stranded nucleic acid; for example, when the first strand and the second strand of the double-stranded nucleic acid each have 9 nucleotides, the TFO also has 9 nucleotides; or, when the first strand and the second strand of the double-stranded nucleic acid each have 22 nucleotides, the TFO also has 22 nucleotides.

[0068] A number of embodiments are presented below to illustrate certain aspects of the present invention so that a person with ordinary knowledge in the art to which the present invention belongs can apply the present invention, and these embodiments should not be regarded as limiting the scope of the present invention. After reading the descriptions presented herein, those skilled in the art can fully utilize and practice the present invention without excessive interpretation. All public documents cited herein are considered part of this specification in their entirety. Example

[0069] Materials and Methods

[0070] Synthetic DNA fragments

[0071] In this study, a total of 5 dsDNA fragments (named as double-stranded fragment 1, double-stranded fragment 2, double-stranded fragment 2-1, double-stranded fragment 2-2 and double-stranded fragment 3), 4 TFO probes (named as G-TFO, A-TFO, C-TFO and T-TFO) and 3 G-TFO fragment probes (named as G-TFO-20, G-TFO-17 and G-TFO-14) were artificially synthesized. The nucleotide sequences of each synthetic fragment are summarized in Table 1 below.

[0072] Table 1 Nucleotide sequences of synthetic fragments of the present invention

[0073] In addition, this study also artificially synthesized a dsDNA fragment derived from the genome of Staphylococcus aureus (named "SAT-1"), and four TFO probe fragments for detecting SAT-1 dsDNA (named "SAT-1-p18", "SAT-1-p16", "SAT-1-p14" and "SAT-1-p12" respectively). The nucleotide sequences of each synthetic fragment are summarized in Table 2 below.

[0074] Table 2 Nucleotide sequences of synthetic fragments of the present invention

[0075] Preparation of modified dsDNA

[0076] PCR technology is used to prepare modified dsDNA. Basically, when dsDNA is synthesized using PCR technology with a specific primer pair, the dNTPs of the PCR reagent are composed of dATP, dTTP, dCTP and dGTP, and when synthesizing modified dsDNA, modified dUTP or modified dCTP is used to replace dTTP and dCTP in dNTPs.

[0077] Specifically, when preparing double-stranded fragment 1 or double-stranded fragment 2 containing modified dUTP, Br-dUTP, Cl-dUTP, F-dUTP or Fml-dUTP is used to replace dTTP in dNTPs. The obtained polynucleotide is composed of four nucleotides: A, G, C and modified U (i.e., Br-U, Cl-U, FU or Fml-U), and the sequence does not contain T nucleotides. According to the modified chemical group, the modified double-stranded fragment 1 is named "double-stranded fragment 1-Br-U", "double-stranded fragment 1-Cl-U", "double-stranded fragment 1-FU" and "double-stranded fragment 1-Fml-U"; at the same time, the modified double-stranded fragment 2 is named "double-stranded fragment 2-Br-U", "double-stranded fragment 2-Cl-U", "double-stranded fragment 2-FU" and "double-stranded fragment 2-Fml-U".

[0078] When preparing the double-stranded fragment 3 containing modified dCTP, 5-hydroxy-dCTP (5-hydroxy-dCTP, hereinafter referred to as "OH-dCTP"), 5-bromo-dCTP (5-bromo-dCTP, hereinafter referred to as "Br-dCTP") or 5-aminoallyl-dCTP (5-aminoallyl-dCTP, hereinafter referred to as "AA-dCTP") is used to replace the dCTP in dNTPs. The obtained polynucleotide is composed of four nucleotides: A, G, T and modified C (i.e., OH-C, Br-C or AA-C). According to the modified chemical groups, the modified double-stranded fragments 3 are named "double-stranded fragment 3-OH-C", "double-stranded fragment 3-Br-C" and "double-stranded fragment 3-AA-C".

[0079] On the other hand, Br-dUTP was used to replace dTTP in dNTPs, and SAT-1 dsDNA containing modified dUTP was prepared by PCR. The obtained modified SAT-1 dsDNA was named "SAT-1-Br-U", which is composed of four nucleotides: A, G, C and modified U (i.e., Br-U), and does not contain T nucleotides in the sequence.

[0080] triple helix

[0081] 0.5 μM dsDNA template and 2 μM TFO were mixed in a 10 mM Tris-HCl (pH=7.2) and 2 mM MgCl2 reaction solution, and reacted at 37°C for 60 minutes or at 40°C for 30 minutes. DNA polyacrylamide gel electrophoresis (PAGE) was then used to confirm whether a triple helix structure existed in the mixture.

[0082] FRET Detection System

[0083] In this study, the DNA sequence that binds to the TFO probe preferably has only 1-2 pyrimidine nucleotides. Therefore, when using the PD-L1 gene for analysis and testing, the binding site of the TFO probe is first selected, in which there is only one T nucleotide in the fragment of the probe binding site. After that, the forward primer is designed upstream of the TFO binding site and has a FITC fluorescent group at the 5' end, while the 3' end of the TFO sequence has a ROX fluorescent group.

[0084] A mixture comprising a primer pair (SEQ ID NO: 1 and 2, wherein the 5' end of the forward primer is linked to FITC), a modified or unmodified PD-L1 gene fragment (i.e., PD-L1 Dx or PD-L1 Dx-Br-U modified with Br-U), and a TFO probe (PD-L1-TFO; SEQ ID NO: 3, wherein the 3' end is linked to ROX) is placed at 40°C for 30 minutes, FITC is excited with light having a wavelength of 488 nanometers, and the fluorescence value emitted by ROX at 605 nanometers is detected using a real-time PCR reaction system. In the method of the present invention, if ROX fluorescence can be detected, it means that the triple-stranded structure exists; conversely, if ROX fluorescence cannot be detected, the triple-stranded structure does not exist.

[0085] Example 1 Effect of T nucleotides in DNA sequences on TFO binding affinity

[0086] First, double-stranded fragments 1 and 2 were used to analyze whether the inclusion of T nucleotides in the DNA sequence would affect the binding affinity of TFO to DNA. Double-stranded fragment 1 was a dsDNA that could completely pair with G-TFO (the binding sequence located on its positive strand could completely pair with G-TFO by reverse Hoostein hydrogen bonding), and double-stranded fragment 2 had a single point substitution in the center of the binding sequence (the G nucleotide was replaced by a T nucleotide; see the underlined portion in the nucleotide sequence of SEQ ID NO: 12 in Table 1).

[0087] The electrophoresis results indicated that in the reaction environment of 10 mM magnesium ions, almost all of the double-stranded fragment 1 could bind to G-TFO and form a triple-stranded structure, while only about 50% of the double-stranded fragment 2 could bind to G-TFO to form a triple-stranded structure (results not shown). This result confirmed that as long as there is a T nucleotide in the binding site of TFO, it will have a significant impact on the formation of the triple-stranded structure.

[0088] Next, the concentration of magnesium ions in the PCR reaction agent was reduced from 10 mM to 5 mM, 2 mM and 1 mM. The results showed that as the magnesium ion concentration decreased, the proportion of G-TFO forming a triple-stranded structure with double-stranded fragment 1 or double-stranded fragment 2 gradually decreased (results not shown); this data indicates that the reaction of TFO and dsDNA to form a triple-stranded structure is magnesium ion dependent.

[0089] According to the analysis results, 2 mM magnesium ions were selected for subsequent experiments. The purpose was to allow TFO to form a triple-stranded structure with double-stranded fragment 1, but not to form a triple-stranded structure with double-stranded fragment 2, so as to evaluate the binding affinity between chemically modified dsDNA and TFO.

[0090] Example 2 Binding affinity of TFO to modified dsDNA

[0091] 2.1 Binding affinity of TFO to double-stranded fragments 2-Br-U, 2-FU and 2-Fml-U

[0092] Based on the analysis results of Example 1, in this example, double-stranded fragment 1, double-stranded fragment 2 and modified double-stranded fragment 2 (including double-stranded fragment 2-Br-U, double-stranded fragment 2-FU and double-stranded fragment 2-Fml-U) were mixed with different TFOs (including G-TFO, A-TFO, C-TFO and T-TFO), reacted at 37° C. for one hour, and PAGE was used to confirm whether a triple-stranded structure was formed.

[0093] In the presence of 2 mM magnesium ions, double-stranded fragment 1 can bind to G-TFO and a small amount of A-TFO (results not shown). Compared with the unmodified double-stranded fragment 2, which cannot bind to the four TFOs, the three modified double-stranded fragments 2 (i.e., double-stranded fragment 2-Br-U, double-stranded fragment 2-FU, and double-stranded fragment 2-Fml-U) can form a triple-stranded structure with the four TFOs, among which G-TFO, A-TFO, and C-TFO have the best binding efficiency, and T-TFO has the worst binding efficiency (results not shown). These data confirm that replacing the T nucleotides in the dsDNA-TFO binding site with chemically base-modified U nucleotides can increase the binding affinity of dsDNA to TFO; surprisingly, the binding affinity of the modified double-stranded fragment 2 (including double-stranded fragment 2-Br-U, double-stranded fragment 2-FU, and double-stranded fragment 2-Fml-U) to TFO is even better than that of the double-stranded fragment 1 to TFO (results not shown).

[0094] After confirming that replacing the T nucleotides of double-stranded fragment 1 or double-stranded fragment 2 with Br-U, FU or Fml-U nucleotides can increase the binding affinity of double-stranded fragment 1 or double-stranded fragment 2 to TFO, the dissociation constant (Kd) was further used to select the best chemically modified base. The results in Table 3 show that G-TFO has binding affinity for double-stranded fragment 1 with or without nucleotide modification, among which the Kd value of unmodified double-stranded fragment 1 is 8.96×10 -8 M, the Kd value of the double-stranded fragment 1-FU is 2.10×10 -8 M, the Kd value of the double-stranded fragment 1-Br-U is 6.17×10 -8 M, while the Kd of the double-stranded fragment 1-Fml-U is 6.55×10 -8 M. The results in Table 3 also indicate that the Kd value of the double-stranded fragment 2-Br-U and G-TFO is 6.52×10 -8 M, the Kd value of the double-stranded fragment 2-FU and G-TFO is 1.04×10 -7 M, while the Kd value of the double-stranded fragment 2-Fml-U and G-TFO is 7.28×10 -8 M; No binding affinity was detected between double-stranded fragment 2 and G-FTO. These data confirm that among all the substituted nucleotides tested, double-stranded fragment 2-Br-U has the best binding affinity with G-TFO. Therefore, subsequent experiments will replace the T nucleotide in the dsDNA binding site with Br-U nucleotides.

[0095] Table 3 Binding affinity of G-TFO to specific double-stranded fragments

[0096] 2.2 Binding affinity of TFO to double-stranded fragment 3-OH-C, double-faced fragment 3-Br-C and double-stranded fragment 3-AA-C

[0097] Compared to double-stranded fragment 1 which can completely pair with G-TFO, double-stranded fragment 3 contains a nucleotide substitution of G→C at the G-TFO binding site (see the underlined portion in the nucleotide sequence of SEQ ID NO: 18 in Table 1). The results of PAGE analysis indicate that under the condition of 2 mM magnesium ion, double-stranded fragment 3 cannot form a triple-stranded structure with four TFOs (i.e., G-TFO, A-TFO, C-TFO or T-TFO). If the concentration of magnesium ions is further increased to 10 mM to promote the formation of triple-stranded structures, it can be found that double-stranded fragment 3 can bind to T-TFO, G-TFO and A-TFO (binding affinity: T-TFO>G-TFO>A-TFO), but still cannot bind to C-TFO (results not shown).

[0098] Next, the binding affinity of double-stranded fragments 3-OH-C, double-stranded fragments 3-Br-C and double-stranded fragments 3-AA-C to four TFOs was tested in a 10 mM magnesium ion environment. The results of PAGE indicated that double-stranded fragment 3-OH-C could not form a triple-stranded structure with any of the four TFOs, double-stranded fragment 3-Br-C could only form a triple-stranded structure with T-TFO, and double-stranded fragment 3-AA-C could bind to T-TFO and G-TFO; however, the binding affinity of double-stranded fragments 3-Br-C and double-stranded fragments 3-AA-C to TFO was lower than that of double-stranded fragment 3 to TFO (results not shown). These data suggest that replacing the C nucleotide of double-stranded fragment 3 with OH-C, Br-C or AA-C nucleotides not only fails to increase the binding affinity of double-stranded fragment 3 to TFO, but instead reduces its binding affinity to TFO.

[0099] 2.3 Effect of Br-U nucleotide substitution on the binding of dsDNA to TFO

[0100] After confirming that replacing the T nucleotide in the dsDNA binding site with a Br-U nucleotide can increase the binding affinity between dsDNA and TFO, when preparing double-stranded fragments 1, double-stranded fragments 2 and double-stranded fragments 3, Br-dUTP was used to replace dTTP in dNTPs to obtain double-stranded fragments 1-Br-U, double-stranded fragments 2-Br-U and double-stranded fragments 3-Br-U.

[0101] The experimental results indicate that at a magnesium ion concentration of 2 mM, double-stranded fragments 1-Br-U, 2-Br-U and 3-Br-U can bind to four types of TFO (i.e., G-TFO, A-TFO, C-TFO or T-TFO) to form a triple-stranded structure. This result indicates that BrU nucleotides can not only increase the binding affinity of a single purine in the TFO binding site, but also increase the ability of the entire dsDNA to form a triple-stranded structure with TFO.

[0102] Example 3: Replacement of two T nucleotides in the dsDNA binding site with Br-U nucleotides

[0103] Compared with the double-stranded fragment 1 which can completely pair with G-TFO, the double-stranded fragment 2-1 has two consecutive T nucleotide substitutions at the G-TFO binding site (see the underlined position in the nucleotide sequence of SEQ ID NO: 14 in Table 1). The PAGE analysis results indicate that at a magnesium ion concentration of 2 mM, both the double-stranded fragment 2-1 and the double-stranded fragment 2-1-Br-U cannot bind to TFO (results not shown). Therefore, the magnesium ion concentration was further increased to 10 mM. From the results, it can be seen that the double-stranded fragment 2-1 still cannot bind to TFO, while the double-stranded fragment 2-1-Br-U can bind to TFO, among which it has a better binding affinity with A-TFO, C-TFO, and G-TFO, and a poorer binding affinity with T-TFO (results not shown). This result proves that replacing two consecutive T nucleotides on dsDNA with Br-U nucleotides can increase the binding affinity between dsDNA and TFO.

[0104] Compared with double-stranded fragment 1, double-stranded fragment 2-2 has two non-consecutive T nucleotide substitutions at the binding site of G-TFO (see the underlined positions in the nucleotide sequence of SEQ ID NO: 16 in Table 1). The results of PAGE analysis indicate that at a magnesium ion concentration of 2 mM, double-stranded fragment 2-2 cannot bind to G-TFO, while double-stranded fragment 2-2-Br-U can bind to G-TFO (results not shown). This result proves that replacing two non-consecutive T nucleotides on dsDNA with BrU nucleotides can also increase the binding affinity between dsDNA and TFO.

[0105] Example 4 Effect of TFO length on dsDNA binding affinity

[0106] In this example, double-stranded fragment 1, double-stranded fragment 2, double-stranded fragment 1-Br-U and double-stranded fragment 2-Br-U were respectively mixed with TFOs of different lengths (including G-TFO, G-TFO-20, G-TFO-17 and G-TFO-14), reacted at 37° C. for 1 hour, and then PAGE was used to analyze whether a triple-stranded structure was formed.

[0107] According to the PAGE analysis results, the shortest length of TFO binding to double-stranded fragment 1 is 17 nucleotides, and the shortest length of TFO binding to double-stranded fragment 1-Br-U is 14 nucleotides (results not shown). Unmodified double-stranded fragment 2 can only form a small amount of triple-stranded structure with G-TFO-20, while double-stranded fragment 2-Br-U can bind to G-TFO-17 (results not shown). From the above results, it can be seen that replacing T nucleotides with BrU nucleotides can increase the binding ability of dsDNA and TFO, so it can form a stable bond with shorter TFO, and the length of TFO probes can be shortened in future applications.

[0108] In addition, this example also detects the binding affinity of the SAT-1TFO probe fragments (i.e., SAT-1-p18, SAT-1-p16, SAT-1-p14, and SAT-1-p12) to SAT-1-Br-U. According to the analysis results, both SAT-1-p18 and SAT-1-p16 have binding affinity to SAT-1-Br-U, thereby forming a triple-stranded nucleic acid (results not shown).

[0109] Example 5 Detection of PD-L1 gene

[0110] This example uses modified or unmodified PD-L1 gene fragments (i.e., PD-L1 Dx or PD-L1 Dx-Br-U modified with Br-U) for actual testing. The experimental results indicate that at a magnesium ion concentration of 10 mM, PD-L1 Dx cannot form a three-chain structure with PD-L1-TFO; after modification with BrU, PD-L1 Dx-Br-U can bind to PD-L1-TFO and form a three-chain structure (results not shown).

[0111] Next, a real-time PCR reaction system was used for fluorescence detection. As described in “Materials and Methods”, PD-L1 Dx or PD-L1 Dx-Br-U was reacted with PD-L1-TFO at 40°C for 30 minutes, and then the fluorescence value was detected. Figure 1 As shown, compared with PD-L1Dx, PD-L1 Dx-Br-U has a higher fluorescence value, indicating that PD-L1 Dx-Br-U has a higher binding affinity with PD-L1-TFO. This result confirms that modifying dsDNA with chemical bases (Br-U) can indeed increase the binding affinity between dsDNA and TFO and can be actually applied to biological gene detection.

[0112] Although specific embodiments of the present invention are disclosed in the above implementation modes, they are not intended to limit the present invention. A person with ordinary knowledge in the technical field to which the present invention belongs can make various changes and modifications without departing from the principle and spirit of the present invention. Therefore, the scope of protection of the present invention shall be based on the scope defined in the claims.

Claims

1. A triple-stranded nucleic acid comprising a double-stranded nucleic acid and a triplex-forming oligonucleotide (TFO), wherein the double-stranded nucleic acid comprises a first strand and a second strand complementary to the first strand, wherein The first strand is a polypurine sequence, which is bonded to the TFO by Hoostein base pairing or reverse Hoostein base pairing; and The second strand is a polypyrimidine sequence and comprises a plurality of modified nucleotides selected from the group consisting of 5-fluoro-uridine nucleotides, 5-chloro-uridine nucleotides, 5-bromo-uridine nucleotides and 5-formyl-uridine nucleotides.

2. The triple-stranded nucleic acid according to claim 1, wherein The double-stranded nucleic acid is prepared by a polymerase-catalyzed reaction.

3. The triple-stranded nucleic acid according to claim 2, wherein The double-stranded nucleic acid is prepared by polymerase chain reaction, isothermal circular nucleic acid amplification method or recombinase polymerase amplification method.

4. The triple-stranded nucleic acid according to claim 1, wherein The double-stranded nucleic acid has 9-40 base pairs.

5. The triple-stranded nucleic acid according to claim 1, wherein In the polypurine sequence, the number of pyrimidine nucleotides is equal to or less than one.

6. A method for detecting a target sequence of a double-stranded nucleic acid, comprising: (a) mixing the double-stranded nucleic acid with a polymerase chain reaction reagent, wherein the PCR reagent comprises a forward primer, a reverse primer, a DNA polymerase, a reaction buffer, and deoxyribonucleoside triphosphates (dNTPs), wherein The forward primer is connected to the first fluorescent group; The dNTPs are composed of deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP) and modified deoxyuridine triphosphate (dUTP), wherein the dUTP is selected from the group consisting of 5-bromo-dUTP, 5-fluoro-dUTP and 5-formyl-dUTP; and The PCR reagent does not contain deoxythymidine triphosphate (dTTP); (b) subjecting the mixture of step (a) to PCR; (c) mixing the amplification product of step (b) with a triplex-forming oligonucleotide to form a triplex complex, wherein the TFO is linked to a second fluorescent group, wherein one of the first and second fluorescent groups is a donor fluorescent group and the other is an acceptor fluorescent group; (d) irradiating the product of step (c) with light having a first wavelength to excite the donor fluorescent group; and (e) measuring the signal emitted by the acceptor fluorescent group at a second wavelength to detect the target sequence.

7. The method according to claim 6, characterized in that The modified dUTP is the 5-bromo-dUTP.

8. The method according to claim 6, characterized in that The acceptor fluorescent group and the donor fluorescent group are fluorescent isothiocyanate and carboxy-X-rose bengal, respectively, and the first and second wavelengths are 485-495 nanometers and 600-605 nanometers, respectively.

9. The method according to claim 6, characterized in that The TFO comprises a nucleotide sequence having 9-40 nucleotides and is substantially in the opposite direction to the strand amplified by the forward primer.

10. The method according to claim 9, characterized in that The first fluorescent group is connected to the 5' end of the forward primer, and the second fluorescent group is connected to the 3' end of the TFO.

11. A kit for detecting a target sequence of a double-stranded nucleic acid, comprising: A forward primer and a reverse primer, used to amplify the target sequence in a polymerase chain reaction, wherein the forward primer is linked to a first fluorescent group; A TFO comprising a nucleotide sequence having 9-40 nucleotides and being substantially opposite to the strand amplified by the forward primer, wherein the TFO is linked to a second fluorescent group; wherein one of the first and second fluorescent groups is a donor fluorescent group, and the other is an acceptor fluorescent group; and dNTPs, which are composed of dATP, dCTP, dGTP and modified dUTP, wherein the dUTP is selected from the group consisting of 5-bromo-dUTP, 5-chloro-dUTP, 5-fluoro-dUTP and 5-formyl-dUTP; wherein the kit does not contain dTTP.

12. The kit according to claim 11, characterized in that The kit further comprises a DNA polymerase, a reaction buffer and MgCl2.

13. The kit according to claim 11, characterized in that The first fluorescent group is connected to the 5' end of the forward primer, and the second fluorescent group is connected to the 3' end of the TFO.

14. The kit according to claim 11, characterized in that In the nucleotide sequence of the TFO, the number of pyrimidine nucleotides is equal to or less than one.

15. The kit according to claim 14, characterized in that The TFO is composed of adenine nucleotides and guanine nucleotides.

16. The kit according to claim 15, characterized in that The target sequence is programmed death-ligand 1; The forward primer and the reverse primer comprise the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2, respectively; and The TFO comprises the nucleotide sequence of SEQ ID NO:

3.

17. The kit according to claim 11, characterized in that The modified dUTP is the 5-bromo-dUTP.

Images