Method for accurately inserting DNA (Deoxyribose Nucleic Acid) into cell genome

Abstract

The invention discloses a method for accurately inserting DNA (deoxyribonucleic acid) into a cell genome. The invention provides a nucleic acid assembly for gene editing. The nucleic acid assembly is composed of pegRNA and donor DNA. One end of the donor DNA is a flush tail end, and the other end of the donor DNA is double-stranded DNA with a 3'end suspension; the RTT sequence in the pegRNA is consistent with the sequence of the 3'end hanging part in the donor DNA. According to the method, a guiding editing system (PE) is utilized, pegRNA with partial fragments of an insertion sequence on a reverse transcription template is used, 3'single-stranded DNA suspension is generated on a genome, meanwhile, exogenous donor DNA with the 3 'single-stranded suspension is provided, and the 3' suspension of the donor DNA and the 3 'suspension of the genome are subjected to base complementary pairing, so that accurate repair is realized, and the purpose of accurate insertion is achieved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for accurately inserting DNA into a cell genome. Background Art

[0002] In 2013, the CRISPR / Cas system first achieved site-specific cutting in eukaryotic cells. Subsequently, various types of gene editing tools such as base editing and guide editing were developed one after another, and showed great application value in the agricultural field. However, there are still some difficulties in accurately inserting foreign DNA into plant genomes. At present, there are mainly the following strategies to achieve DNA insertion: 1. Using the endogenous repair pathway mediated by homologous recombination; 2. Using the repair pathway mediated by non-homologous end joining; 3. Using the transposition activity of transposase; 4. Using the guide editing system mediated by reverse transcriptase activity; 5. In recent years, a large fragment insertion method combining guide editing with sequence-specific recombinase has been developed. These methods each have their own advantages and disadvantages.

[0003] There have been many successful cases of large DNA fragment site-specific insertion technology mediated by non-homologous end joining repair pathways in plants, creating plant materials such as herbicide-resistant rice and β-carotene-rich nutritionally enhanced rice. This method uses the Cas9 / sgRNA complex to generate double-strand breaks on the genome, and then the linear double-stranded DNA delivered into the cell is inserted between the double-strand breaks. The cell repairs the damage between the donor DNA and the genome by non-homologous end joining. However, the large DNA fragment insertion generated by this method is not precise. First, the ends of the exogenously delivered donor fragment DNA will be processed by endogenous processes such as exotomy in the cell. Second, the double-strand breaks in the genomic DNA generated by the Cas9 / sgRNA complex will produce unpredictable insertions or deletions. Third, the direction and copy number of the donor DNA inserted into the genome are random. Therefore, even if chemical modifications are added to both ends of the double-stranded donor DNA, a large proportion of inaccurate insertions will occur.

[0004] Guide editing is a precise editing method, and its core components include Cas9 (H840A), reverse transcriptase (MLV) and pegRNA. Reverse transcriptase reverse transcribes the information on pegRNA into DNA, generating a 3'DNA overhang with programmable length and sequence on the genome. This 3'DNA overhang usually contains a reverse transcription template homologous to the genome, so that the cell can then replace the 3'DNA overhang homologously into the genome through the endogenous repair mechanism. Due to various reasons such as the stability of pegRNA and the reverse transcription activity of reverse transcriptase, the length of the 3'DNA overhang that can be reverse transcribed by the PE editor is limited, so the achievable insertion length is also limited.

[0005] Other methods for DNA insertion in plants also have their own advantages and disadvantages. For example, although homologous recombination is accurate, it is too inefficient in plant cells; transposases are rarely reported in plants; and guide editing combined with sequence-specific recombinases can insert longer fragments, but will leave recombinase recognition sites on the genome. Therefore, it is necessary to develop more efficient and accurate plant genomic DNA site-specific insertion technologies. Summary of the invention

[0006] The purpose of the present invention is to provide a method for accurately inserting DNA into a cell genome and a dedicated gene editor.

[0007] The present invention utilizes a guide editing system (PE) and uses pegRNA with a partial fragment of the insertion sequence on a reverse transcription template to generate a 3' single-stranded DNA overhang on the genome. At the same time, an exogenous donor DNA with a 3' single-stranded overhang is provided. The 3' overhang of the donor DNA is complementary to the 3' overhang of the genome, thereby achieving precise repair and achieving the purpose of precise insertion.

[0008] In a first aspect, the present invention claims a nucleic acid component for gene editing.

[0009] The nucleic acid component for gene editing claimed in the present invention consists of pegRNA and donor DNA;

[0010] The donor DNA is a double-stranded DNA with a blunt end at one end and a 3' overhang at the other end;

[0011] The RTT sequence in the pegRNA is consistent with the sequence of the 3' overhang in the donor DNA.

[0012] As is well known to those skilled in the art, the pegRNA comprises a spacer, a gRNA backbone sequence, an RTT sequence (reverse transcription template) and a PBS sequence (primer binding site), and the 3' end may also comprise a structural motif (tevopreQ1) as required, which functions to form an engineered pegRNA (epegRNA) to further enhance the stability of the 3' end of the pegRNA and prevent it from being degraded.

[0013] Furthermore, in the donor DNA, the nucleotide length of the 3'-end overhang portion is 3-15 nt; further, the nucleotide length of the 3'-end overhang portion is 9-15 nt (such as 12 nt or 9 nt).

[0014] In some embodiments of the present invention, the nucleotide sequence of the 3'-end overhang in the donor DNA is GATGACGACGATAAG (unmodified); the RTT sequence in the pegRNA is GAUGACGACGAUAAG. Accordingly, the sequence of the pegRNA is as shown in SEQ ID No.4, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10 or SEQ ID No.11; and / or, the donor DNA is formed by annealing two single-stranded DNAs shown in SEQ ID No.12 and SEQ ID No.13.

[0015] In other embodiments of the present invention, the nucleotide sequence of the 3'-end overhang in the donor DNA is GTCTGATCCAGAGCC (unmodified); the RTT sequence in the pegRNA is GUCUGAUCCAGAGCC. Accordingly, the sequence of the pegRNA is as shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No.5; and / or, the donor DNA is formed by annealing two single-stranded DNAs shown in SEQ ID No.14 and SEQ ID No.15.

[0016] Furthermore, the donor DNA may be a modified donor DNA. The modification may be any of the following: only phosphate modification; only thiolation modification; both phosphate modification and thiolation modification.

[0017] Furthermore, the phosphate modification is to perform phosphorylation modification on the 5' ends of the two chains constituting the donor DNA; and / or the thiolation modification is to perform two thiolation modifications on the two ends of the two chains constituting the donor DNA.

[0018] In one embodiment of the present invention, the donor DNA is any one of the following: (1) formed by annealing two single-stranded DNAs shown in SEQ ID No.16 and SEQ ID No.17; (2) formed by annealing two single-stranded DNAs shown in SEQ ID No.18 and SEQ ID No.19; (3) formed by annealing two single-stranded DNAs shown in SEQ ID No.20 and SEQ ID No.21; (4) formed by annealing two single-stranded DNAs shown in SEQ ID No.22 and SEQ ID No.23.

[0019] Based on the nucleic acid assembly for gene editing claimed in the present invention, the deformation forms that can be anticipated by those skilled in the art also belong to the protection scope of the present invention. For example, the donor DNA is designed to have a 3'-end overhang at both ends, and the pegRNA is designed as a pair (i.e., two), and the RTT sequences in the two pegRNAs correspond to the overhangs at both ends of the donor DNA.

[0020] In a second aspect, the present invention claims protection for a gene editor.

[0021] The gene editor claimed for protection in the present invention includes the nucleic acid component described in the first aspect above and the following protein components: Cas protein, reverse transcriptase.

[0022] Furthermore, the Cas protein is a Cas protein with complete nuclease activity, which may be a Cas9 protein, such as a SpCas9 protein. The reverse transcriptase may be an M-MLV reverse transcriptase with a deleted RNase H domain and fused to a viral nucleocapsid protein (NC).

[0023] In a third aspect, the present invention claims protection for a set of products for gene editing.

[0024] The complete set of products for gene editing claimed in the present invention includes:

[0025] (A1) an expression vector for expressing the pegRNA described in the first aspect above;

[0026] (A2) The donor DNA described in the first aspect above.

[0027] Furthermore, the complete set of products may also include the following (A3):

[0028] (A3) An expression vector for expressing the Cas protein described in the second aspect above and the reverse transcriptase described in the second aspect above.

[0029] In (A3), depending on the actual situation, the Cas protein and the reverse transcriptase can be expressed using the same expression vector or different expression vectors. Similarly, the pegRNA in (A1) can be expressed with the Cas protein and / or the reverse transcriptase in (A3) using the same expression vector or different expression vectors.

[0030] In (A2), the donor DNA may be present in the form of two single-stranded DNAs constituting it (ie, two oligonucleotides before annealing).

[0031] In one embodiment of the present invention, the expression vector for expressing the pegRNA contains an expression cassette 1; the expression cassette 1 includes a U3 promoter, a spacer, a gRNA backbone sequence, an RTT sequence (reverse transcription template), a PBS sequence (primer binding site), a tevopreQ1 motif and poly(T) from the 5' end to the 3' end. Specifically, the "expression vector for expressing the pegRNA" is the OsU3-epegRNA expression vector in the embodiment.

[0032] In one embodiment of the present invention, the expression vector for expressing the Cas protein and the reverse transcriptase contains an expression cassette 2; the expression cassette 2 includes a UBI promoter, a nuclear localization signal, a SpCas9 encoding gene, a viral nucleocapsid protein (Nucleocapsid, NC), a nuclear localization signal, a reverse transcriptase RT (△RNaseH) encoding gene, a nuclear localization signal, and a CaMV terminator sequence from the 5' end to the 3' end. Among them, the nuclear localization signal (NLS) comes from SV40. Specifically, the "expression vector for expressing the Cas protein and the reverse transcriptase" is the ePPE-Cas9 vector in the embodiment.

[0033] In a fourth aspect, the present invention claims protection for the use of the nucleic acid assembly described in the first aspect above, or the gene editor described in the second aspect above, or the set of products described in the third aspect above in gene editing of a genome.

[0034] In a fifth aspect, the present invention claims protection for a method for gene editing of a genome.

[0035] The method for gene editing of a genome claimed to be protected by the present invention may include the following steps: introducing the nucleic acid component described in the first aspect above, the gene editor described in the second aspect above, or the set of products described in the third aspect above into a receptor, thereby achieving gene editing of the genome of the receptor.

[0036] The basic principle is: This method uses a guide editing system (PE) to generate a 3' single-stranded DNA overhang on the genome using pegRNA with a partial fragment of the insertion sequence on the reverse transcription template. At the same time, an exogenous donor DNA with a 3' single-stranded overhang is provided. The 3' overhang of the donor DNA is complementary to the 3' overhang of the genome, thereby achieving precise repair and precise insertion.

[0037] In the fourth and fifth aspects, the gene editing of the genome is specifically inserting a target DNA fragment into a specific site of the genome.

[0038] Wherein, the length of the target DNA fragment can be 25bp-2Kb.

[0039] The target DNA fragment is located on the donor DNA and the pegRNA.

[0040] In the fourth and fifth aspects, the receptor may be selected from any one of the following: plant cells, animal cells, protoplasts (such as rice protoplasts), plant tissues, animal tissues, plants, animals or microorganisms.

[0041] In one embodiment of the present invention, the receptor is a rice protoplast; the "insertion of the target DNA fragment into a specific site of the genome" is any of the following: (1) inserting a Flag sequence into the OsALS gene (corresponding to OsALS-T3 in the embodiment); (2) inserting a Flag sequence into the OsCDC48 gene (corresponding to OsCDC48-T1 in the embodiment); (3) inserting a Flag sequence into the OsCDC48 gene (corresponding to OsCDC48-T7 in the embodiment); (4) inserting a Flag sequence into the OsCDC48 gene (corresponding to OsCDC48-T7 in the embodiment); (5) inserting a Flag sequence into the OsCDC48 gene (corresponding to OsCDC48-T7 in the embodiment); (6) inserting a Flag sequence into the OsCDC48 gene (corresponding to OsCDC48-T7 in the embodiment); (7) inserting a Flag sequence into the OsCDC48 gene (corresponding to OsCDC48-T7 in the embodiment); (8) inserting a Flag sequence into the OsCDC48 gene (corresponding to OsCDC48-T7 in the embodiment); (9) inserting a Flag sequence into the OsCDC48 gene (corresponding to OsCDC48-T7 in the embodiment); (10) inserting a Flag sequence into the OsCDC48 gene (corresponding to OsCDC48-T7 in the embodiment); (11) inserting a Flag sequence into the OsCDC48 gene (corresponding to OsCDC48-T7 in the embodiment); (12) inserting a Flag sequence into the OsCDC48 gene (corresponding to OsCDC48-T7 in the embodiment); (13) inserting a Flag sequence into the OsCDC48 gene (corresponding to OsCDC48-T7 in the embodiment); (14) inserting a Flag sequence into the OsCDC48 gene (corresponding to OsCDC The Flag sequence is inserted into the OsCDC48 gene (corresponding to OsCDC48-T4 in the example); (5) the Flag sequence is inserted into the OsS20 gene (corresponding to OsS20-T3 in the example); (6) the Flag sequence is inserted into the OsIPA1 gene (corresponding to OsIPA1-T3 in the example); (7) the Flag sequence is inserted into the OsCDC48 gene (corresponding to OsCDC48-T9 in the example); (8) the Flag sequence is inserted into the OsS20 gene (corresponding to OsS20-T4 in the example). The pegRNA sequences corresponding to each target point are shown in the sequence table.

[0042] In one embodiment of the present invention, the receptor is a HEK293T cell; the "insertion of the target DNA fragment at a specific site in the genome" is any of the following: (1) inserting a Flag sequence into a DNMT gene (corresponding to DNMT-T2 in the embodiment); (2) inserting a Flag sequence into a HEK3 gene (corresponding to HEK3-T2 in the embodiment); (3) inserting a Flag sequence into a HEK4 gene (corresponding to HEK4-T2 in the embodiment).

[0043] The novel gene editor provided by the present invention is named BGPE (Base-glue PE). The core components of the BGPE editor include Cas9 with complete nuclease activity, reverse transcriptase, pegRNA, and donor DNA with 3'DNA overhang. The PE editor can generate a 3'DNA overhang with programmable length and sequence on the genome, and the genomic 3'DNA overhang is designed to be complementary to the donor 3'DNA overhang base, so that the direction of DNA insertion and the accuracy of insertion can be regulated. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 The diagram of the BGPE editor of the present invention. A is the base-glue strategy, GBG (Genome Base Glue) is the genomic DNA overhang, and DBG (Donor Base Glue) is the donor DNA overhang. B is the process of BGPE producing GBG. C is the synthesis method of short-chain DBG.

[0045] Figure 2 To compare BGPE and Blunt in rice protoplasts. A is a diagram of the Blunt and BGPE strategies, with genome diagrams on the left and donor DNA diagrams on the right. B is a diagram of the vector backbones used by BGPE and Blunt. BGPE uses OsU3-epegRNA and ePPE-Cas9, and Blunt uses OsU3-guide and Cas9. C is a comparison of the forward and reverse insertion efficiencies of BGPE and Blunt. D is a comparison of the precise insertion efficiencies of BGPE and Blunt at sticky ends and blunt ends. E is a comparison of the percentage of precise insertions of sticky ends and blunt ends of BGPE and Blunt in all forward insertions, i.e., a comparison of precision. F is a comparison of the completely precise insertion efficiencies of BGPE and Blunt.

[0046] Figure 3 To optimize the exogenous DNA donor in rice protoplasts. A is a diagram of chemical modification of the exogenous DNA donor, BGPE represents no modification, BGPE-PM represents 5' end phosphate modification, BGPE-SM represents two thiolation modifications at both ends, and BGPEM represents simultaneous 5' phosphate modification and thiolation modification. B is a comparison of the complete and precise insertion efficiency of the four DNA donor forms in A. C is a comparison of the complete and precise insertion efficiency of Blunt, BGPE, and BGPEM.

[0047] Figure 4 To test the complete and precise insertion efficiency of BGPE at three target sites in the HEK293T cell genome.

[0048] Figure 5 Comparison of the nucleotide lengths of different 3' overhangs in rice protoplasts. A is a comparison at the OsCDC48-T9 target site. B is a comparison at the OsIPA1-T3 target site. C is a comparison at the OsS20-T4 target site. D is ABC Figure 3 Data summary for each target site.

[0049] In each figure, NS indicates no significant difference. * indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, and **** indicates P < 0.0001. DETAILED DESCRIPTION

[0050] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0051] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0052] The present invention designs a new gene editor named BGPE (Base-glue PE). The core components of the BGPE editor include Cas9 with complete nuclease activity, reverse transcriptase, pegRNA, and donor DNA with 3'DNA overhang. The PE editor can generate 3'DNA overhangs with programmable length and sequence on the genome. The genomic 3'DNA overhang is designed to be complementary to the donor 3'DNA overhang base, thereby regulating the direction of DNA insertion and the accuracy of insertion. The specific design scheme is shown in the figure below ( Figure 1 ).

[0053] Example 1: BGPE is superior to Blunt (NHEJ-mediated blunt-end insertion) in terms of insertion direction and accuracy

[0054] 1. Experimental Materials and Methods

[0055] The ePPE-Cas9 expression vector was modified from the vector ePPE of this laboratory. The ePPE vector sequence can be obtained from Addgene. The website is: https: / / www.addgene.org / Caixia_Gao / , and the vector ID number is #183095. The amino acid at position 840 in the CDS sequence encoding the Cas9 protein in the vector ePPE was changed from A to H, which became the vector ePPE-Cas9 used in the present invention. Specifically, the base sequence GCC encoding the amino acid A was changed to the base sequence CAT encoding the amino acid H. The vector ePPE-Cas9 is used to express the SpCas9 protein fused with a nuclear localization signal and an engineered reverse transcriptase RT (△RNaseH).

[0056] The Cas9 expression vector is pJIT163-2NLSCas9, which comes from our laboratory and its sequence can be obtained from Addgene. The website is: https: / / www.addgene.org / Caixia_Gao / , and the vector ID number is #53064.

[0057] The OsU3-guide expression vector is pOsU3, which comes from our laboratory and its sequence can be obtained from Addgene. The website is: https: / / www.addgene.org / Caixia_Gao / , and the vector ID number is #170132.

[0058] The OsU3-epegRNA expression vector was modified from pOsU3. The OsU3-epegRNA expression vector was obtained by replacing the 5'-tttttttgttttttatgtc-3' sequence on the OsU3-guide expression vector pOsU3 with the sequence 5'-CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTT-3'.

[0059] Eight endogenous targets of rice were selected, and gRNA expression vectors and pegRNA expression vectors were constructed respectively. The gRNA information and pegRNA information are shown in Table 1. The sequence of the pegRNA targeting the OsALS-T3 target is shown in SEQ ID No.1; the sequence of the pegRNA targeting the OsCDC48-T1 target is shown in SEQ ID No.2; the sequence of the pegRNA targeting the OsCDC48-T7 target is shown in SEQ ID No.3; the sequence of the pegRNA targeting the OsCDC48-T4 target is shown in SEQ ID No.4; the sequence of the pegRNA targeting the OsS20-T3 target is shown in SEQ ID No.5; the sequence of the pegRNA targeting the OsIPA1-T3 target is shown in SEQ ID No.6; the sequence of the pegRNA targeting the OsCDC48-T9 target is shown in SEQ ID No.7; the sequence of the pegRNA targeting the OsS20-T4 target is shown in SEQ ID No.8.

[0060] Table 1. Coding sequence information corresponding to the gRNA and pegRNA of the 8 targets involved in this example

[0061]

[0062]

[0063] When constructing a gRNA expression vector for implementing Blunt, the spacer coding sequence in Table 1 was inserted between the two BsaI restriction sites of pOsU3.

[0064] The pegRNA construction method for implementing BGPE is as follows: First, double-digest OsU3-epegRNA with BsaI and SacII to obtain a linearized vector. Then, the vector OsU3-epegRNA is used as a template, and the front primer sequence is designed as (NNNN represents the spacer coding sequence): 5'-agatgatccgtggcgNNNNgttttagagctagaaatagcaag-3'; the rear primer sequence is designed as (NNNN represents the reverse complementary sequence of the RTT+PBS coding sequence): 5'-GTAACTAGATAGAACCGCGNNNNgcaccgactcggtgccac-3', amplified, and the obtained fragment is recovered. The recovered fragment is homologously recombined with the aforementioned linearized vector, and the pegRNA expression vector required for BGPE can be obtained after sequencing verification.

[0065] To construct an exogenous donor DNA that can insert the Flag (5'-GGCTCTGGATCAGACTATAAGGATGACGACGATAAG-3') sequence into the genome, primers need to be designed and single-strand annealing experiments need to be performed. Specifically, for Blunt, the front primer is 5'-GGCTCTGGATCAGACTATAAGGATGACGACGATAAG-3', and the back primer is 5'-CTTATCGTCGTCATCCTTATAGTCTGATCCAGAGCC-3'. For BGPE, the sequences are different for different target sites. For the four targets OsIPA1-T3, OsCDC48-T9, OsS20-T4, and OsCDC48-T4, the exogenous donor DNA was formed by single-stranded annealing of FLAG-F (5'-GGCTCTGGATCAGACTATAAGGATGACGACGATAAG-3', SEQ ID No. 12) and tFLAG-R (5'-CTTATAGTCTGATCCAGAGCC-3', SEQ ID No. 13). For the four targets of OsALS-T3, OsCDC48-T1, OsCDC48-T7, and OsS20-T3, the exogenous donor DNA was formed by single-stranded annealing of tFLAG-F (5'-TATAAGGATGACGACGATAAG-3', SEQ ID No. 14) and FLAG-R (5'-CTTATCGTCGTCATCCTTATAGTCTGATCCAGAGCC-3', SEQ ID No. 15). The system and procedure for single-stranded annealing are as follows: the front primer and the rear primer are mixed in equal molar numbers, and no buffer is added, and they are directly placed on the PCR instrument for reaction. The reaction procedure is: 95℃ / 5min, 90℃ / 1min, 80℃ / 1min, 70℃ / 1min, 60℃ / 1min, 50℃ / 1min, 40℃ / 1min, 30℃ / 1min, 20℃ / 1min, 10℃ / 1min, 4℃ / hold. Obtain exogenous donor DNA.

[0066] To test the efficiency, the constructed vector and donor DNA sequence were experimented in rice cells. For Blunt, 5 μg of the corresponding gRNA expression vector, 10 pmol of exogenous donor DNA, and 5 μg of Cas9 expression vector were mixed at different target sites and transformed into rice protoplasts. For BGPE, 5 μg of the corresponding pegRNA expression vector, 10 pmol of the corresponding exogenous donor DNA, and 5 μg of ePPE-Cas9 expression vector were mixed at different target sites and transformed into rice protoplasts. Two days after transformation, the cells were collected and DNA was extracted. The target target was amplified, and the amplicon was sent to a sequencing company for second-generation sequencing. The second-generation sequencing results were analyzed, and sequences inserted into 1 / 3 or more of the forward sequence were calculated as forward insertions, and sequences inserted into 1 / 3 or more of the reverse sequence were calculated as reverse insertions. The precise insertion of sticky ends in the forward insertion was recorded as sticky end precise insertions, and the precise insertion of flat ends in the forward insertion was recorded as flat end precise insertions. The insertion sequence that is inserted into the genome in the forward, complete and accurate direction is recorded as completely accurate insertion.

[0067] 2. Results and Analysis

[0068] In order to test whether BGPE improves the directionality and accuracy of insertion as expected, this example compares BGPE with Blunt (NHEJ-mediated blunt-end insertion) ( Figure 2 A and B in Figure 1). A 36nt Flag tag sequence was inserted into eight endogenous genomic target sites of rice, and the genomic 3'DNA overhang and the 3'DNA overhang of the donor DNA were set to 15nt. It was found that the forward and reverse insertion efficiencies of Blunt were similar, while BGPE was almost always forward insertion ( Figure 2 (C) The average efficiency of BGPE in the forward insertion direction is 2.1 times that of Blunt. Therefore, BGPE is much better than Blunt in terms of insertion direction.

[0069] The BGPE strategy designed in the present invention generates a sticky end at one end and a blunt end at the other end, so we calculated the precise insertion efficiency of the sticky end and the blunt end respectively. It was found that the precise insertion efficiency of both ends of Blunt was basically the same, while the precise insertion efficiency of the sticky end of BGPE was 2.6 times that of the blunt end, indicating that the sticky end can indeed increase the proportion of precise repair ( Figure 2 In addition, the present invention counted the proportion of single-end precise insertion in forward insertion and found that the flat-end insertion accuracy of BGPE was similar to that of Blunt, at about 40%, while the sticky-end accuracy of BGPE reached 82.7% ( Figure 2 Further statistics on the complete precision efficiency showed that at the eight target locations, the complete precision efficiency of BGPE was greater than that of Blunt, and on average was 6.5 times that of Blunt ( Figure 2 In summary, compared with Blunt, the BGPE strategy of the present invention can improve the efficiency of precise insertion in terms of directionality and accuracy.

[0070] Example 2: BGPEM uses modified DNA donor to improve precision insertion efficiency

[0071] 1. Experimental Materials and Methods

[0072] Figure 3 The donor DNA sequence used for BGPE shown in B is formed by annealing single strands of FLAG-F (5'-GGCTCTGGATCAGACTATAAGGATGACGACGATAAG-3', i.e., SEQ ID No. 12) and tFLAG-R (5'-CTTATAGTCTGATCCAGAGCC-3', i.e., SEQ ID No. 13); Figure 3 The donor DNA sequence used for BGPE-PM shown in B is formed by single-stranded annealing of FLAG-F-PM (5'-P-GGCTCTGGATCAGACTATAAGGATGACGACGATAAG-3', i.e., SEQ ID No. 22) and tFLAG-R-PM (5'-P-CTTATAGTCTGATCCAGAGCC-3', i.e., SEQ ID No. 23); Figure 3 The donor DNA sequence used for BGPE-SM shown in B is formed by annealing single strands of FLAG-F-SM (5'-G*G*CTCTGGATCAGACTATAAGGATGACGACGATA*A*G-3', i.e., SEQ ID No. 20) and tFLAG-R-SM (5'-C*T*TATAGTCTGATCCAGAG*C*C-3', i.e., SEQ ID No. 21); Figure 3 The donor DNA sequence used for BGPEM shown in B is formed by single-stranded annealing of FLAG-FM (5'-PG*G*CTCTGGATCAGACTATAAGGATGACGACGATA*A*G-3', SEQ ID No. 16) and tFLAG-RM (5'-PC*T*TATAGTCTGATCCAGAG*C*C-3', SEQ ID No. 17).

[0073] Figure 3The donor DNA sequence of the Blunt treatment group shown in C is formed by annealing single strands of FLAG-F (5'-GGCTCTGGATCAGACTATAAGGATGACGACGATAAG-3', SEQ ID No. 12) and FLAG-R (5'-CTTATCGTCGTCATCCTTATAGTCTGATCCAGAGCC-3', SEQ ID No. 15). Figure 3 As shown in C, the donor DNA sequences of the targets OsCDC48-T4, OsCDC48-T9, OsIPA1-T3, and OsS20-T4 in the BGPE treatment group were formed by single-stranded annealing of FLAG-F (5'-GGCTCTGGATCAGACTATAAGGATGACGACGATAAG-3', i.e., SEQ ID No.12) and tFLAG-R (5'-CTTATAGTCTGATCCAGAGCC-3', i.e., SEQ ID No.13); while the donor DNA sequences of the targets OsALS-T3 and OsCDC48-T1 were formed by single-stranded annealing of tFLAG-F (5'-TATAAGGATGACGACGATAAG-3', i.e., SEQ ID No.14) and FLAG-R (5'-CTTATCGTCGTCATCCTTATAGTCTGATCCAGAGCC-3', i.e., SEQ ID No.15). Figure 3 The donor DNA sequences of the BGPEM treatment group targets OsCDC48-T4, OsCDC48-T9, OsIPA1-T3, and OsS20-T4 shown in C were formed by single-stranded annealing of FLAG-FM (5'-PG*G*CTCTGGATCAGACTATAAGGATGACGACGATA*A*G-3', i.e., SEQ ID No.16) and tFLAG-RM (5'-PC*T*TATAGTCTGATCCAGAG*C*C-3', i.e., SEQ ID No.17); while the donor DNA sequences of the targets OsALS-T3 and OsCDC48-T1 were formed by single-stranded annealing of tFLAG-FM (5'-PT*A*TAAGGATGACGACGATA*A*G-3', i.e., SEQ ID No.18) and FLAG-RM (5'-PC*T*TATCGTCGTCATCCTTATAGTCTGATCCAGAG*C*C-3', i.e., SEQ ID No.19) single strand annealing.

[0074] In the above sequence, the mark * indicates that the non-bridging oxygen atom on the phosphodiester bond between two adjacent bases is replaced by a sulfur atom (forming a thiophosphate group, the structural formula is formula (1); the nucleotide connected by the thiophosphate group is shown in formula (2)). P indicates phosphorylation modification (5' end). The following has the same meaning.

[0075]

[0076] The donor DNA and the corresponding editor were transformed into rice protoplast cells. The vector and target information used and the specific operation are shown in Example 1.

[0077] 2. Results and Analysis

[0078] In order to further optimize the BGPE system, the present invention used modified DNA donors and tested four different groups of DNA donors, including no modification, only phosphate modification, only thiolation modification, and both phosphate and thiolation modification ( Figure 3 Middle A). Experimental results of inserting 36nt Flag tag sequences into eight endogenous genomic target sites in rice showed that both phosphorylation and thiolation modification improved the insertion efficiency of BGPE, and the combination of the two had the best effect. We named this strategy BGPEM. The complete and precise insertion efficiency of BGPEM was further improved on the basis of BGPE, which was 12.4 times that of Blunt on average. Figure 3 Medium B and C.

[0079] Example 3: Application of BGPEM strategy in animal cells

[0080] 1. Experimental Materials and Methods

[0081] To construct a pegRNA expression vector for mammalian cells, pU6-tevopreq1-GG-acceptor was used as the vector backbone (the pU6-tevopreq1-GG-acceptor vector sequence can be obtained from Addgene at: https: / / www.addgene.org / David_Liu / , and the vector ID number is #174038). The spacer coding sequence, gRNA scaffold coding sequence, RTT coding sequence, and PBS coding sequence in Table 2 were inserted between the two BsaI restriction sites of the pU6-tevopreq1-GG-acceptor vector. For example, for the DNMT-T2 target, tcacccctgtttctggcaccgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttga aaaagtggcaccgagtcggtgcThe GATGACGACGATAAGgccagaaacag (the underlined part is the gRNA scaffold coding sequence, which is the same for all targets) sequence was inserted between the two BsaI restriction sites of the pU6-tevopreq1-GG-acceptor vector.

[0082] The protein expression vector used in this example is a modified pCMV-PE2 vector. The sequence of the pCMV-PE2 vector can be obtained from Addgene at: https: / / www.addgene.org / David_Liu / , and the vector ID number is #132775. The amino acid at position 840 in the CDS sequence encoding the Cas9 protein on the pCMV-PE2 vector was modified from A to H, that is, the base sequence GCT encoding the amino acid A was changed to the base sequence CAT encoding the amino acid H. The protein expression vector obtained after the modification can express the SpCas9 protein fused with the nuclear localization signal and the reverse transcriptase RT.

[0083] In this embodiment, the exogenous donor DNA is formed by single-stranded annealing of FLAG-FM (5'-PG*G*CTCTGGATCAGACTATAAGGATGACGACGATA*A*G-3', SEQ ID No. 16) and tFLAG-RM (5'-PC*T*TATAGTCTGATCCAGAG*C*C-3', SEQ ID No. 17).

[0084] The target information used in this example is shown in Table 2. The sequence of the pegRNA targeting the DNMT-T2 target is shown in SEQ ID No.9; the sequence of the pegRNA targeting the HEK3-T2 target is shown in SEQ ID No.10; and the sequence of the pegRNA targeting the HEK4-T2 target is shown in SEQ ID No.11.

[0085] Table 2. Target information used in this example

[0086]

[0087] HEK293T cells were co-transfected with exogenous donor DNA, protein expression vector, and pegRNA expression vector. Each treatment transformed 10pmol of exogenous donor DNA, 300ng of protein expression vector, and 100ng of pegRNA expression vector. The BGPE gene editing component was transformed into cells using liposome transfection. After three days of culture, the cells were lysed and PCR amplified for the target site. The resulting amplicon was sent to a sequencing company for next-generation sequencing. The insertion sequence was recorded as completely and accurately inserted into the genome in the forward, complete, and accurate direction.

[0088] 2. Results Analysis

[0089] like Figure 4 As shown, the BGPE editor achieved precise insertion at three target sites in the mammalian cell genome.

[0090] Example 4, optimization screening of DBG length

[0091] 1. Experimental Materials and Methods

[0092] The method was carried out with reference to Example 2, except that the forward primer of the exogenous donor DNA used for all targets in Example 4 was FLAG-FM (5'-PG*G*CTCTGGATCAGACTATAAGGATGACGACGATA*A*G-3', i.e., SEQ ID No. 16), and the target and rear primer information used were shown in Table 3.

[0093] Table 3. Target and rear primer information involved in this example (5'-3')

[0094]

[0095]

[0096] Note: The * indicates that the non-bridging oxygen atom on the phosphodiester bond between two adjacent bases is replaced by a sulfur atom. P indicates phosphorylation modification (5' end).

[0097] 2. Results Analysis

[0098] Analysis of three endogenous genomic target sites in rice protoplasts revealed that the least efficient 3'DNA overhang lengths were all 1 bp ( Figure 5 A, B and C in the figure). However, the optimal 3'DNA overhang length is not consistent at different target sites. At the OsCDC48-T9 target site, the most efficient 3'DNA overhang length is 9bp. At the OsIPA1-T3 target site, the most efficient 3'DNA overhang length is 12bp. At the OsS20-T4 target site, the most efficient 3'DNA overhang length is 12bp. The results of the three targets were summarized and analyzed, and it was found that the optimal 3'DNA overhang length ranged from 9-15nt ( Figure 5 (middle D).

[0099] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A nucleic acid component for gene editing, consisting of pegRNA and donor DNA; The donor DNA is a double-stranded DNA with a blunt end at one end and a 3' overhang at the other end; The RTT sequence in the pegRNA is consistent with the sequence of the 3' overhang in the donor DNA.

2. The nucleic acid assembly according to claim 1, characterized in that: In the donor DNA, the nucleotide length of the 3'-end overhang is 3-15 nt; Furthermore, the nucleotide length of the 3'-end overhang is 9-15 nt.

3. The nucleic acid assembly according to claim 1 or 2, characterized in that: The nucleotide sequence of the 3'-end overhang in the donor DNA is the 22nd to 36th positions of SEQ ID No.12, and the corresponding RTT sequence in the pegRNA is the 22nd to 36th positions of SEQ ID No.12; or, the nucleotide sequence of the 3'-end overhang in the donor DNA is the 22nd to 36th positions of SEQ ID No.15, and the corresponding RTT sequence in the pegRNA is the 22nd to 36th positions of SEQ ID No.15; Furthermore, the sequence of the pegRNA is as shown in any one of SEQ ID No.1 to SEQ ID No.11; and / or, the donor DNA is formed by annealing two single-stranded DNAs shown in SEQ ID No.12 and SEQ ID No.13 or by annealing two single-stranded DNAs shown in SEQ ID No.14 and SEQ ID No.

15.

4. The nucleic acid assembly according to any one of claims 1 to 3, characterized in that: The donor DNA is modified; the modification is any of the following: only phosphate modification; only thiolation modification; both phosphate modification and thiolation modification; Further, the phosphate modification is to perform phosphorylation modification on the 5' ends of the two chains constituting the donor DNA; and / or, the thiolation modification is to perform two thiolation modifications on both ends of the two chains constituting the donor DNA; Furthermore, the donor DNA is any one of the following: (1) formed by annealing two single-stranded DNAs shown in SEQ ID No.16 and SEQ ID No.17; (2) formed by annealing two single-stranded DNAs shown in SEQ ID No.18 and SEQ ID No.19; (3) formed by annealing two single-stranded DNAs shown in SEQ ID No.20 and SEQ ID No.21; (4) formed by annealing two single-stranded DNAs shown in SEQ ID No.22 and SEQ ID No.

23.

5. A gene editor, comprising the nucleic acid component according to any one of claims 1 to 4 and the following protein components: Cas protein, reverse transcriptase; Furthermore, the Cas protein is a Cas protein with complete nuclease activity.

6. A complete set of products for gene editing, comprising: (A1) an expression vector for expressing the pegRNA according to any one of claims 1 to 4; (A2) the donor DNA according to any one of claims 1 to 4; Furthermore, the complete set of products also includes the following (A3): (A3) Expression vector for expressing Cas protein and reverse transcriptase.

7. Use of the nucleic acid assembly according to any one of claims 1 to 4, the gene editor according to claim 5, or the set of products according to claim 6 in gene editing of a genome.

8. A method for gene editing of a genome, comprising the following steps: introducing the nucleic acid component described in any one of claims 1 to 4, the gene editor described in claim 5, or the set of products described in claim 6 into a receptor, thereby achieving gene editing of the genome of the receptor.

9. The use according to claim 7 or the method according to claim 8, characterized in that: The gene editing of the genome is to insert a target DNA fragment into a specific site of the genome; Furthermore, the length of the target DNA fragment is 25bp-2Kb.

10. The use or method according to any one of claims 7 to 9, characterized in that: The receptor is selected from any one of the following: plant cells, animal cells, protoplasts, plant tissues, animal tissues, plants, animals or microorganisms.

Images