Construction method of hsd17b12a gene deletion type zebrafish

Abstract

The invention provides a construction method of an hsd17b12a gene deletion type zebrafish, and relates to the technical field of gene engineering. The sgRNA is targeted to the hsd17b12a gene of the zebra fish; the nucleotide sequence of the sgRNA is as shown in SEQ ID NO. 1. According to the sgRNA, a zebrafish hsd17b12a gene is precisely targeted by utilizing a CRISPR / Cas9 technology, and an ovum quality defect model is efficiently constructed. The method simulates human diseases, reduces the research cost, improves the experiment efficiency and reliability, and is helpful for researching the ovum development law and promoting the related medical progress.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a method for constructing an hsd17b12a gene-deficient zebrafish. Background Art

[0002] The regulation of oocyte maturation and egg quality is a key area in reproductive biology, involving a variety of genetic and environmental factors. Genetic factors include maternal proteins, RNA, fatty acids, lipids, steroids and intercellular communication, while environmental factors such as nutrition and water temperature also affect egg quality. These factors work together to regulate the occurrence and quality of fish eggs. The development of oocytes includes three stages: growth, maturation and ovulation. Germinal vesicle rupture (GVBD) is an important sign of oocyte maturation.

[0003] In the prior art, zebrafish, as a model organism, has been widely studied because of its high homology with vertebrate genes such as humans. Zebrafish have the advantages of being small, easy to raise, highly adaptable, having a wide range of diets, and having strong fertility. In addition, the early embryos are transparent and easy to observe, so they are widely used in toxicology, pharmacology, pathology, and new drug screening. The zebrafish gene has a similarity of up to 87% with human genes, and the early embryonic development process is highly similar to that of humans, which makes zebrafish a good model for studying vertebrate development.

[0004] However, existing technologies have some defects in the study of oocyte maturation and egg quality regulation. First, although the zebrafish model can provide many advantages, the understanding of the specific functions and regulatory mechanisms of genes such as hsd17b12 is still limited. Studies have shown that insufficient dosage of hsd17b12 in humans and mice can lead to defects in ovarian function and organ formation, and functional loss of Hsd17b12 in mice can lead to embryonic lethality. In addition, the steroid hormone levels and fatty acid content of hsd17b12 heterozygous mutants are reduced, but the specific molecular mechanism is still unclear. Secondly, conditional knockout of hsd17b12 in the liver of mice leads to a significant decrease in the body weight of mutants, activated inflammatory responses, and reduced lipid content. These research results suggest that hsd17b12 plays an important role in metabolic regulation, but the functional studies of the homologous genes hsd17b12a and hsd17b12b in zebrafish are still insufficient.

[0005] In summary, existing technologies have made some progress in studying oocyte maturation and egg quality regulation using zebrafish models, but some challenges are still faced. These challenges include insufficient understanding of the functions and regulatory mechanisms of key genes such as hsd17b12, and the need for in-depth research on how environmental factors affect egg quality. In addition, although the zebrafish model has advantages in simulating human development, there are still certain limitations in translating research results into clinical applications. These defects suggest the direction of future research, including in-depth exploration of gene function, optimization of model systems, and strengthening research on the effects of environmental factors on egg quality.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The purpose of the present invention is to provide a method for constructing a hsd17b12a gene-deficient zebrafish. The sgRNA achieves efficient gene editing by precisely targeting the zebrafish hsd17b12a gene, constructs an egg quality defect model, helps study disease mechanisms, reduces experimental costs, and promotes the development of egg quality-related research.

[0008] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:

[0009] In a first aspect, the present invention provides an sgRNA, wherein the sgRNA targets a zebrafish hsd17b12a gene;

[0010] The nucleotide sequence of the sgRNA is shown in SEQ ID NO.1.

[0011] In a second aspect, the present invention provides a primer set, which is used to construct a gRNA in vitro transcription template for synthesizing the sgRNA as described in the above embodiment, comprising a forward primer and a reverse primer;

[0012] The nucleotide sequence of the forward primer is shown in SEQ ID NO.2;

[0013] The nucleotide sequence of the reverse primer is shown in SEQ ID NO.3.

[0014] In a third aspect, the present invention provides a method for constructing a hsd17b12a gene-deficient zebrafish, comprising:

[0015] Using the primer set described in the above embodiment, a PCR reaction is performed with pMD19T-gRNA as a template for the PCR reaction, the PCR product is purified and recovered to obtain a purified product, and the purified product is used as a gRNA in vitro transcription template;

[0016] The gRNA in vitro transcription template is transcribed in vitro using T7 transcriptase to obtain the purified sgRNA as described in the above embodiment;

[0017] Mixing the sgRNA and Cas9 mRNA to obtain a CRISPR / Cas9 injection mixture, and microinjecting the CRISPR / Cas9 injection mixture into a zebrafish one-cell stage fertilized egg;

[0018] Cultivating the fertilized egg injected with the CRISPR / Cas9 injection mixture to develop a target embryo;

[0019] According to the target embryos, hsd17b12a gene-deficient zebrafish are obtained.

[0020] In an optional embodiment, the number of zebrafish one-cell stage fertilized eggs microinjected is 200 to 500.

[0021] In an optional embodiment, the fertilized egg injected with the CRISPR / Cas9 injection mixture is cultured to develop a target embryo, comprising:

[0022] After the microinjection is completed, the fertilized eggs are cultured for the first time to obtain primary cultured embryos;

[0023] collecting the primary cultured embryos and performing a second culture to obtain secondary cultured embryos;

[0024] Extracting genomic DNA from the secondary cultured embryos, and using a screening primer set to perform PCR amplification on the target site sequence of the target site targeted by the sgRNA sequence contained in the genomic DNA, and performing sequencing using a forward screening primer in the screening primer set to obtain a sequencing result;

[0025] According to the sequencing results, the secondary cultured embryos showing chaotic peaks near the target site are screened out as the target embryos.

[0026] In an optional embodiment, the target site targeted by the sgRNA sequence is located on exon 1 of the hsd17b12a gene;

[0027] In an optional embodiment, the site sequence of the target site targeted by the sgRNA sequence is shown in SEQ ID NO.4.

[0028] In an optional embodiment, the screening primer set includes the forward screening primer and the reverse screening primer;

[0029] The nucleotide sequence of the forward screening primer is shown in SEQ ID NO.5;

[0030] The nucleotide sequence of the reverse screening primer is shown in SEQ ID NO.6.

[0031] In an optional embodiment, obtaining the hsd17b12a gene-deficient zebrafish according to the target embryo comprises:

[0032] Raising the target embryos to sexual maturity using a breeding system to obtain mature embryos;

[0033] The next generation of embryos of the mature embryos is screened for embryos with effective mutation types, and the hsd17b12a deletion mutant zebrafish is cultured.

[0034] In a fourth aspect, the present invention provides a use of the sgRNA as described in the aforementioned embodiment in constructing an egg defect model.

[0035] In a fifth aspect, the present invention provides an application of the zebrafish hsd17b12a gene targeted by sgRNA as described in the aforementioned embodiment in preparing an egg defect model.

[0036] The sgRNA, by targeting the zebrafish hsd17b12a gene and using CRISPR / Cas9 gene editing technology, achieves precise gene editing and efficient induction of gene mutations, thereby constructing a zebrafish model of egg quality defects. This method can not only replicate models that are highly similar to human diseases, reduce the cost of pharmacological experiments and drug screening, shorten the research cycle, but also improve the repeatability and reliability of the research. In addition, the application of this sgRNA is also helpful in establishing a systematic method for diagnosing pathological characteristics, conducting in-depth research on the laws of oogenesis and development, and promoting the development of egg quality medical services, providing powerful tools and models for the research and treatment of egg quality defects. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0038] Figure 1 Schematic diagram of the process of constructing the hsd17b12a gene-deficient zebrafish in the embodiment of the present application;

[0039] Figure 2A schematic diagram of the sequence of the hsd17b12a gene target site in Example 1 of the present application (including a peak diagram of the sequencing results of the mutation site and a schematic diagram of the wild-type and predicted mutant hsd17b12a protein structure);

[0040] Figure 3 The hsd17b12a embryonic development diagram is performed using the hsd17b12a gene mutant zebrafish embryo as material in Example 6 of the present application;

[0041] Figure 4 This is a statistical graph of the GVBD rate using hsd17b12a mutant zebrafish eggs as material in Example 6 of the present application;

[0042] Figure 5 This is a diagram showing the mitochondrial fluorescence observation results of hsd17b12a mutant zebrafish embryos in Example 6 of the present application;

[0043] Figure 6 This is a schematic diagram of feeding hsd17b12a mutant zebrafish embryos with a high-fat diet in Example 6 of the present application. DETAILED DESCRIPTION

[0044] The embodiments of the present invention will be described in detail below in conjunction with the examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially.

[0045] In an embodiment of the present application, a sgRNA is provided, wherein the sgRNA targets the zebrafish hsd17b12a gene; the nucleotide sequence of the sgRNA is shown in SEQ ID NO.1.

[0046] As mentioned above, sgRNA, or single guide RNA, is a key component in CRISPR / Cas9 gene editing technology. sgRNA is a man-made RNA molecule that consists of two parts: one is a guide sequence (about 20 base pairs) that can recognize and bind to the target DNA sequence, and the other is a domain that can bind to the Cas9 enzyme.

[0047] The sgRNA (single guide RNA) provided in the examples of this application is a specially designed RNA molecule whose core function is to guide the CRISPR / Cas9 gene editing system to target and edit a specific gene in the zebrafish genome: hsd17b12a. This specific sgRNA sequence is constructed to be able to complement and pair with a specific DNA sequence on the first exon of the hsd17b12a gene, thereby guiding the Cas9 enzyme to precisely cut a specific location of the gene.

[0048] As mentioned above, the nucleotide sequence of sgRNA is shown in SEQ ID NO.1, and specifically can be: 5'-GGTGGTATTACATCTCCAAGGGGTTTTAGAGCTAGAAATAGCAAGT TAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTC GGTGCT-3'.

[0049] The mechanism of action of sgRNA is based on the high specificity of the CRISPR / Cas9 system, in which sgRNA complements the target DNA sequence and guides the Cas9 enzyme to a specific gene site for cutting. In this application, the sequence of sgRNA is specially designed to recognize a specific region of the zebrafish hsd17b12a gene, allowing the Cas9 enzyme to generate double-stranded DNA breaks at this site, thereby inducing gene mutations.

[0050] The sgRNA sequence recorded in SEQ ID NO.1 is a key component in achieving gene editing, which ensures the accuracy and specificity of gene editing and avoids nonspecific editing of other non-target regions in the genome. This precise gene editing capability is crucial for studying the function of the hsd17b12a gene and its role in egg quality, and also provides a powerful tool for studying related diseases. Through this precise gene editing technology, researchers can gain a deeper understanding of the impact of gene variation on the development and function of organisms, thereby promoting the study of related disease mechanisms and the development of new therapies.

[0051] A primer set is provided in the examples of the present application, and the primer set is used to construct a gRNA in vitro transcription template for synthesizing the sgRNA as described in the above embodiment, including a forward primer and a reverse primer; the specific nucleotide sequence is shown in Table 1.

[0052] Table 1. Nucleotide sequences of primer sets

[0053]

[0054] refer to Figure 1 In the present application, a method for constructing a hsd17b12a gene-deficient zebrafish is provided, comprising:

[0055] Step S1, using the primer set described in the above embodiment, performing a PCR reaction with pMD19T-gRNA as a template for the PCR reaction, purifying and recovering the PCR product to obtain a purified product, and using the purified product as a gRNA in vitro transcription template.

[0056] In this step, a specific primer set (SEQ ID NO.2 and SEQ ID NO.3) is used to perform a PCR reaction with pMD19T-gRNA as a template, the purpose of which is to amplify a DNA fragment containing the sgRNA sequence, and the PCR product is a DNA fragment containing the sgRNA sequence. The PCR technology can quickly and massively amplify the target DNA fragment, providing sufficient templates for subsequent gRNA preparation.

[0057] Specifically, a standard PCR instrument and reaction system can be used to amplify according to a specific procedure. The PCR reaction achieves the amplification of the target DNA fragment and provides a template for the next step of gRNA in vitro transcription.

[0058] As mentioned above, the PCR product is purified and recovered, that is, a pure DNA fragment containing the sgRNA sequence is extracted from the PCR reaction mixture to obtain a purified sgRNA template DNA. In this step, impurities in the PCR reaction, such as unbound primers, enzymes, and salts, are removed to provide a clean template for in vitro transcription. This step can use a commercial PCR product purification kit such as GeneJET PCR Purification Kit (Thermo Fisher, K0701).

[0059] Step S2, in vitro transcription of the gRNA in vitro transcription template using T7 transcriptase to obtain the purified sgRNA as described in the above embodiment.

[0060] As mentioned above, T7 transcriptase (T7 RNA polymerase), referred to as T7 RNAP or T7 Pols, is an enzyme from Escherichia coli bacteriophage T7. It is a strong and specific RNA polymerase used to synthesize RNA under in vitro conditions.

[0061] As described above, the DNA template purified in step S1 is transcribed into sgRNA using T7 transcriptase, thereby obtaining a large amount of sgRNA, which will be used for subsequent gene editing.

[0062] In vitro transcription can efficiently synthesize RNA from DNA templates, and it is simple to operate and low-cost.

[0063] Specifically, an in vitro transcription kit such as the T7 High Yield RNA Transcription Kit (TR101-01) of Novazon can be used according to the manufacturer's instructions. It can be carried out in a reaction system containing T7 transcriptase and reacted according to the conditions of the transcription reaction. In vitro transcription achieves the conversion from DNA template to RNA and produces sgRNA for gene editing.

[0064] Step S3, mixing the sgRNA and Cas9 mRNA to obtain a CRISPR / Cas9 injection mixture, and microinjecting the CRISPR / Cas9 injection mixture into a zebrafish one-cell stage fertilized egg.

[0065] As mentioned above, Cas9 mRNA refers to the messenger RNA that encodes the Cas9 protein. In the CRISPR / Cas9 gene editing system, the Cas9 protein is a nuclease that can recognize and cut specific DNA sequences. The role of Cas9 mRNA is to deliver the genetic information of the Cas9 protein to cells, allowing the cells to translate and produce the Cas9 protein. The mixing of Cas9 mRNA and sgRNA is to quickly form an effective CRISPR / Cas9 gene editing complex in cells, thereby accurately targeting and editing specific gene sequences. This method plays an important role in improving the efficiency and accuracy of gene editing.

[0066] As described above, the sgRNA purified in step S2 is mixed with Cas9 mRNA to prepare a CRISPR / Cas9 injection mixture, which will be used for gene editing of fertilized eggs. The preparation of this mixture enables sgRNA and Cas9 mRNA to be introduced into fertilized eggs at the same time, thereby improving the efficiency of gene editing.

[0067] Specifically, the concentration can be adjusted to a state suitable for injection by physically mixing sgRNA and Cas9 mRNA. The mixing process achieves the synergistic effect of sgRNA and Cas9 mRNA, providing the necessary components for gene editing.

[0068] As described above, the CRISPR / Cas9 injection mixture is microinjected into zebrafish one-cell stage fertilized eggs and cultured, so that the fertilized eggs develop into target embryos after gene editing.

[0069] Microinjection technology can accurately introduce gene editing tools into embryos, and the development of embryos can be observed during the culture process. Specifically, the mixture can be injected into fertilized eggs using a microinjection device, and then cultured under appropriate culture conditions. Microinjection achieves precise delivery of gene editing tools, and the culture process provides the necessary conditions for embryo development.

[0070] Step S4, culturing the fertilized egg injected with the CRISPR / Cas9 injection mixture to develop a target embryo.

[0071] In the above, the fertilized eggs injected with the CRISPR / Cas9 injection mixture are cultured. The fertilized eggs are cultured under suitable conditions to develop into embryos, thereby obtaining developing embryos. In this step, the gene-edited embryos are allowed to develop normally for subsequent screening and analysis.

[0072] Step S5, obtaining hsd17b12a gene-deficient zebrafish according to the target embryo.

[0073] By screening the target embryos obtained in step S4, zebrafish with hsd17b12a gene deletion mutation were identified, thus successfully constructing a zebrafish model with hsd17b12a deletion mutation, which can be used as a model for studying egg defects. The establishment of this model provides a reliable experimental system for studying egg quality defects and helps to deeply understand the molecular mechanisms of related diseases.

[0074] Mutants can be screened by molecular biology methods (such as PCR and sequencing) and phenotypes analyzed.

[0075] Throughout the above process, there are synergistic effects between the various steps. For example, the PCR reaction provides sufficient DNA templates, and in vitro transcription efficiently converts these templates into sgRNAs. The mixture of these sgRNAs and Cas9 mRNA further enhances the ability of gene editing. Microinjection precisely introduces these mixtures into fertilized eggs, while the culture process supports the development of embryos and the manifestation of gene editing effects. Finally, the screening process ensures the successful construction of a zebrafish model with a specific gene mutation, laying the foundation for subsequent research. These steps work together to achieve efficient and precise gene editing and model construction.

[0076] In the present application example, by using the deletion mutation zebrafish on exon 1 of the hsd17b12a gene as an experimental animal model, a disease model with a high similarity to human diseases was successfully replicated, and this model can more accurately simulate human disease characteristics and their occurrence mechanism. In addition, a set of systematic pathological feature diagnostic methods have also been established in the present application example, specifically for the zebrafish egg quality defect model, which not only improves the repeatability and reliability of the research, but also reduces the cost of pharmacological experiments and drug screening. The method is low in cost and short in cycle, and effectively promotes the in-depth study of the egg quality mechanism, and provides the possibility for the exploration of new treatment methods for egg quality defects. At the same time, the method provided in the application example also helps to deeply understand the occurrence and development of eggs, and lays a solid foundation for promoting the development of egg quality medical career.

[0077] In some embodiments, the number of microinjected into zebrafish one-cell stage fertilized eggs is 200 to 500. For example, it can be 200, 300, 400, 500, etc.

[0078] In some embodiments, the step S4, culturing the fertilized egg injected with the CRISPR / Cas9 injection mixture to develop a target embryo, comprises:

[0079] Step S41, after completing the microinjection, the fertilized eggs are cultured for the first time to obtain primary cultured embryos.

[0080] As mentioned above, after completing the microinjection, the fertilized eggs are cultured for the first time to obtain primary cultured embryos. After the CRISPR / Cas9 injection mixture is injected into the single-cell stage fertilized eggs, these fertilized eggs are placed in a suitable culture environment to allow them to develop. Primary cultured embryos are obtained. This step ensures that the embryos can develop normally after gene editing at the fertilized egg stage.

[0081] Specifically, the culture can be carried out under controlled temperature and culture medium conditions, and the culture time can be, for example, 24 hours.

[0082] Step S42, collecting the primary cultured embryos and performing a second culture to obtain secondary cultured embryos.

[0083] In the above, the embryos of the primary culture are collected and cultured for the second time to obtain secondary culture embryos. Healthy individuals are selected from the embryos of the first culture and cultured further to obtain further developed embryos.

[0084] This step is used to screen out healthy embryos and provide materials for subsequent gene editing effect testing.

[0085] Specifically, the culture may continue in a suitable culture environment, and the culture time may be 24 hours.

[0086] For example, the culture environment in this step is to place some of the one-cell stage zebrafish fertilized eggs after microinjection in 0.3x Danieauˋs buffer.

[0087] As mentioned above, in the embodiments of the present application, two culturing steps (each lasting 24 hours) are performed to ensure that the fertilized eggs have enough time to develop into embryos that can be analyzed for gene editing effects.

[0088] First, the first culture allows the fertilized egg to develop from the single-cell stage to the multi-cell stage, which is a critical period for early embryonic development, and provides enough time for the CRISPR / Cas9 system to work in the cell, including the cutting and repair process of DNA, which may lead to insertion or deletion mutations. The subsequent second culture further ensures that the embryo develops to a stage suitable for genotyping analysis, which is crucial for subsequent PCR amplification and sequencing analysis because sufficient embryonic tissue is required to extract high-quality genomic DNA. In addition, by culturing twice, embryos that may be damaged in early development due to injection pressure or other environmental factors can be screened out, thereby improving the accuracy of subsequent gene editing effect analysis. This culture strategy may also be an optimization in experimental design, aiming to balance the needs of experimental efficiency and embryonic development, based on the optimal culture time determined by experimental data to maximize the success rate of gene editing and embryo survival rate. Ultimately, two cultures help ensure that the data obtained reflect the long-term effects of gene editing, rather than just short-term phenotypic changes, and improve the success rate of the experiment and the reliability of the results.

[0089] Step S43, extracting genomic DNA from the secondary cultured embryos, and using a screening primer set to perform PCR amplification on the target site sequence of the target site targeted by the sgRNA sequence contained in the genomic DNA, and sequencing using the forward screening primer in the screening primer set to obtain a sequencing result.

[0090] As described above, genomic DNA is extracted from the secondary cultured embryos, that is, DNA is extracted from the developing embryos for subsequent gene editing effect detection, thereby obtaining genomic DNA for analysis. In short, this step is used to provide a template for molecular biological verification of gene editing effects.

[0091] Step S44, based on the sequencing results, the secondary cultured embryos showing chaotic peaks near the target point are screened out as the target embryos.

[0092] As mentioned above, in the context of CRISPR / Cas9 gene editing technology, "disordered peaks near the target site" refers to the abnormal peak pattern observed in a specific area when sequencing and analyzing the target DNA sequence. Such abnormal peaks, or "disordered peaks", are usually caused by insertion or deletion mutations caused by gene editing, because these mutations change the normal nucleotide sequence in the target area and its surroundings, resulting in irregular peaks on the sequencing map. These disordered peaks are key indicators for confirming whether gene editing is successful, as they indicate that the expected DNA sequence changes have occurred near the target site. By analyzing these disordered peaks, the editing effects caused by the CRISPR / Cas9 system can be evaluated, including the frequency and type of editing, so that successfully edited samples can be screened for further research and analysis.

[0093] As described above, based on the sequencing results, secondary culture embryos showing random peaks near the target site are screened as target embryos. The sequencing results are analyzed to identify embryos showing insertions or deletions (random peaks), indicating that gene editing may have occurred, and successfully edited embryos are screened.

[0094] This step is used to accurately identify embryos carrying target gene mutations and provide an accurate model for subsequent research.

[0095] In some embodiments, the target site of the sgRNA sequence is located on exon 1 of the hsd17b12a gene.

[0096] In some embodiments, the site sequence of the target site targeted by the sgRNA sequence is shown as SEQ ID NO.4.

[0097] As mentioned above, the site sequence of the target site targeted by the sgRNA sequence is shown in SEQ ID No. 4, specifically: 5`-GGATATGGGTGCTGGGAAACCGG-3`.

[0098] In some embodiments, the screening primer set includes the forward screening primer and the reverse screening primer; the nucleotide sequence of the forward screening primer is shown in SEQ ID NO.5; the nucleotide sequence of the reverse screening primer is shown in SEQ ID NO.6.

[0099] A screening primer set in the embodiment of the present application is a pair of DNA primers used in the PCR amplification and sequencing process, which are used to detect whether CRISPR / Cas9 gene editing has successfully introduced a mutation at the target site (exon 1 of the hsd17b12a gene). The screening primer set includes a forward screening primer and a reverse screening primer, which are respectively bound to the complementary strands of the target DNA sequence and are used to amplify a DNA fragment containing the target site. The details are shown in Table 2.

[0100] Table 2. Nucleotide sequences of screening primer sets

[0101] name SEQ ID NO. Nucleotide sequence (5`-3`) Forward screening primers 5 ACTAGTATGTTAGAGGAGTTGTAG Reverse screening primers 6 ACAATCACCCCCCATTTGTG

[0102] It should be noted that the above-mentioned forward screening primers are not only amplification primers for PCR amplification of genomic DNA, but also primers for Sanger DNA sequencing in step S43 of the method of this embodiment.

[0103] In some embodiments, the step S5, obtaining the hsd17b12a gene-deficient zebrafish according to the target embryo, comprises:

[0104] Step S51, raising the target embryos to sexual maturity using a breeding system to obtain mature embryos;

[0105] As mentioned above, the target embryos that have been gene-edited are raised to sexual maturity using a breeding system to obtain mature embryos. That is, after gene editing and preliminary screening, the selected embryos need to mature so that they can reproduce offspring, thereby obtaining sexually mature zebrafish, ensuring that the effects of gene editing can be passed on to the germ cells of zebrafish, so that the effects of the mutation can be observed in the next generation.

[0106] Specifically, zebrafish can be raised under controlled environmental conditions, including suitable temperature, light and nutrition.

[0107] Step S52, screening the next generation of embryos of the mature embryos for embryos with effective mutation types, and culturing to obtain the hsd17b12a deletion mutant zebrafish.

[0108] As mentioned above, the next generation of embryos from mature embryos are screened for embryos with effective mutation types. Embryos carrying specific gene mutations are screened from the offspring of sexually mature zebrafish, and embryos carrying hsd17b12a deletion mutations are obtained, ensuring that the research focus is on embryos with a specific genetic background, which can be used for further biological research.

[0109] The present application provides an application of the sgRNA described in the aforementioned embodiment in constructing an egg defect model.

[0110] The present application provides an application of the zebrafish hsd17b12a gene targeted by sgRNA as described in the aforementioned embodiment in preparing an egg defect model.

[0111] The present invention is further described below by means of specific examples, but it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0112] Example 1

[0113] In this example, a single guide RNA (sgRNA) and its corresponding primer set were designed and constructed, which are specifically used to target exon 1 of the zebrafish hsd17b12a gene to achieve CRISPR / Cas9-mediated gene knockout.

[0114] 1. Design and synthesize sgRNA:

[0115] (1) sgRNA design: Based on the CRISPER / Cas9 knockout principle, a sgRNA sequence containing the hsd17b12a gene target site sequence was designed and synthesized, where the hsd17b12a gene target site is as follows: Figure 2 As shown in the figure, the underlined gene sequence is the target sequence, and the underlined 7 bases are:

[0116] GAGATCA is the specific sequence for the insertion mutation.

[0117] (2) sgRNA synthesis: sgRNA was synthesized by an in vitro transcription method using an in vitro transcription template with SEQ ID NO.1 sequence as a template.

[0118] 2. Design and synthesize primer sets:

[0119] In order to construct an in vitro transcription template for sgRNA, a pair of PCR primers was synthesized in this example, including a forward primer sequence of SEQ ID NO.2 and a reverse primer sequence of SEQ ID No.3.

[0120] SEQ ID NO.2:

[0121] 5ˋ-TGTAATACGACTCACTATAGGATATGGGTGCTGGGAAACGTTTTAGAG CTAGAAATAGC-3ˋ;

[0122] SEQ ID NO.3:

[0123] 5ˋ-AAAAAAAGCACCGACTCGGTGCCAC-3ˋ.

[0124] Through these steps, the sgRNA targeting the zebrafish hsd17b12a gene and its primer set were successfully designed in this example, providing the necessary tools for subsequent gene knockout experiments. These tools will be used to introduce the CRISPR / Cas9 system into zebrafish fertilized eggs to achieve precise editing of the hsd17b12a gene, thereby creating a zebrafish model with gene mutation and egg quality defects.

[0125] Example 2: Preparation of gRNA in vitro transcription template

[0126] In this example, a gRNA in vitro transcription template was prepared.

[0127] Experimental methods:

[0128] The gRNA in vitro transcription template prepared in Example 2 was used for PCR with pMD19T-gRNA as a template for PCR reaction, and the PCR product was purified and recovered to prepare a gRNA in vitro transcription template.

[0129] 1. Prepare the reaction system:

[0130] The reaction system was prepared according to the components shown in Table 3.

[0131] Table 3. Reaction system

[0132] NO. Components Dosage μL 1 2x PCR mix 25 2 pMD19T-gRNA (50 ng / μL) 0.5 3 Forward primer (10uM) 2 4 Reverse primer (10uM) 2 5 <![CDATA[H2O]]> 20.5 6 Total 50

[0133] (2) PCR procedure:

[0134] Prepare 200 μL of the above reaction system. The PCR program includes:

[0135] Initial denaturation was at 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 30 s, and a final extension at 72°C for 10 min.

[0136] Finally, the PCR product is obtained, which is a DNA fragment containing the target sgRNA sequence.

[0137] 2. PCR product purification and recovery:

[0138] The PCR product purification and recovery steps include:

[0139] (1) Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CB2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~13,400 × g) for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube.

[0140] (2) Estimate the volume of the PCR reaction solution or enzyme digestion reaction solution, add 5 times the volume of Binding Buffer PB to it, and mix thoroughly.

[0141] (3) Add the solution obtained in the previous step to an adsorption column CB2 (the adsorption column is placed in a collection tube), leave it at room temperature for 2 minutes, centrifuge it at 12,000 rpm (~13,400×g) for 30-60 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CB2 in the collection tube.

[0142] (4) Add 600 μL of rinse solution PW to the adsorption column CB2 (check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (~13,400×g) for 30-60 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CB2 in the collection tube.

[0143] (5) Repeat step 4(4)

[0144] (6) Place the adsorption column CB2 back into the collection tube and centrifuge at 12,000 rpm (~13,400 × g) for 2 min to remove as much rinsing solution as possible. Place the adsorption column CB2 at room temperature for several minutes to dry thoroughly to prevent residual rinsing solution from affecting the next step of the experiment.

[0145] (7) Place the adsorption column CB2 in a clean centrifuge tube, add 30-50 μl of elution buffer EB to the middle of the adsorption membrane, and leave it at room temperature for 2 minutes. Centrifuge at 12,000 rpm (~13,400 × g) for 2 minutes to collect the DNA solution.

[0146] Example 3

[0147] In this example, gRNA was prepared.

[0148] Experimental methods:

[0149] The gRNA in vitro transcription template prepared in Example 2 was transcribed in vitro using T7 transcriptase, purified and recovered to obtain gRNA.

[0150] 1. Prepare T7 RNA transcription reaction system:

[0151] Prepare the in vitro transcription reaction system according to Table 4.

[0152] Table 4. Reaction system

[0153] NO. Components Dosage 1 2.5 mM NTP 4μL 2 10x Reaction Buffer 2μL 3 gRNA in vitro transcription template 0.5 μg~1 μg 4 T7 RNA polymerase 2μL 5 Enzyme-free water Add to 20 μL

[0154] 2. In vitro transcription:

[0155] The reaction was allowed to react at 37°C for 1 hour, and gRNA was transcribed from the gRNA in vitro transcription template using T7 RNA polymerase.

[0156] In this step, the reaction system prepared in step 1 is used to obtain a newly synthesized gRNA.

[0157] 3. DNase I treatment:

[0158] Removal of DNA template:

[0159] 2.5 μL 10X buffer and 2 μL DNase I were added to the transcription reaction product, and the reaction was carried out at 37°C for 15 minutes to remove the DNA template and obtain a gRNA solution excluding the DNA template.

[0160] 4. Purification of synthesized gRNA:

[0161] In this step, SigmaSpin TM Sequencing reaction clean-up kit for purification.

[0162] The purification column was placed in a 2 mL collection tube and centrifuged at 2800 rpm for 15 seconds.

[0163] Twist off the sealing column at the bottom of the tube, discard the tube cap, put the purification column back into the collection tube, and centrifuge at 2800 rpm for 2 minutes.

[0164] Place the purification column in a new RNase-free EP tube and discard the collection tube.

[0165] Add the gRNA synthesis solution to the purification column and centrifuge at 2800 rpm for 4 minutes.

[0166] The column liquid is collected, detected by electrophoresis and the concentration is determined to obtain the purified gRNA for storage.

[0167] 5. Save gRNA:

[0168] The purified gRNA was stored in a -80℃ refrigerator for later use. The stored gRNA can be used for subsequent experiments.

[0169] Through the above steps in this example, gRNA was successfully prepared and purified from the gRNA in vitro transcription template, providing a key guide RNA component for the CRISPR / Cas9 gene editing system. Finally, purified gRNA was obtained for use in subsequent gene editing experiments.

[0170] Example 4: Synthesis of Cas9 mRNA

[0171] In this example, a plasmid containing the full-length sequence of zebrafish codon-optimized Cas9 was linearized by restriction endonuclease digestion, and purified and recovered using GeneJET PCR Purification Kit for use as a transcription template.

[0172] 1. Starting from a plasmid containing the full-length zebrafish codon-optimized Cas9 sequence, linearize it using restriction endonucleases to obtain a DNA template for transcription.

[0173] 2. Use GeneJET PCR Purification Kit to purify and recover the plasmid after enzyme digestion to ensure that a pure DNA template is obtained and provide a high-quality template for in vitro transcription.

[0174] The purification process includes the following steps:

[0175] (1) Column equilibration: Add 500 μL of equilibration solution BL to the adsorption column CB2 and centrifuge at 12,000 rpm for 1 minute. Then, discard the waste liquid and put it back into the collection tube.

[0176] (2) Add 5 times the volume of Binding Buffer PB according to the volume of PCR reaction solution or enzyme digestion reaction solution and mix thoroughly.

[0177] (3) The mixed solution was added to the adsorption column CB2, and after being placed at room temperature for 2 minutes, the mixture was centrifuged at 12,000 rpm for 30-60 seconds, and the waste liquid was discarded.

[0178] (4) Add 600 μL of the rinse solution PW to which anhydrous ethanol has been added to the adsorption column CB2, centrifuge again at 12,000 rpm for 30-60 seconds, and discard the waste liquid.

[0179] (5) After repeating this rinsing step, the adsorption column CB2 was placed back into the collection tube and centrifuged at 12,000 rpm for 2 min to remove excess rinsing solution. The adsorption column CB2 was then dried at room temperature to prevent the residual rinsing solution from affecting subsequent experiments.

[0180] (6) Finally, place the adsorption column CB2 in a clean centrifuge tube and add 30 μL to 50 μL of elution buffer EB to the middle of the adsorption membrane. After standing at room temperature for 2 minutes, centrifuge at 12,000 rpm for 2 minutes to collect the purified DNA solution.

[0181] 3. Synthesis: Ambion's mMessage mMachine in vitro transcription kit was used to synthesize Cas9 mRNA. The reaction system is shown in Table 5.

[0182] Table 5. Reaction system

[0183] NO. Components Dosage 1 DNA template 0.5~1 μg 2 2x NTP / CAP 5μL 3 10x reaction buffer 1μL 4 Enzyme mix 1μL 5 Enzyme-free water Add to 10 μL

[0184] The above reaction system was mixed and incubated in a 37°C water bath for 2 hours to obtain Cas9 mRNA.

[0185] 4. Purification and recovery of Cas9 mRNA:

[0186] (1) Add 1 μL of the DNA enzyme included in the kit to the reaction system, mix well, and place in a 37°C water bath for 15 minutes to remove the DNA template.

[0187] (2) Add 20 μL of 5 M ammonium acetate, mix well, and place on ice for 10 minutes to allow mRNA precipitation.

[0188] (3) Centrifuge at 12,000 rpm for 15 minutes at 4°C to collect the mRNA as a white precipitate.

[0189] (4) After discarding the supernatant, wash the precipitate with 75% ethanol and centrifuge at 7,500 rpm for 5 minutes at 4°C.

[0190] (5) Discard the supernatant, dry the precipitate, and add 10 μL of enzyme-free water to dissolve it.

[0191] (6) Take 0.5 μL of RNA and dilute it 20 times to detect the concentration and purity. Then take 10 μL of the dilution and perform agarose gel electrophoresis to detect the degree of mRNA degradation.

[0192] Through the above experimental method in this example, Cas9 mRNA was synthesized from a plasmid containing the zebrafish codon-optimized Cas9 full-length sequence, providing a key RNA component for CRISPR / Cas9 gene editing experiments.

[0193] Example 5: Microinjection

[0194] In this example, the purified gRNA and Cas9 mRNA obtained in Example 3 were mixed and microinjected into single-cell stage zebrafish fertilized eggs, with 1 nL injected into each embryo.

[0195] Experimental methods:

[0196] After the gRNA (Example 3) and Cas9 mRNA (Example 4) were synthesized, the injection sample was prepared according to the following system. The 3 μL injection system is shown in Table 6.

[0197] Table 6. Injection system

[0198] NO. Components Dosage 1 Cas9 mRNA 500ng / μL 2 gRNA 50–100 ng / μL 3 Phenol red 0.5μL 4 Enzyme-free water Add to 3 μL

[0199] The number of injected single-cell stage zebrafish fertilized egg embryos is 200 to 500. In this embodiment, the number of injected embryos is 500.

[0200] Example 6: Obtaining an egg defect model

[0201] In this example, PCR amplification and sequencing were used to verify the gene editing effect introduced by the CRISPR / Cas9 system in zebrafish embryos, and then the successfully edited zebrafish were screened to construct an egg defect model.

[0202] Experimental methods:

[0203] 1. After microinjection of the CRISPR / Cas9 injection mixture into zebrafish one-cell stage fertilized eggs, these fertilized eggs were cultured for 24 hours to develop into embryos. At this stage, some embryos were collected and genomic DNA was extracted from them in preparation for the next step of PCR amplification.

[0204] 2. Perform PCR amplification to detect the target site sequence. The PCR reaction system used is shown in Table 7.

[0205] Table 7. PCR reaction system

[0206]

[0207] The PCR program was set as a preliminary denaturation at 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s, and finally an extension at 72°C for 10 min.

[0208] In this process, the screening primer sets used were:

[0209] The forward screening primer sequence is SEQ ID NO.5 (5'-GCTTCCTTTGACCGAGTA-3'), and the reverse screening primer sequence is SEQ ID NO.6 (5'-AAACTGAGGGACCACATC-3'). The primer of SEQ ID No.5 is also used for Sanger DNA sequencing.

[0210] 3. Sequencing: After PCR amplification, the product is sequenced to verify whether the expected mutation has occurred at the target site. The embryos with random peaks near the target site in the sequencing results are considered to be successfully edited, and these embryos are then placed in a breeding system and raised to sexual maturity.

[0211] 4. For sexually mature zebrafish, the same PCR and sequencing methods were used again to screen the next generation of embryos to detect effective mutation types. Through this screening process, zebrafish with hsd17b12a gene mutations were finally obtained, thus constructing an egg defect model, which is of great significance for studying gene function and disease mechanism.

[0212] 5. Effects of gene deletion on early embryonic development of zebrafish:

[0213] (1) hsd17b12a deletion mutant zebrafish (zebrafish model) were used for embryonic development observation;

[0214] like Figure 3 As shown, compared with wild-type zebrafish, embryos using the hsd17b12a gene mutation provided in this example do not cleave during development.

[0215] (2) taking the hsd17b12a deletion mutant zebrafish from step S7 to perform GVBD rate statistics;

[0216] like Figure 4 As shown, compared with wild-type zebrafish, the GVBD rate of the hsd17b12a gene mutation provided by this example is significantly reduced.

[0217] (3) Observe the mitochondria of the hsd17b12a deletion mutant zebrafish obtained in step S7;

[0218] like Figure 5 As shown, compared with wild-type zebrafish, the mitochondria of the hsd17b12a gene mutation provided in this example are abnormal.

[0219] (4) Take the statistics of high-fat diet feeding of hsd17b12a deletion mutant zebrafish in step S7.

[0220] like Figure 6 As shown, compared with the hsd17b12a gene mutant zebrafish, the hsd17b12a gene mutant provided in this example can rescue the cleavage abnormality after high-fat feeding.

[0221] (5) By analyzing the data obtained in steps (1) to (4), the egg quality defects of hsd17b12a deletion mutant zebrafish are described.

[0222] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A sgRNA, characterized in that The sgRNA targets the zebrafish hsd17b12a gene; The nucleotide sequence of the sgRNA is shown in SEQ ID NO.

1.

2. A primer set, characterized in that: The primer set is used to construct a gRNA in vitro transcription template for synthesizing the sgRNA according to claim 1, comprising a forward primer and a reverse primer; The nucleotide sequence of the forward primer is shown in SEQ ID NO.2; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.

3.

3. A method for constructing a hsd17b12a gene-deficient zebrafish, characterized in that: include: Using the primer set as claimed in claim 2, a PCR reaction is performed using pMD19T-gRNA as a template for the PCR reaction, purifying and recovering the PCR product to obtain a purified product, and using the purified product as a gRNA in vitro transcription template; The gRNA in vitro transcription template is transcribed in vitro using T7 transcriptase to obtain the purified sgRNA according to claim 1; Mixing the sgRNA and Cas9 mRNA to obtain a CRISPR / Cas9 injection mixture, and microinjecting the CRISPR / Cas9 injection mixture into a zebrafish one-cell stage fertilized egg; Cultivating the fertilized egg injected with the CRISPR / Cas9 injection mixture to develop a target embryo; According to the target embryos, hsd17b12a gene-deficient zebrafish are obtained.

4. The method for constructing the hsd17b12a gene-deficient zebrafish according to claim 3, characterized in that: The number of microinjected into zebrafish single-cell stage fertilized eggs is 200 to 500.

5. The method for constructing the hsd17b12a gene-deficient zebrafish according to claim 3, characterized in that: The step of culturing the fertilized egg injected with the CRISPR / Cas9 injection mixture to develop a target embryo comprises: After the microinjection is completed, the fertilized eggs are cultured for the first time to obtain primary cultured embryos; collecting the primary cultured embryos and performing a second culture to obtain secondary cultured embryos; Extracting genomic DNA from the secondary cultured embryos, and using a screening primer set to perform PCR amplification on the target site sequence of the target site targeted by the sgRNA sequence contained in the genomic DNA, and performing sequencing using a forward screening primer in the screening primer set to obtain a sequencing result; According to the sequencing results, the secondary cultured embryos showing chaotic peaks near the target site are screened out as the target embryos.

6. The method for constructing the hsd17b12a gene-deficient zebrafish according to claim 3, characterized in that: The target site targeted by the sgRNA sequence is located on exon 1 of the hsd17b12a gene; Preferably, the site sequence of the target site targeted by the sgRNA sequence is shown as SEQ ID NO.

4.

7. The method for constructing the hsd17b12a gene-deficient zebrafish according to claim 5, characterized in that: The screening primer set includes the forward screening primer and the reverse screening primer; The nucleotide sequence of the forward screening primer is shown in SEQ ID NO.5; The nucleotide sequence of the reverse screening primer is shown in SEQ ID NO.

6.

8. The method for constructing the hsd17b12a gene-deficient zebrafish according to claim 3, characterized in that: The method of obtaining the hsd17b12a gene-deficient zebrafish according to the target embryo comprises: Raising the target embryos to sexual maturity using a breeding system to obtain mature embryos; The next generation of embryos of the mature embryos is screened for embryos with effective mutation types, and the hsd17b12a deletion mutant zebrafish is cultured.

9. Use of the sgRNA as claimed in claim 1 in constructing an egg defect model.

10. Use of the zebrafish hsd17b12a gene targeted by the sgRNA as claimed in claim 1 in preparing an egg defect model.

Images